ID: 1152728741

View in Genome Browser
Species Human (GRCh38)
Location 17:81959955-81959977
Sequence GAGGACCGCCGCCCGCGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152728741_1152728746 -7 Left 1152728741 17:81959955-81959977 CCTCGGCGCGGGCGGCGGTCCTC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1152728746 17:81959971-81959993 GGTCCTCCCGGGGCGCGCGGCGG 0: 1
1: 0
2: 0
3: 18
4: 139
1152728741_1152728750 26 Left 1152728741 17:81959955-81959977 CCTCGGCGCGGGCGGCGGTCCTC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1152728750 17:81960004-81960026 GTGAAACGCGTCCGCACTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 10
1152728741_1152728745 -10 Left 1152728741 17:81959955-81959977 CCTCGGCGCGGGCGGCGGTCCTC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1152728745 17:81959968-81959990 GGCGGTCCTCCCGGGGCGCGCGG 0: 1
1: 0
2: 2
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152728741 Original CRISPR GAGGACCGCCGCCCGCGCCG AGG (reversed) Intronic
901024062 1:6269887-6269909 GAGGAAGGCCGCCCGCACCTTGG - Intronic
901361306 1:8703227-8703249 CGGGACCTGCGCCCGCGCCGCGG - Intronic
901602081 1:10430419-10430441 GCGGCCCGTCGCTCGCGCCGCGG + Exonic
903263393 1:22143011-22143033 GAGCCCCGCCGCGCGCGCCCCGG - Intronic
903700819 1:25247123-25247145 GGCGGTCGCCGCCCGCGCCGTGG - Intronic
905408486 1:37753207-37753229 CAGGGCCGCCGTCGGCGCCGCGG - Exonic
910981249 1:92961556-92961578 GGGGAGCGCGGCGCGCGCCGCGG - Intergenic
917846578 1:179025693-179025715 GGAGACCGGCGCCGGCGCCGAGG + Intergenic
918388791 1:184037178-184037200 GAGGACCGCCACGAGCACCGTGG + Exonic
922250491 1:223845534-223845556 GGGGGCCGCAGCCCGCGCGGAGG - Intronic
1063115420 10:3068527-3068549 GAAGCCCGGAGCCCGCGCCGCGG - Intronic
1072591470 10:96832202-96832224 GAGGCGCGACGCCCGGGCCGCGG + Intergenic
1073051654 10:100671116-100671138 GAGACCCGCCGCCTCCGCCGGGG + Intergenic
1073325844 10:102643729-102643751 GAGGCCCGGCGCCCCCGCCGCGG - Intergenic
1078250718 11:9614290-9614312 CAGGACGGCCACCCACGCCGGGG + Intergenic
1083610187 11:64000674-64000696 AGGAACCGCCGCCCGAGCCGGGG + Intronic
1083885770 11:65572834-65572856 GAGCCGCGCCGCCCGCGCCCCGG + Exonic
1084112522 11:67023302-67023324 GAGGAGCGCGGCGCGGGCCGGGG - Intronic
1084516912 11:69642405-69642427 GGGAAACGCCGCCCGCGCCCAGG + Intronic
1092743133 12:11649454-11649476 GAGGGCGGGCGCCCGCACCGGGG + Intergenic
1093894662 12:24562708-24562730 GCGGCCCGGCGCCCGCCCCGGGG + Intergenic
1096336926 12:50763976-50763998 CAGGACGGCGGCCCGCGCGGAGG + Intronic
1096829133 12:54300919-54300941 GAGGACCGCGCCCCGCCCCCGGG + Intronic
1100260556 12:92928962-92928984 GAGGAGGGGCGCCCGCGCCGCGG + Intronic
1102471492 12:113162224-113162246 GAGGACTGCCGCCAGCACTGGGG + Intronic
1103570124 12:121839442-121839464 CAGGGCGGCCGCCAGCGCCGCGG - Intergenic
1104961487 12:132490345-132490367 GCGCCCAGCCGCCCGCGCCGGGG + Exonic
1107133327 13:36919686-36919708 CCCGACCGCCGCCCCCGCCGCGG + Intronic
1117478126 14:56118193-56118215 GCGGACGGCCCCACGCGCCGGGG + Intronic
1118292924 14:64541976-64541998 GAGGATGGCCGCCTGCACCGCGG - Exonic
1122558009 14:102592001-102592023 GAAGCCCGTCCCCCGCGCCGCGG + Intergenic
1123047669 14:105526698-105526720 CAGGCCCGCCGCCCCCTCCGCGG - Intronic
1124128911 15:26967868-26967890 GGGTCCCGCCGCCCCCGCCGAGG + Intergenic
1130132916 15:81158944-81158966 GAGCACCGCCGCCTGCTCCACGG + Intergenic
1131846081 15:96491922-96491944 GCGCACCGCCCCCCGCCCCGGGG - Intergenic
1132691131 16:1182431-1182453 GAGCACCGCCCCCAGCGCAGGGG - Intronic
1133079162 16:3305145-3305167 GAGCACGGCCGGCCGGGCCGCGG + Intronic
1138105110 16:54283957-54283979 GAGAACCGCCACCCGCCCCAGGG + Intronic
