ID: 1152718114

View in Genome Browser
Species Human (GRCh38)
Location 17:81909546-81909568
Sequence CTGCGCCAGGCACGGGCCAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152718114_1152718123 17 Left 1152718114 17:81909546-81909568 CCCATGGCCCGTGCCTGGCGCAG 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1152718123 17:81909586-81909608 AATGCACCATGTCATAGCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 127
1152718114_1152718121 -10 Left 1152718114 17:81909546-81909568 CCCATGGCCCGTGCCTGGCGCAG 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1152718121 17:81909559-81909581 CCTGGCGCAGCTGGTTGGAGTGG 0: 1
1: 0
2: 0
3: 11
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152718114 Original CRISPR CTGCGCCAGGCACGGGCCAT GGG (reversed) Exonic
900226710 1:1536438-1536460 CTGTGCCAGGCAAGGGCAAGGGG - Intronic
900385339 1:2408007-2408029 CTGGGCCAGGCAGGGGCGAGGGG + Intronic
900556662 1:3284073-3284095 CTGCCCCAGGCCCAGGCCATGGG - Intronic
900699285 1:4034115-4034137 CAGGGCCAGGCATGGGGCATGGG + Intergenic
901163709 1:7199497-7199519 GTGCACCAGGCACAGGACATGGG - Intronic
903263167 1:22142271-22142293 CAGCGCCAGCCCCGGGCCCTGGG + Intronic
905278366 1:36833555-36833577 CTGCTCCAGGCTGGGGCAATGGG + Intronic
905480595 1:38259286-38259308 GTGTGCCAGGCACCGGCCAGTGG - Intergenic
905866955 1:41381861-41381883 CTGCGGCAGGCACCGGCCCCGGG - Exonic
909565251 1:77046441-77046463 CTGCACCAGGCAGGAGGCATGGG + Intronic
914748332 1:150515430-150515452 CTGCGCCAGCCAGGGGCAAGCGG + Intergenic
915471167 1:156126563-156126585 CTGCAGCAGGCCCGGGCCCTTGG - Intronic
915558064 1:156670876-156670898 CTGAGCCAGGCCCGGGGCAGGGG - Exonic
1064343916 10:14513373-14513395 CTGCTGCAGTCATGGGCCATGGG - Intergenic
1065574436 10:27103779-27103801 CCACGCCCGGCACTGGCCATGGG - Intergenic
1069775740 10:70926109-70926131 CTGTGCCAGGCATGGGGCATAGG + Intergenic
1070756272 10:78995274-78995296 CTGTGCCAGGCACTGGGCAAGGG - Intergenic
1071570699 10:86695208-86695230 CTGCACCAGGCAGGGGCTCTGGG + Intronic
1071970865 10:90905374-90905396 CTGCATCAGTCACTGGCCATGGG - Intronic
1072431818 10:95379098-95379120 CTGGGCCAGGCACGGGCTCATGG + Intronic
1072742963 10:97921272-97921294 CTGCCCCAGGTAGGGGCTATGGG + Intronic
1076487889 10:130836012-130836034 ATGGGCCAGGCATGGGCCAGGGG - Intergenic
1077309592 11:1882463-1882485 CTGCGCCAGGCCAGGACCAGTGG - Intronic
1078069771 11:8100785-8100807 CTGAGCCAGGCCCAGGCCTTTGG - Intronic
1084150402 11:67285555-67285577 CTGGGCCAGGCTGGGGCCACGGG - Exonic
1085413839 11:76307373-76307395 CTGGGCCAGGCCCAGGCCTTGGG - Intergenic
1088759157 11:112912963-112912985 CTGTGACAGGCAAAGGCCATGGG + Intergenic
1097028162 12:56073786-56073808 ATGTGTCAGGCACGTGCCATAGG + Intergenic
