ID: 1152713987

View in Genome Browser
Species Human (GRCh38)
Location 17:81889514-81889536
Sequence CTGAGGGCTCCTGCCATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152713983_1152713987 -7 Left 1152713983 17:81889498-81889520 CCAAGAGCACCTGGGTCTGAGGG 0: 1
1: 0
2: 5
3: 24
4: 299
Right 1152713987 17:81889514-81889536 CTGAGGGCTCCTGCCATTGTGGG 0: 1
1: 0
2: 3
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152713987 Original CRISPR CTGAGGGCTCCTGCCATTGT GGG Intronic