ID: 1152720525

View in Genome Browser
Species Human (GRCh38)
Location 17:81921438-81921460
Sequence CACGGACGACACCACGGCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 48}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152720517_1152720525 20 Left 1152720517 17:81921395-81921417 CCAGAAGCACCAGCACTTTACCG 0: 1
1: 1
2: 1
3: 1
4: 62
Right 1152720525 17:81921438-81921460 CACGGACGACACCACGGCACCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1152720518_1152720525 11 Left 1152720518 17:81921404-81921426 CCAGCACTTTACCGCTGCACAAA 0: 1
1: 1
2: 0
3: 9
4: 97
Right 1152720525 17:81921438-81921460 CACGGACGACACCACGGCACCGG 0: 1
1: 0
2: 1
3: 2
4: 48
1152720519_1152720525 0 Left 1152720519 17:81921415-81921437 CCGCTGCACAAAACCTCACCAGG 0: 1
1: 1
2: 1
3: 17
4: 172
Right 1152720525 17:81921438-81921460 CACGGACGACACCACGGCACCGG 0: 1
1: 0
2: 1
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152720525 Original CRISPR CACGGACGACACCACGGCAC CGG Exonic
902199145 1:14820907-14820929 CTCAGACGACATGACGGCACCGG + Intronic
904252647 1:29236301-29236323 CACGGACGTCTCCACGGACCGGG - Intergenic
922796138 1:228340779-228340801 CAGGGCAGACACCACGGCATAGG - Exonic
922826981 1:228528761-228528783 CACAGACGACACCACAGCACTGG - Intergenic
1063459059 10:6203937-6203959 CACGGGCGCCCCCATGGCACTGG - Intronic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1077164159 11:1127587-1127609 CAGGGGCGGCACCAGGGCACTGG - Intergenic
1077368713 11:2171756-2171778 CCCCGACGCCACCACGCCACAGG - Exonic
1091449370 12:562916-562938 GACGGTCCAAACCACGGCACTGG + Exonic
1103701643 12:122851125-122851147 CACCGCCGACACCATGGCTCTGG - Intronic
1105889273 13:24670445-24670467 CCCGGACCACATCACGTCACTGG - Intergenic
1112025109 13:95404435-95404457 CCAGGAAGACACCACGGCTCTGG - Intergenic
1121097061 14:91224806-91224828 GGTGGACGTCACCACGGCACAGG + Exonic
1127862009 15:63002300-63002322 CACAGACAACTCCACAGCACAGG + Intergenic
1131794070 15:95995343-95995365 AAAGGACGACATCATGGCACAGG - Intergenic
1134104440 16:11475929-11475951 CATGGAGGACAGCATGGCACAGG + Intronic
1140591607 16:76360219-76360241 CACTGACTACACCATGCCACAGG - Intronic
1140927653 16:79599402-79599424 CACGGCGGACACCACGGCGGCGG + Exonic
1143372515 17:6449225-6449247 CACAGACCACACCCCGGTACCGG + Intronic
1150008187 17:61482664-61482686 CACGGGGGACACCACATCACCGG - Intronic
1151977422 17:77490523-77490545 CACAGGTGACACCACTGCACAGG - Intronic
1152154212 17:78622388-78622410 CTCGGACGTCACCATGGCACAGG - Intergenic
1152407886 17:80107919-80107941 CACGGAGGAGACCCCGGCCCGGG - Intergenic
1152711384 17:81871845-81871867 CACGGGGGACACCAAGGCCCTGG - Intergenic
1152720525 17:81921438-81921460 CACGGACGACACCACGGCACCGG + Exonic
1158606709 18:58902172-58902194 CACAGACAACACCGCTGCACAGG - Intronic
1160018778 18:75164615-75164637 CACAGACCACACCAAGGCATGGG + Intergenic
1160521192 18:79509168-79509190 CACGGGCCACGCCACTGCACAGG - Intronic
1163743868 19:19033408-19033430 CACCGACGACGCCAGGGCCCGGG + Intronic
1166863289 19:45821810-45821832 CACAGACTCCACCGCGGCACAGG + Intronic
929771654 2:44897473-44897495 CACATACGACATCAGGGCACAGG - Intergenic
1176523421 21:7845336-7845358 CAAGGAAGACACCACAGTACTGG + Intergenic
1178657441 21:34475348-34475370 CAAGGAAGACACCACAGTACTGG + Intergenic
1182621707 22:31621992-31622014 CACGGAGGACACCAGGGCCCAGG + Intronic
1183776799 22:39971437-39971459 CAGAGACCACACCTCGGCACTGG + Exonic
1184631710 22:45786451-45786473 CAAGGACTGCACCACTGCACGGG - Intronic
963289297 3:143471158-143471180 CACGCACGGCACTGCGGCACTGG + Intronic
966866205 3:184260348-184260370 CGGGGAGGACACCGCGGCACAGG - Intronic
968439643 4:616925-616947 CATGGGGGACACCACGGCAGGGG - Intergenic
985769384 5:1799484-1799506 CCCGGAGGACACTGCGGCACCGG + Intronic
989043006 5:37248941-37248963 CTCGGGCCACACCTCGGCACCGG - Intronic
990376186 5:55173259-55173281 CTCTGACGACACCGCGGCGCCGG - Intergenic
999223485 5:150000778-150000800 CACGGTCGTCACCGAGGCACCGG - Exonic
1002102800 5:176865643-176865665 CACGGCAGATACCACGGCAGTGG + Intronic
1002390818 5:178910355-178910377 CAAGGAAGACTCCTCGGCACTGG + Intronic
1003422836 6:5973808-5973830 CAGGGAAGATACCACGGTACAGG - Intergenic
1019577700 7:1745484-1745506 CGGGGACGGCACCACGCCACTGG + Exonic
1034829224 7:154294775-154294797 CACTGAAGACAGCACGGCAGTGG + Intronic
1035712790 8:1731275-1731297 CAAGGAAGACCCCAAGGCACTGG + Intergenic
1191840851 X:65512870-65512892 CACTGCCGACACCACAGCTCAGG + Exonic
1200209697 X:154341756-154341778 CACGGCCGACGCCCCGGCAGCGG + Intergenic
1200221155 X:154390336-154390358 CACGGCCGACGCCCCGGCAGCGG - Intronic