1100105889 12:91171602-91171624 CTGGGACAGCCAGGGGCCATAGG + Intronic
1102422987 12:112818649-112818671 ATGGGCCAGGCACAGGTCATTGG + Intronic
1110884723 13:80618547-80618569 CTGCACCTGGCAAGGGCCAAAGG - Intergenic
1112617561 13:101020816-101020838 CTGGTCCAGCCACTGGCCATGGG + Intergenic
1114083448 14:19220304-19220326 CTGCGGCAGGCAGTGGCCAGTGG + Intergenic
1114577897 14:23730049-23730071 CTGGGCCAGGCAGGGGACAGGGG - Intergenic
1121569544 14:94937006-94937028 CTGCGCCTGGCCCGGCCCCTTGG - Intergenic
1123034616 14:105466829-105466851 CTGCCCCAAGCATGGGCCCTGGG - Intronic
1125464083 15:39934038-39934060 CCGCGCCGGGGACGGGCCGTAGG - Intergenic
1129755026 15:78092861-78092883 CTGGGCTAGGCAGGGGCCCTTGG + Intronic
1129823755 15:78621001-78621023 CTGCGCCAGGCGCGGGCGGGCGG + Exonic
1132548496 16:544455-544477 CTGCGCCAGTCACAGGCCCGCGG + Intronic
1132696122 16:1202744-1202766 CGGGGCCAGGCAGGGGCAATGGG - Intronic
1136536388 16:30902309-30902331 GCGCGCCAGGCCCGGGCCCTGGG + Exonic
1138330939 16:56214824-56214846 CCAGGCCAGGCACAGGCCATGGG - Intronic
1138443703 16:57050253-57050275 CTGCCCCAGGGACTGGGCATGGG - Intronic
1138509658 16:57501001-57501023 CTGTGCCAGGCACTGGGCACTGG + Intergenic
1139544890 16:67645454-67645476 CTGTGCCAGGCTGGGGCCCTGGG - Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1142892034 17:2949993-2950015 CTGTGCCAGCCCCAGGCCATGGG + Intronic
1143212435 17:5198584-5198606 CTGGTCCAGGCCCGGGCAATGGG - Intergenic
1143634460 17:8156429-8156451 CTGCACGCGGCACGGGGCATGGG - Intronic
1144889153 17:18484060-18484082 CTGCGCCAGGCACGTGAGCTTGG - Intronic
1145143055 17:20460236-20460258 CTGCGCCAGGCACGTGAGCTTGG + Intronic
1145865833 17:28240990-28241012 CTGGGCCAGGCTCTGGCCAGTGG + Intergenic
1146668516 17:34720921-34720943 CTGGGCCAGGCAGAGGCCACAGG + Intergenic
1147926160 17:43947246-43947268 CTGGGCCAGGCTCTGGCCAGTGG - Intergenic
1148271704 17:46266814-46266836 TTGCGCCAGGCGCGGGCCTGTGG - Intergenic
1149864229 17:60141554-60141576 CTGCGCCAGCCGAGGGCCCTAGG + Intergenic
1151454305 17:74216914-74216936 GTGTGCCAGGCACTGGCCACAGG - Intronic
1152036979 17:77879657-77879679 CTGTGCCAGGCACAGGCCAGGGG + Intergenic
1152525165 17:80884327-80884349 CTGCACCAGGCACGAGCCACTGG - Intronic
1152718114 17:81909546-81909568 CTGCGCCAGGCACGGGCCATGGG - Exonic
1152790765 17:82277965-82277987 CTGTGCCAGGCACGAGTCCTGGG - Intergenic
1153900660 18:9614628-9614650 CCGCGGCAGGCCCGGGCCCTCGG - Intronic
1154500132 18:14991967-14991989 CTGCGGCAGGCAGTGGCCAGTGG + Intergenic
1159421165 18:68221489-68221511 CTGAGCCAGGCAATTGCCATTGG + Intergenic
1160030517 18:75254004-75254026 CTACGCCAGGCCCAGGCCAGGGG - Intronic
