ID: 1152724728

View in Genome Browser
Species Human (GRCh38)
Location 17:81939572-81939594
Sequence CGCTAGGAGGGGCCGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 130}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152724715_1152724728 8 Left 1152724715 17:81939541-81939563 CCACTTCCTTCCTCAGCCTTCCC 0: 1
1: 0
2: 21
3: 260
4: 2108
Right 1152724728 17:81939572-81939594 CGCTAGGAGGGGCCGCCAGGAGG 0: 1
1: 0
2: 3
3: 6
4: 130
1152724712_1152724728 26 Left 1152724712 17:81939523-81939545 CCTGACTGTGATCCCAGGCCACT 0: 1
1: 0
2: 1
3: 8
4: 196
Right 1152724728 17:81939572-81939594 CGCTAGGAGGGGCCGCCAGGAGG 0: 1
1: 0
2: 3
3: 6
4: 130
1152724714_1152724728 13 Left 1152724714 17:81939536-81939558 CCAGGCCACTTCCTTCCTCAGCC 0: 1
1: 0
2: 5
3: 79
4: 634
Right 1152724728 17:81939572-81939594 CGCTAGGAGGGGCCGCCAGGAGG 0: 1
1: 0
2: 3
3: 6
4: 130
1152724713_1152724728 14 Left 1152724713 17:81939535-81939557 CCCAGGCCACTTCCTTCCTCAGC 0: 1
1: 1
2: 5
3: 46
4: 478
Right 1152724728 17:81939572-81939594 CGCTAGGAGGGGCCGCCAGGAGG 0: 1
1: 0
2: 3
3: 6
4: 130
1152724716_1152724728 2 Left 1152724716 17:81939547-81939569 CCTTCCTCAGCCTTCCCCCAGAG 0: 1
1: 0
2: 8
3: 79
4: 832
Right 1152724728 17:81939572-81939594 CGCTAGGAGGGGCCGCCAGGAGG 0: 1
1: 0
2: 3
3: 6
4: 130
1152724717_1152724728 -2 Left 1152724717 17:81939551-81939573 CCTCAGCCTTCCCCCAGAGCACG 0: 1
1: 1
2: 1
3: 26
4: 303
Right 1152724728 17:81939572-81939594 CGCTAGGAGGGGCCGCCAGGAGG 0: 1
1: 0
2: 3
3: 6
4: 130
1152724711_1152724728 27 Left 1152724711 17:81939522-81939544 CCCTGACTGTGATCCCAGGCCAC 0: 1
1: 0
2: 1
3: 20
4: 189
Right 1152724728 17:81939572-81939594 CGCTAGGAGGGGCCGCCAGGAGG 0: 1
1: 0
2: 3
3: 6
4: 130
1152724719_1152724728 -8 Left 1152724719 17:81939557-81939579 CCTTCCCCCAGAGCACGCTAGGA 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1152724728 17:81939572-81939594 CGCTAGGAGGGGCCGCCAGGAGG 0: 1
1: 0
2: 3
3: 6
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152724728 Original CRISPR CGCTAGGAGGGGCCGCCAGG AGG Intronic
900114508 1:1022747-1022769 CCCTAGAAGGGGCCTCCAGAAGG - Intronic
901404731 1:9038545-9038567 AGCTAGGACGGGACCCCAGGGGG + Intronic
903276529 1:22225543-22225565 GGCCAGGAGGGGCCGGAAGGGGG + Intergenic
905519950 1:38589908-38589930 GGCCAGGAGGGGCAGCAAGGAGG + Intergenic
906259884 1:44378860-44378882 TGCAAGGAGGAGACGCCAGGTGG - Intergenic
907540934 1:55215122-55215144 CGCTGGCCGGGGCGGCCAGGAGG - Intergenic
914640850 1:149606150-149606172 CCCTAGGAGGGGTCTCCAGCAGG - Intergenic
924473437 1:244363554-244363576 CTCTGGGTGGGGCCCCCAGGAGG + Intronic
1065788674 10:29240046-29240068 CTCTAGGAGGAGCCTCTAGGAGG + Intergenic
1068080623 10:52314163-52314185 CGCTGGGAGGGGCTGGGAGGGGG - Intergenic
1070922734 10:80198385-80198407 AGCTAGGAGGGCCTGCCATGGGG + Intronic
1073138045 10:101230331-101230353 GGCTAGGCGGGGCCGGCAGCGGG - Intergenic
1073552145 10:104413549-104413571 AGCAAGGAGAGGCCACCAGGAGG - Intronic
