ID: 1152714325

View in Genome Browser
Species Human (GRCh38)
Location 17:81891297-81891319
Sequence AGTGCGGAGGCCGGCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 252}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152714325_1152714328 -9 Left 1152714325 17:81891297-81891319 CCGGCGCGGCCGGCCTCCGCACT 0: 1
1: 0
2: 1
3: 20
4: 252
Right 1152714328 17:81891311-81891333 CTCCGCACTCACCCTGCTGTAGG 0: 1
1: 0
2: 0
3: 16
4: 169
1152714325_1152714331 -2 Left 1152714325 17:81891297-81891319 CCGGCGCGGCCGGCCTCCGCACT 0: 1
1: 0
2: 1
3: 20
4: 252
Right 1152714331 17:81891318-81891340 CTCACCCTGCTGTAGGGCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 134
1152714325_1152714336 21 Left 1152714325 17:81891297-81891319 CCGGCGCGGCCGGCCTCCGCACT 0: 1
1: 0
2: 1
3: 20
4: 252
Right 1152714336 17:81891341-81891363 TCGGTTCCTGCCGCCTCCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 78
1152714325_1152714333 2 Left 1152714325 17:81891297-81891319 CCGGCGCGGCCGGCCTCCGCACT 0: 1
1: 0
2: 1
3: 20
4: 252
Right 1152714333 17:81891322-81891344 CCCTGCTGTAGGGCGCCGGTCGG 0: 1
1: 0
2: 1
3: 4
4: 63
1152714325_1152714329 -8 Left 1152714325 17:81891297-81891319 CCGGCGCGGCCGGCCTCCGCACT 0: 1
1: 0
2: 1
3: 20
4: 252
Right 1152714329 17:81891312-81891334 TCCGCACTCACCCTGCTGTAGGG 0: 1
1: 0
2: 0
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152714325 Original CRISPR AGTGCGGAGGCCGGCCGCGC CGG (reversed) Intronic