1161038138 19:2096644-2096666 TTGGCACAGGCACGGGCCATTGG + Intronic
1161429413 19:4222803-4222825 CTGGGCCACGCAGGGGCCAGGGG + Intronic
1163012407 19:14433946-14433968 CTGCGCCAGGCACGTGCCCCAGG - Intronic
1164643328 19:29842203-29842225 CTGTGCCAGGCCCGGGATATGGG + Intergenic
1166352866 19:42208578-42208600 ATGCGCCAGGCACTGGCAGTGGG - Intronic
1167422445 19:49412254-49412276 CTGAGCCAGGCCAGGGCCCTAGG + Intronic
1167728449 19:51235267-51235289 CTGGGTCAGGCATGGGCCAGAGG + Intronic
925103417 2:1268932-1268954 CTCAGCCAGGCATGGGCCCTGGG - Intronic
925173505 2:1767046-1767068 CTGGGTCAGGCAGGGGCCAGGGG + Intergenic
926163948 2:10506476-10506498 CTGCGCTCTGCACGGGCTATGGG - Intergenic
931582227 2:63789372-63789394 CTGAGCCAGGCACTGGGCAAAGG - Intronic
937046087 2:118852786-118852808 CTGCGCCCGGCGCGGGCCTGTGG - Intergenic
938020577 2:127902729-127902751 CTGCCCCAGCCACAAGCCATAGG - Intergenic
948287327 2:236795909-236795931 CTGGGCCAGGGATGGGCCCTGGG + Intergenic
1171333460 20:24361498-24361520 CTCCTCCAGGCACAGGCCTTAGG - Intergenic
1172174727 20:32965372-32965394 CTGAGCCAGGCACGGAACAGGGG + Intergenic
1172443194 20:34979807-34979829 GAGCCCCAGGCCCGGGCCATGGG + Intronic
1175846863 20:62064328-62064350 CTGCTCCAGCCACGGGCCTACGG + Intronic
1176034562 20:63029909-63029931 CTGCTCCCAGCACGGGCCATCGG - Intergenic
1176386934 21:6142828-6142850 ATGCGCCAGGCACGGGCAAGGGG - Intergenic
1176710448 21:10145811-10145833 CTGCGGCAGGCAGTGGCCAGTGG - Intergenic
1176869083 21:14072461-14072483 CTGCGCCAGGCCCGGGGCGTCGG - Intergenic
1179736539 21:43395424-43395446 ATGCGCCAGGCACGGGCAAGGGG + Intergenic
1179889259 21:44327459-44327481 CTGGCCCAGGCACTGGCCAGAGG - Intergenic
1180294527 22:10872963-10872985 CTGCGGCAGGCAGTGGCCAGTGG - Intergenic
1180497333 22:15902377-15902399 CTGCGGCAGGCAGTGGCCAGTGG - Intergenic
1180843759 22:18970802-18970824 CCGCGCCAGGCTGGGGCCAAGGG + Intergenic
1181039614 22:20185653-20185675 CTGCACCATGCACGGGTCACGGG + Intergenic
1183373440 22:37448722-37448744 CTGTGCCAGGCGCAGGCCCTGGG - Intergenic
1184227047 22:43135072-43135094 CTGGGCCAAGGACTGGCCATTGG - Intronic
1184743577 22:46443281-46443303 CAGAGCCAGGCACAGGCCAGGGG + Intronic
1185097438 22:48819151-48819173 CTGGGCCAGGCGCTGGCCAACGG - Intronic
952873987 3:37926375-37926397 CTGCCCCAACCATGGGCCATGGG + Intronic
954413121 3:50379918-50379940 CTGGGGCAGGGACGGGCAATGGG - Intronic
954577410 3:51684224-51684246 ATGCCACAGGCAGGGGCCATAGG + Intronic
954705594 3:52478983-52479005 CTGCTCCAGGCCCAGGCGATGGG - Intronic
957533112 3:81466088-81466110 CTGTGCCAGGCCAGGGGCATTGG + Intergenic
960942563 3:122944142-122944164 CTGTGCCAGGCACTGGACTTGGG - Intronic
961110553 3:124279724-124279746 CTGTGCCAGGGATGGGCAATTGG + Intronic