1075071066 10:119320157-119320179 GGATTGGAGGGGCTGCCAGGTGG + Intronic
1076734680 10:132453307-132453329 TGCTAGGAGGTGTCGGCAGGGGG - Intergenic
1077241440 11:1512734-1512756 CGCTAGGAGGTGGGGCCTGGTGG + Intergenic
1079005420 11:16788546-16788568 CGCCAGGAAGCGCCACCAGGGGG + Exonic
1079128847 11:17735942-17735964 CCATGGGAGCGGCCGCCAGGGGG - Exonic
1079642905 11:22829569-22829591 CGCTAGCAGGGTCCCCCAGCGGG + Intronic
1082260032 11:50071647-50071669 GGCCTGGAGAGGCCGCCAGGAGG + Intergenic
1083666087 11:64275516-64275538 GGCTATGAGGGGCCGGTAGGGGG - Intronic
1088058209 11:105610492-105610514 CTCGAGGAGGGGACGCCAGGAGG + Intronic
1089011103 11:115132485-115132507 AGTTGGGAGGGGCCGGCAGGTGG - Intergenic
1089051312 11:115548598-115548620 CGCTGGGCTGGGCCCCCAGGTGG + Intergenic
1091601888 12:1922656-1922678 CACTCGGAGGGGCCAGCAGGAGG + Intergenic
1097177252 12:57150577-57150599 CTCTAGGTGGGCCCTCCAGGTGG - Intronic
1097879949 12:64677710-64677732 CCCTAGGAGGGTCTTCCAGGTGG - Intronic
1101441647 12:104708605-104708627 GGCTAGGAGGGGGCACCTGGAGG - Intronic
1101493863 12:105235823-105235845 CGGTGGGAGGCGCCGCGAGGGGG + Intronic
1104270829 12:127280885-127280907 CTCCACGAGGGGCCGACAGGGGG + Intergenic
1108611033 13:52083954-52083976 TGCTGGGAGGGGCAGCCTGGAGG - Intronic
1125328904 15:38564176-38564198 GGCCGGGAGGGGCCACCAGGTGG + Intronic
1129575143 15:76735100-76735122 CGTTAGGAGGGCCGGGCAGGAGG + Intronic
1129847505 15:78774701-78774723 CGGAAGGAGGGGCGGCCAGCAGG + Exonic
1129898038 15:79122981-79123003 CGCTAGGATGGTCCCACAGGCGG + Intergenic
1130254400 15:82319208-82319230 CGGAAGGAGGGGCGGCCAGCGGG - Intergenic
1130545826 15:84857253-84857275 CCCAAGGAGGAGCGGCCAGGGGG + Exonic
1130600565 15:85270762-85270784 CGGAAGGAGGGGCGGCCAGCGGG + Intergenic
1132252154 15:100341950-100341972 CGCTAGGCGGCGGCGCCAGCCGG + Exonic
1132462771 16:63545-63567 CGGAAGGAGGGGCCTGCAGGAGG + Intronic
1132679169 16:1132703-1132725 GGCTAGGAGGGGGCGCTTGGGGG + Intergenic
1133026627 16:2991460-2991482 CGCAGGGAGGGGCGGGCAGGAGG + Intergenic
1133324950 16:4936793-4936815 AGCTGGGAAGCGCCGCCAGGTGG - Intronic
1134029306 16:10978987-10979009 CGGCAGGAGAGGCCTCCAGGAGG - Intronic
1134909272 16:18009451-18009473 GGCTAGAAGGGGAGGCCAGGAGG - Intergenic
1136220049 16:28823070-28823092 CGCGAGGAAGCGCCGCGAGGCGG - Intronic
1136496993 16:30650909-30650931 CGCTGGGCGGGGACGCGAGGAGG + Intronic
1138580715 16:57939106-57939128 GGTTAGGAGGGGCCTGCAGGAGG + Intronic
1139473946 16:67193175-67193197 CCCCAGCAGGGACCGCCAGGAGG - Intronic
1141682668 16:85553526-85553548 CGCTGGGAGGGGGCGCCAGGCGG + Intergenic
1141979375 16:87540567-87540589 CGCTGGGAGGGGCCCCCAAAGGG - Intergenic
1142335829 16:89489683-89489705 TGCCGGGAGGGGCTGCCAGGGGG - Intronic
1142409849 16:89910469-89910491 GACACGGAGGGGCCGCCAGGGGG - Intronic
1145976736 17:28988267-28988289 CACTAGGAAGTGCCCCCAGGAGG - Intronic
1148752801 17:49955284-49955306 GGCTGGGAGGGGCCTCCAGCAGG - Intergenic
