ID: 1152713988

View in Genome Browser
Species Human (GRCh38)
Location 17:81889515-81889537
Sequence TGAGGGCTCCTGCCATTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152713983_1152713988 -6 Left 1152713983 17:81889498-81889520 CCAAGAGCACCTGGGTCTGAGGG 0: 1
1: 0
2: 5
3: 24
4: 299
Right 1152713988 17:81889515-81889537 TGAGGGCTCCTGCCATTGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152713988 Original CRISPR TGAGGGCTCCTGCCATTGTG GGG Intronic