961371785 3:126435849-126435871 CTCAGCCTGGCATGGGCCATGGG - Intronic
968925330 4:3544183-3544205 CTGCACCAGGCCCTGGCCAGAGG - Intergenic
971165314 4:24176618-24176640 CTGTGCCAGACATGGGACATGGG + Intergenic
977848162 4:101790891-101790913 CAGCGCCAGGCAAGGGGCTTGGG + Exonic
978630263 4:110735862-110735884 CTGTGCCAGGAATGGGCCCTGGG - Intergenic
984705621 4:182845157-182845179 CAGCGCCAGGCTAGGGCCAGAGG - Intergenic
985997439 5:3604828-3604850 CTGGGACAGGCACTGGCCTTTGG + Intergenic
1001648284 5:173297989-173298011 CTGCCCCATGCACAGGCCTTGGG + Intergenic
1004427082 6:15513810-15513832 GTGCACCAGGCACAGGCCACAGG - Intronic
1006725422 6:36196559-36196581 CCGCGCCAGGCACGGGCGGGGGG + Intergenic
1006908141 6:37546464-37546486 CAGCCCCAGGCACAGGCTATGGG - Intergenic
1012476692 6:99621504-99621526 CTGGGCCAGGCAGGGGGCAGAGG + Intergenic
1012738713 6:102984941-102984963 CTACGTGAAGCACGGGCCATGGG + Intergenic
1013286888 6:108689602-108689624 CTGTGCCAGGCCCTGGCCCTCGG + Intergenic
1019399606 7:844729-844751 CTGCGCCAGGCACTGTTCATGGG + Intronic
1020118151 7:5487839-5487861 CTGCACCAGGTGCGGGACATCGG + Intronic
1021845428 7:24757912-24757934 CTACTCCAGGCACGGGCATTAGG - Exonic
1024268776 7:47626562-47626584 CTGCTCCAGGTAAGGGACATGGG + Intergenic
1029113384 7:98224499-98224521 CTGTGCCAGGCACGGGCTCTGGG - Intronic
1029715695 7:102324307-102324329 CTGCGCCAGGCCAGGCCCATGGG + Intergenic
1035665867 8:1379252-1379274 CTGTGCCAGGCACAGGCCCGAGG + Intergenic
1039053351 8:33514475-33514497 CGGCGCCCGGAACGGGCCAGGGG + Intergenic
1042571292 8:70168128-70168150 CTGGGCCATTCATGGGCCATTGG - Intronic
1048422849 8:134294435-134294457 CTGCTCCAGGCAGGGGCCCTTGG - Intergenic
1049278397 8:141731533-141731555 CGGGGCCAGCCAGGGGCCATGGG - Intergenic
1049499602 8:142954814-142954836 CTGCACCTGGCACGGGCCCAGGG - Intergenic
1053800221 9:41759365-41759387 CTGCACCAGGCCCTGGCCAGAGG - Intergenic
1054188649 9:61971517-61971539 CTGCACCAGGCCCTGGCCAGAGG - Intergenic
1054464668 9:65486427-65486449 CTGCACCAGGCCCTGGCCAGAGG + Intergenic
1054649872 9:67617100-67617122 CTGCACCAGGCCCTGGCCAGAGG + Intergenic
1057253615 9:93524855-93524877 CTGAGACAGGCACCGGCCACAGG - Intronic
1057832899 9:98420268-98420290 CTGAGCCAGGCATGGGACAACGG - Intronic
1059476878 9:114554440-114554462 CTGAAGCAGGCATGGGCCATGGG - Intergenic
1059676432 9:116544959-116544981 CTGGGCCAGGAGCAGGCCATTGG - Intronic
1061160798 9:128892717-128892739 CTGCTCCCACCACGGGCCATGGG - Intronic
1062425014 9:136502148-136502170 CCACGCCAGGCCCGGGCCAGGGG - Intronic
1202795212 9_KI270719v1_random:114806-114828 CTGCGGCAGGCAGTGGCCAGTGG - Intergenic
1192191424 X:68993489-68993511 CTGCACCAGGCATTGGCCAAGGG - Intergenic