ID: 1152724886

View in Genome Browser
Species Human (GRCh38)
Location 17:81940274-81940296
Sequence GAACCACTCCTGGTTCAGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152724886_1152724904 28 Left 1152724886 17:81940274-81940296 CCTCTCTGAACCAGGAGTGGTTC 0: 1
1: 0
2: 2
3: 11
4: 134
Right 1152724904 17:81940325-81940347 CCTGGCCCAGCTACTCTCCTGGG 0: 1
1: 0
2: 2
3: 32
4: 320
1152724886_1152724893 10 Left 1152724886 17:81940274-81940296 CCTCTCTGAACCAGGAGTGGTTC 0: 1
1: 0
2: 2
3: 11
4: 134
Right 1152724893 17:81940307-81940329 CGCCCCTCCCTCCCCTTGCCTGG 0: 1
1: 1
2: 3
3: 65
4: 577
1152724886_1152724902 27 Left 1152724886 17:81940274-81940296 CCTCTCTGAACCAGGAGTGGTTC 0: 1
1: 0
2: 2
3: 11
4: 134
Right 1152724902 17:81940324-81940346 GCCTGGCCCAGCTACTCTCCTGG 0: 1
1: 0
2: 4
3: 33
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152724886 Original CRISPR GAACCACTCCTGGTTCAGAG AGG (reversed) Exonic
900513622 1:3071303-3071325 GCACCACTTCTGGTCCTGAGCGG - Intronic
901925238 1:12561781-12561803 GAGCCACCTCTGGTTCACAGTGG + Intergenic
903140651 1:21337078-21337100 GTGCAACTCCTGGGTCAGAGGGG - Intronic
903971339 1:27120876-27120898 GAAGAAATCCAGGTTCAGAGAGG + Intronic
904581800 1:31549113-31549135 TAACCATGCCTGGTTCAAAGGGG + Intergenic
906200374 1:43956449-43956471 GAACCACTCCCGGTAAAGGGTGG + Exonic
906768568 1:48460929-48460951 GAACCAGAACAGGTTCAGAGAGG - Intronic
907019813 1:51055844-51055866 GAACAACTCTTGGGTCAAAGAGG - Intergenic
913202973 1:116511049-116511071 CAACCACTCCTAGTGTAGAGTGG - Intergenic
916098924 1:161376740-161376762 AAACCACTCCTGGGTCAAGGGGG + Intergenic
917222047 1:172742323-172742345 GAACCACTCTTGAGTCAAAGTGG + Intergenic
919206352 1:194424962-194424984 GAAACCCTGGTGGTTCAGAGAGG + Intergenic
920985439 1:210884683-210884705 GAACCATACTTGCTTCAGAGAGG + Intronic
923318900 1:232809505-232809527 GATCCACTCATGCTACAGAGTGG + Intergenic
923553267 1:234980820-234980842 GATCCAATCCTGAGTCAGAGAGG + Intergenic
1064161015 10:12946604-12946626 GAACCTATTCTGGTTCTGAGTGG + Intronic
1069809424 10:71147384-71147406 GAAGCACTGGTGGTTCTGAGTGG - Intergenic
1071502990 10:86216766-86216788 GAAGCACAGCTGGCTCAGAGAGG + Intronic
1076242232 10:128917128-128917150 GAAGCACTCAGGGTTCACAGGGG - Intergenic
1076693236 10:132234389-132234411 GAACCCCCGCTGTTTCAGAGGGG - Intronic
1076986695 11:241814-241836 GAAACACGCCTGGGGCAGAGAGG - Intronic
1087031997 11:93715391-93715413 GAACCTACCCTGGGTCAGAGAGG - Intronic
1089465324 11:118681306-118681328 GAACCTTTACTAGTTCAGAGTGG - Intergenic
1091449047 12:561482-561504 GAGCCACTGCTAGTCCAGAGCGG - Exonic
1094624347 12:32107995-32108017 TAACCACTCCTTGGTGAGAGAGG + Intronic
1096648932 12:53052611-53052633 GAACCCCTCCTGGGTGGGAGGGG + Intronic
1098894169 12:76038589-76038611 GAACAACTCAGGCTTCAGAGAGG + Exonic
