ID: 1152713993

View in Genome Browser
Species Human (GRCh38)
Location 17:81889547-81889569
Sequence GTGTACCACGATGCAGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 31}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152713985_1152713993 17 Left 1152713985 17:81889507-81889529 CCTGGGTCTGAGGGCTCCTGCCA 0: 1
1: 0
2: 3
3: 44
4: 446
Right 1152713993 17:81889547-81889569 GTGTACCACGATGCAGGTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 31
1152713983_1152713993 26 Left 1152713983 17:81889498-81889520 CCAAGAGCACCTGGGTCTGAGGG 0: 1
1: 0
2: 5
3: 24
4: 299
Right 1152713993 17:81889547-81889569 GTGTACCACGATGCAGGTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 31
1152713990_1152713993 -3 Left 1152713990 17:81889527-81889549 CCATTGTGGGGACCTGACACGTG 0: 1
1: 0
2: 1
3: 4
4: 71
Right 1152713993 17:81889547-81889569 GTGTACCACGATGCAGGTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 31
1152713989_1152713993 1 Left 1152713989 17:81889523-81889545 CCTGCCATTGTGGGGACCTGACA 0: 1
1: 0
2: 2
3: 11
4: 106
Right 1152713993 17:81889547-81889569 GTGTACCACGATGCAGGTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152713993 Original CRISPR GTGTACCACGATGCAGGTAG AGG Intronic