1150387643 17:64774067-64774089 AGAGAGGAGGGGCCCCCAGGTGG + Intergenic
1152218092 17:79046024-79046046 TGCCATGAGGGGCCGCGAGGTGG + Intronic
1152418876 17:80181398-80181420 CCCTAGGAGGGGTGGCCATGGGG - Exonic
1152567546 17:81106926-81106948 GGCTGGGAGGGGCCCGCAGGTGG + Intronic
1152724728 17:81939572-81939594 CGCTAGGAGGGGCCGCCAGGAGG + Intronic
1156046647 18:32885038-32885060 TGCTGGGAGGGGGCGCCTGGTGG + Intergenic
1157374429 18:47150262-47150284 CGAGAGGAGGGGCGGCCTGGGGG + Intronic
1157493469 18:48139445-48139467 GGCTAGGAGGAGCCGCCTGGGGG - Intronic
1160453330 18:78979729-78979751 CTCCGGGAGGGGCCGCCCGGCGG + Intergenic
1163081414 19:14945986-14946008 AGCTAGGAGGGGCAGTAAGGAGG - Intergenic
1165153974 19:33776688-33776710 CGCCCGGAGGGGCCCACAGGGGG - Intergenic
1166064421 19:40348686-40348708 GGCTAGGAGGGGCCGTCAGGCGG + Exonic
1167160745 19:47765852-47765874 CCCTAGGAGGGTCAGCCAGGAGG + Intergenic
1168059739 19:53884219-53884241 CGCTGGGAAGGGCCCCCAGACGG + Exonic
1168153421 19:54460825-54460847 CTCTAGGAAGGCCCGGCAGGCGG - Exonic
924988239 2:289325-289347 CCCGAGGCGGGGCGGCCAGGAGG + Intergenic
925917494 2:8617184-8617206 TGCCAGGAGGGGCGGCCGGGGGG + Intergenic
931515995 2:63051026-63051048 CGCGCCGAGGGGCCGCAAGGGGG - Intronic
932560400 2:72862777-72862799 CGCTGGGAGGCCCCGCCTGGCGG - Intergenic
935332239 2:101985705-101985727 TGCCAGGAGGGGCAGCCAGAAGG + Intergenic
947827808 2:233118152-233118174 AGCCAGGAGGGGCTTCCAGGTGG - Intronic
1174048540 20:47750993-47751015 AGCCAGGAGGGGAAGCCAGGAGG - Intronic
1176259481 20:64172005-64172027 CAGTAGGAGGGGCTGGCAGGGGG - Intronic
1179531964 21:42025937-42025959 CGTGAGGAGGGGTCACCAGGAGG - Intergenic
1179956273 21:44740936-44740958 AGCTGGGAGGGGAGGCCAGGCGG - Intergenic
1180095825 21:45555065-45555087 CGCGGGGAGTGGCCACCAGGGGG + Intergenic
1181163955 22:20973689-20973711 CACTGGGAGGAGCTGCCAGGAGG + Intronic
1181967813 22:26668850-26668872 CTCTGGGAGGGGCAGCCAGAGGG + Intergenic
1184300491 22:43555937-43555959 AGCTAGGAGGGGCCCGCAGAGGG + Intronic
1184470403 22:44692515-44692537 CGGGAGGAGGAGCCCCCAGGAGG - Intronic
1184981205 22:48097104-48097126 AGCAAGGAGGGGCTGCCAGGTGG - Intergenic
1185404725 22:50641383-50641405 CCCTAGGAGGGGCCACCCTGAGG - Intergenic
954291669 3:49653187-49653209 GGCTGAGAGGGGCCGCCATGGGG - Exonic
954627759 3:52031989-52032011 GGCTTGGAGGGTCCGCCGGGGGG - Intergenic
954831009 3:53421412-53421434 AGGTTGGAGGGGCAGCCAGGGGG - Intergenic
960687208 3:120306770-120306792 CACTATGAGGGGCCGCGAGGGGG - Intergenic
962389389 3:134958701-134958723 CGCTGGGTAGGGCCGCCATGGGG - Intronic
962444567 3:135453099-135453121 CGGGAGGAGGGGCCGTCAGCAGG - Intergenic
969597827 4:8158880-8158902 CGCGGGGCGGGGCCGCCAGGAGG - Intergenic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
979133971 4:117085436-117085458 CGCTGTGAGGAGCAGCCAGGGGG - Exonic
981616361 4:146648262-146648284 CGCTGGGAGGGGCGGGGAGGAGG - Intergenic
985525653 5:400140-400162 TCCGAGGAGGGGCAGCCAGGGGG + Intronic