1102035740 12:109769584-109769606 GAACCATTCCTGTTTTTGAGTGG - Exonic
1103340135 12:120216676-120216698 GCCCCACTCTTGGTGCAGAGTGG - Intronic
1104561372 12:129848152-129848174 GACGCACCCTTGGTTCAGAGAGG - Intronic
1104915286 12:132261252-132261274 GAACCACATGTGGTTCAGCGTGG + Intronic
1106053456 13:26214532-26214554 GAACCATTTCTCGTTTAGAGCGG - Exonic
1106287201 13:28328429-28328451 GGACCACTTCTGGGTCAAAGGGG + Intronic
1107168578 13:37313186-37313208 GAAACTCTCTTGGTTCAAAGGGG - Intergenic
1107599473 13:41998657-41998679 GAACTACTCCCAGCTCAGAGAGG - Intergenic
1110277314 13:73654604-73654626 GAACCAGCCCTGGTTCTTAGAGG + Intergenic
1111639339 13:90947527-90947549 GAACCTGTCCTGGGCCAGAGGGG + Intergenic
1111894952 13:94129736-94129758 AAACCACTCCAGGTTCAGAGTGG - Intronic
1113580289 13:111423905-111423927 CAACCACACCTGCTCCAGAGAGG - Intergenic
1121495514 14:94389260-94389282 AAACAGTTCCTGGTTCAGAGAGG - Intronic
1122013013 14:98769177-98769199 CAACCACTTCTTGCTCAGAGGGG - Intergenic
1125214384 15:37253669-37253691 GAACCAGAATTGGTTCAGAGAGG + Intergenic
1130547826 15:84869442-84869464 CCTCCACTCCTGGTTGAGAGGGG - Exonic
1131171802 15:90184511-90184533 GAAAAACTCCAGGCTCAGAGAGG + Intronic
1132088767 15:98930270-98930292 GAAGTACTCCGGGTTCACAGAGG - Exonic
1136668360 16:31834623-31834645 AAACAACTACTGATTCAGAGCGG + Intergenic
1138016677 16:53434681-53434703 GAACCGCTGCTGGATCTGAGGGG - Exonic
1142605900 17:1080875-1080897 AAATCACTCCTGCTGCAGAGAGG + Intronic
1143684500 17:8503339-8503361 GAACCATGCCTGGCTCAGATGGG + Intronic
1144740927 17:17581835-17581857 GAATGACTAATGGTTCAGAGTGG + Intronic
1147757134 17:42776150-42776172 GTATCATTCCTGGATCAGAGGGG + Intronic
1152724886 17:81940274-81940296 GAACCACTCCTGGTTCAGAGAGG - Exonic
1159117034 18:64126519-64126541 GAACAGCTCCTTGTTCATAGAGG - Intergenic
1159478753 18:68959895-68959917 GAACCAGTCCTGGGCCAGAGGGG - Intronic
1159544155 18:69818332-69818354 GAACCATGCCTGGTGCACAGGGG - Intronic
1166156091 19:40912271-40912293 GACTCACTCATGGTTCAGCGTGG + Intergenic
1168723276 19:58566684-58566706 TCACCACACCTGGCTCAGAGAGG - Intronic
925211360 2:2050048-2050070 GAACCAAGCTTGGTACAGAGTGG + Intronic
930119491 2:47748439-47748461 GAACCACTTCTGGGGCAGTGCGG + Intronic
931679353 2:64731134-64731156 GAACCACTTCATTTTCAGAGTGG + Intronic
932406182 2:71513769-71513791 GAGCCATTCCTGGATCAAAGCGG + Exonic
933938618 2:87227138-87227160 GAAGCAAACCTTGTTCAGAGAGG + Intergenic
934937590 2:98476608-98476630 AGACCTCTCCTGGCTCAGAGGGG + Intronic
935618733 2:105110792-105110814 GAACCACTCCTGGGTCACTTAGG + Intergenic
936354517 2:111738636-111738658 GAAGCAAACCTTGTTCAGAGAGG - Intergenic
937443135 2:121933861-121933883 GAACAGCTCTTGGGTCAGAGAGG - Intergenic
941476721 2:165958488-165958510 GAACCAGTCAAGGTTCAGAGAGG - Intergenic
