ID: 1152713992

View in Genome Browser
Species Human (GRCh38)
Location 17:81889541-81889563
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152713990_1152713992 -9 Left 1152713990 17:81889527-81889549 CCATTGTGGGGACCTGACACGTG 0: 1
1: 0
2: 1
3: 4
4: 71
Right 1152713992 17:81889541-81889563 TGACACGTGTACCACGATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 33
1152713985_1152713992 11 Left 1152713985 17:81889507-81889529 CCTGGGTCTGAGGGCTCCTGCCA 0: 1
1: 0
2: 3
3: 44
4: 446
Right 1152713992 17:81889541-81889563 TGACACGTGTACCACGATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 33
1152713983_1152713992 20 Left 1152713983 17:81889498-81889520 CCAAGAGCACCTGGGTCTGAGGG 0: 1
1: 0
2: 5
3: 24
4: 299
Right 1152713992 17:81889541-81889563 TGACACGTGTACCACGATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 33
1152713989_1152713992 -5 Left 1152713989 17:81889523-81889545 CCTGCCATTGTGGGGACCTGACA 0: 1
1: 0
2: 2
3: 11
4: 106
Right 1152713992 17:81889541-81889563 TGACACGTGTACCACGATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type