991054370 5:62306067-62306089 AGCTGGGCGGGGCCGCCTGGAGG + Intergenic
992199664 5:74370728-74370750 CTCCATGAGGGGCAGCCAGGTGG + Intergenic
992528727 5:77636493-77636515 CGCTCGGCTGGGCCGCCCGGGGG + Intronic
1001426413 5:171625526-171625548 CACTGGTAGGGGCCGGCAGGAGG - Intergenic
1001773184 5:174311096-174311118 CTCTGGGAGGCCCCGCCAGGAGG + Intergenic
1002938963 6:1699353-1699375 AGCCAGGAGGGGTCTCCAGGAGG + Intronic
1006303253 6:33205027-33205049 AGCAAGGAGGGGCCGCCCCGAGG + Exonic
1013556167 6:111259415-111259437 CGCTGGGAGGTGGCGCCCGGAGG + Exonic
1017978177 6:159375837-159375859 CGCAGGGAGGGGCAGTCAGGAGG + Intergenic
1018174974 6:161170701-161170723 CACAAGAAGGGGCTGCCAGGTGG - Intronic
1019585606 7:1800913-1800935 GACTTGGAGGGGCCGCGAGGGGG - Intergenic
1023599269 7:41865325-41865347 CGCTTGGAGTGGCCACCCGGGGG + Intergenic
1023852542 7:44158455-44158477 CACTGGGAGGGGCCGGCTGGTGG + Intronic
1025176351 7:56804262-56804284 GGCCTGGAGAGGCCGCCAGGCGG - Intergenic
1025181936 7:56827775-56827797 CACTTGGAGTGGCCGCCAAGAGG + Intergenic
1025689984 7:63749220-63749242 CACTTGGAGAGGCCGCCAAGAGG - Intergenic
1025694182 7:63766389-63766411 CGCCTGGAGAGGCCGCCGGGAGG - Intergenic
1025695443 7:63772160-63772182 GGCCTGGAGAGGCCGCCAGGCGG + Intergenic
1027423538 7:78040372-78040394 CACGACCAGGGGCCGCCAGGGGG - Intronic
1034455691 7:151168377-151168399 GGCGAGGCGGGGCCGACAGGGGG + Intronic
1035016793 7:155773744-155773766 AGCTGGGAGGGGCAGGCAGGAGG - Intronic
1035438576 7:158878117-158878139 GGCGAGGAGGGGAGGCCAGGAGG + Intronic
1035438590 7:158878172-158878194 GGCGAGGAGGGGAAGCCAGGAGG + Intronic
1035438641 7:158878353-158878375 GGCGAGGAGGGGAGGCCAGGAGG + Intronic
1035438709 7:158878576-158878598 GGCGAGGAGGGGAGGCCAGGAGG + Intronic
1035438761 7:158878757-158878779 GGCGAGGAGGGGAGGCCAGGAGG + Intronic
1035438816 7:158878938-158878960 GGCGAGGAGGGGAGGCCAGGAGG + Intronic
1038963813 8:32549242-32549264 CGCTGGAATGGGCCGCCTGGAGG + Intronic
1039956094 8:42208096-42208118 CGGTAGGAGGTGCCCCCATGGGG + Intergenic
1047722310 8:127652482-127652504 GGCTGGGAGGGGCAGCGAGGTGG + Intergenic
1053138517 9:35666841-35666863 AGATAGGAGGGGCCAACAGGAGG + Intronic
1056618608 9:88191128-88191150 CGCAGGGAGGGGCAACCAGGCGG - Intergenic
1057353501 9:94318451-94318473 AGCCAGTAGGGGCCGCCATGGGG - Exonic
1057654250 9:96939141-96939163 AGCCAGTAGGGGCCGCCATGGGG + Exonic
1060187670 9:121573888-121573910 CACAGGGAGGGGCCTCCAGGTGG - Intronic
1061044939 9:128160045-128160067 CGCTGGGCGGGGCCACCACGGGG - Intergenic
1062461863 9:136665699-136665721 GGCGGGGCGGGGCCGCCAGGTGG + Intronic
1062696578 9:137878855-137878877 CCCTAGGGGCGGCCGCGAGGCGG - Intronic
1186757782 X:12691001-12691023 GGGTAGGAGGGGACACCAGGAGG + Intronic
1187478627 X:19634620-19634642 CACTTGGAGGGGCCACAAGGAGG + Intronic
1189102766 X:38208305-38208327 CACTGGGAGGGGCCACAAGGGGG - Intronic
1198517906 X:137427407-137427429 GGCTAGGAGGGGCCCCCAGGCGG + Intergenic