944827984 2:203504207-203504229 GAACCTCTCCTGGGACAGTGCGG - Intronic
945512949 2:210725270-210725292 GAACCACTCAAGCTTCAGAAAGG - Intergenic
1168843169 20:922850-922872 GATGCTCTCATGGTTCAGAGAGG - Intergenic
1169150663 20:3286931-3286953 TCACCACTCCAGGCTCAGAGGGG - Intronic
1171261578 20:23738871-23738893 CAAACACTGGTGGTTCAGAGAGG + Intergenic
1171270715 20:23814761-23814783 CAAACACTGGTGGTTCAGAGAGG + Intergenic
1173779926 20:45746794-45746816 CAACCCCTCCTGGCTCAGTGTGG - Intergenic
1174803220 20:53582532-53582554 GAAGAACTGCTGGTTCACAGAGG + Exonic
1175063055 20:56261149-56261171 GAACCATTCCTGTTACAGATGGG - Intergenic
1177266752 21:18796099-18796121 GAACCAGAACAGGTTCAGAGAGG - Intergenic
1180702879 22:17791258-17791280 GAACCACTCCTGCATCAGCTTGG + Exonic
949231849 3:1758917-1758939 GAACCCCACCTGGTTAACAGTGG + Intergenic
950181713 3:10918167-10918189 GGAGCACTCATGGTTCAGAGAGG - Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
953716537 3:45320988-45321010 GAACCACTCATCATTTAGAGTGG - Intergenic
954440174 3:50517423-50517445 CACCCACTCCTGCCTCAGAGAGG - Intergenic
956745594 3:72308565-72308587 AAACCTCTCATGGTTCAGACTGG + Intergenic
958598571 3:96262809-96262831 GAACAACTACTGGGTCAAAGAGG + Intergenic
960025874 3:113008774-113008796 GGACCTGTCCTGGTACAGAGGGG - Intronic
961165756 3:124762686-124762708 AAACCACCCCTTGTTCTGAGGGG - Exonic
963044433 3:141092506-141092528 GGCCCACTCCTGGTGCACAGGGG - Intronic
965267928 3:166571669-166571691 GAACCAGAGTTGGTTCAGAGTGG + Intergenic
966269201 3:178084238-178084260 GAACCATTCCTGTTGCAGAGAGG + Intergenic
966454044 3:180094545-180094567 AGACCACTCCTGCATCAGAGTGG - Intergenic
966454223 3:180096279-180096301 AGACCACTCCTGCATCAGAGTGG - Intergenic
969347347 4:6577568-6577590 GAGACATTCCAGGTTCAGAGAGG + Intronic
969957611 4:10907887-10907909 GCAGAACTCCTAGTTCAGAGGGG + Intergenic
970701077 4:18739229-18739251 GAACCACTCCTGGTACAAAGAGG + Intergenic
971681483 4:29706583-29706605 GAACCACTGCTAGATCAGTGTGG - Intergenic
975937523 4:79599900-79599922 GCAGCACTCCAGGTTCAGAAAGG - Intergenic
978557184 4:109993341-109993363 AAATCAGTCCTGGTTCAGACAGG - Exonic
978676094 4:111317936-111317958 CACTCACTACTGGTTCAGAGAGG + Intergenic
978989761 4:115066011-115066033 TAAACACTCCTGGTTCCTAGAGG + Intronic
979475946 4:121157484-121157506 AAACCACCCCTACTTCAGAGGGG + Intronic
979522653 4:121686638-121686660 CAACACCTCCTGGTTCACAGAGG + Intronic
983368639 4:166830025-166830047 GAAACATTGCTGGTTCAGAAAGG - Intronic
985051155 4:185993242-185993264 AAACCAGTCCTGGGACAGAGGGG - Intergenic
986104795 5:4649508-4649530 GCACCACCTCTGGTACAGAGAGG - Intergenic
986577628 5:9229075-9229097 GCACCACTCCTGGCTCAGATTGG + Intronic
987514314 5:18886284-18886306 GCACTACTCCTGGTTCTGTGGGG - Intergenic
987631533 5:20478652-20478674 GAACCAGCCCTGGGTCAGAAGGG + Intronic
989165852 5:38433033-38433055 TTCCCACTCCTGGTTCACAGTGG - Intronic
990191198 5:53262009-53262031 GAAACACTGCTAGTTCTGAGTGG - Intergenic
994264652 5:97700403-97700425 GAACCTGCCCTGGGTCAGAGGGG + Intergenic
995008498 5:107230514-107230536 GAACCAATCCTGCTACAAAGAGG - Intergenic
995958099 5:117804592-117804614 AAACCATTCTTAGTTCAGAGAGG - Intergenic
996255022 5:121389278-121389300 GAACAATGCCTGGTACAGAGAGG - Intergenic
999263071 5:150249451-150249473 GCACCACAAGTGGTTCAGAGTGG - Intronic
999348972 5:150848742-150848764 GAAACACACCTGGTGCAGAAGGG + Intronic
1006910813 6:37562441-37562463 GAACCACCCCAGGTTGGGAGGGG - Intergenic
1007828180 6:44617450-44617472 GACCCATTCCTGCTTCAGTGAGG - Intergenic
1008171598 6:48214333-48214355 GAACCACTCCTAGTAAAAAGAGG - Intergenic
1010264732 6:73853176-73853198 GGACCTGTCCTGGTCCAGAGAGG - Intergenic
1011088210 6:83566927-83566949 GAACCTCTTCTGTTTCCGAGAGG + Intronic
1015294649 6:131576798-131576820 GACACACTCCAGGTTCACAGGGG - Intronic
1016252997 6:142069884-142069906 TAACAACTCCTGGTTTAAAGAGG + Intronic
1020607341 7:10356015-10356037 GAACCACTACTGGTTTATGGGGG + Intergenic
1021165415 7:17333672-17333694 GAACCACTCCTTGTTCCTAATGG - Intronic
1023130296 7:36996467-36996489 GAATCAGTCCTGGTTCTTAGGGG + Intronic
1023275113 7:38510498-38510520 GAACCATGCCTGGATCAAAGTGG - Intronic
1026241293 7:68577688-68577710 GAACCACCGTTGGTTCAGTGTGG + Intergenic
1028339061 7:89695276-89695298 GAACCAGCCCTAGGTCAGAGGGG + Intergenic
1035282884 7:157788479-157788501 GAACCCATCCTGGTTTAGGGAGG + Intronic
1049207166 8:141368995-141369017 GAGCCAGTCCTGGTCCAGAGAGG - Intergenic
1050013985 9:1213444-1213466 GTACCACTCCTGGGTCACAAAGG + Intergenic
1052802078 9:32978165-32978187 GAACCACTACTGCTTCAAAAGGG + Intronic
1053153060 9:35754964-35754986 GAATCACTCCAGGTTCACAGAGG + Exonic
1056230557 9:84538832-84538854 GAACCAGCCCTGGGCCAGAGGGG - Intergenic
1056579730 9:87882142-87882164 AAACCACTCCTGGCTCATGGTGG + Intergenic
1057351756 9:94304470-94304492 GAGCCACTGCTGGCTCAGAGGGG + Intergenic
1057391775 9:94646526-94646548 GAACTCTTCCTGGTCCAGAGAGG + Intergenic
1059547529 9:115193180-115193202 GAACCACAGCTGCTTCAGAATGG - Intronic
1061403188 9:130379403-130379425 GGACCTCACCTGGTACAGAGAGG + Intronic
1061505955 9:131032031-131032053 GACCCACTCCTGGGGCAGAGGGG - Exonic
1061798033 9:133099790-133099812 GAACCAGTGCAGGCTCAGAGTGG - Intronic
1188897462 X:35686609-35686631 GGACCTGTCCTGGTTCAGAGGGG + Intergenic
1191700680 X:64038602-64038624 GGACCTGTCCTGGGTCAGAGGGG + Intergenic
1195971498 X:110478188-110478210 GGACCTGCCCTGGTTCAGAGGGG - Intergenic
1199981348 X:152922235-152922257 GATCCACTCCTGGCTCAAACAGG + Exonic
1201894069 Y:18974952-18974974 CAACCACTCCTGGCCCTGAGTGG + Intergenic
1201980223 Y:19899223-19899245 AGACCATTCCTGGTTCAGAGAGG + Intergenic