1138625752 16:58250114-58250136 AGGTACCGCCGCCCGCGCCTGGG + Exonic
1140256142 16:73337886-73337908 GAGGACCCCCCCCCCCGCCAAGG - Intergenic
1140699291 16:77566567-77566589 GAGGACTGCAGCCCTGGCCGAGG + Intergenic
1142130739 16:88430509-88430531 GAGAGCCGCCGCCCTCCCCGAGG + Exonic
1143022955 17:3926107-3926129 GAGGACCGCCCCCAGCCCCCAGG + Intronic
1149994616 17:61400093-61400115 GCGCGCCGCCGCCCGGGCCGGGG + Exonic
1150239947 17:63622926-63622948 CAGAACCCCCGCCCGGGCCGCGG - Intronic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1154070533 18:11148713-11148735 GAGCGTCGCGGCCCGCGCCGAGG - Intronic
1157529517 18:48409452-48409474 GCGCCCCGCCTCCCGCGCCGCGG + Intronic
1158962144 18:62596239-62596261 GAGGACGGCGGCGCGGGCCGGGG + Intergenic
1160807810 19:1000370-1000392 GGGGCCCTCCACCCGCGCCGTGG + Intergenic
1162007181 19:7788327-7788349 GAGCAGCGCCGCGCGCTCCGTGG - Intergenic
1164693728 19:30228336-30228358 CAGGGCCCCCGCCCCCGCCGGGG + Intronic
1166360133 19:42249561-42249583 GTGGCCCGCCGCCTGGGCCGAGG - Exonic
1166367380 19:42284425-42284447 GACGGCCCCCGCGCGCGCCGGGG + Intronic
1167311290 19:48739339-48739361 GAGGACCCCCGGAGGCGCCGTGG + Exonic
925609636 2:5692514-5692536 GACGACGGCCGCCGGCGCGGTGG - Intergenic
931602672 2:64019452-64019474 GAGGGCCGCGGCCCGGGCCGGGG + Intergenic
942448267 2:176092632-176092654 GGGGGCCGCCTCCCGCCCCGAGG - Intergenic
946354584 2:219176930-219176952 GAGGACGGCGGCCCGCCCCGGGG - Intronic
947792647 2:232876837-232876859 GAGGGCCTCGGCCCGCGCCCAGG - Intronic
1169093179 20:2873650-2873672 CAGGGCCGCCGCCCGGCCCGCGG - Intronic
1169171712 20:3470876-3470898 GAAGATCGCCTCCGGCGCCGCGG + Intergenic
1171425297 20:25044968-25044990 GAGGACCCCCTCCCCTGCCGCGG - Intronic
1175859442 20:62142722-62142744 GGGGACCCCCACCCGCTCCGGGG - Intronic
1176020303 20:62959225-62959247 GAGGACAGCCGCCTGCCCCAGGG - Intronic
1178518238 21:33266406-33266428 CACGACCCCCGCCCGCGCCCGGG - Exonic
1179411967 21:41168758-41168780 GAGGACGGCAGCCCCCGCCCGGG + Intronic
1179512024 21:41879418-41879440 CAGGACCCCCGGCCGCGCCAGGG - Exonic
1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG + Exonic
1184276370 22:43411673-43411695 GAGGAGCGGGGCCCGCGCTGCGG - Intronic
954803197 3:53199314-53199336 GAGGCCAGCCGCCCCAGCCGAGG + Intergenic
955400320 3:58586827-58586849 GAGCAACGCCACCCTCGCCGCGG - Intronic
961775174 3:129279148-129279170 GAGCACCGGCCCCCGCTCCGGGG + Intronic
964201223 3:154121388-154121410 GCGGGCCGGCGCCGGCGCCGCGG + Intronic
966362930 3:179148911-179148933 CAGGGCCGCCGCCCCGGCCGCGG + Intronic
968965362 4:3766614-3766636 CAGCGCCGCCGCCAGCGCCGGGG - Exonic
971327468 4:25655893-25655915 GAGTACCGCCGCCGGGGCAGGGG + Intronic
972890514 4:43551535-43551557 GAGCACCGCCCCCTGCTCCGCGG + Intergenic
973619519 4:52712698-52712720 GGGCACCGCCGCCCGCCCCCCGG - Intergenic
975870774 4:78776363-78776385 GGGCCCCGCCGCCCGCTCCGCGG - Exonic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
984888716 4:184473422-184473444 GGGGTCAGCCGCCCGGGCCGCGG - Intronic
985129224 4:186724450-186724472 GAGGCCAGGCGCCCGCGGCGGGG - Intronic
986330517 5:6713641-6713663 GTGGAACGCCGCCGCCGCCGCGG + Intergenic
997129543 5:131263697-131263719 GATGTCCGCGGCCCGGGCCGGGG + Intronic
998374516 5:141682065-141682087 GGGGAGGGCCGCCGGCGCCGAGG + Intronic
998435918 5:142108795-142108817 AAGCACCGCCGCCGCCGCCGAGG - Exonic
1001902595 5:175444234-175444256 GAGGACCGCCCCCAGGGCAGGGG - Intergenic
1002424510 5:179167298-179167320 GAGAACAGCGGCCCGGGCCGGGG + Intronic
1003425730 6:5997154-5997176 GAAGCCCGCCGCCCGCTGCGGGG - Intergenic
1013619374 6:111873138-111873160 GGCGGCCGCCGCCCGCGCCAGGG - Exonic
1014137654 6:117907606-117907628 CAGCACCGCCTCCCGGGCCGCGG + Exonic
1015244801 6:131063389-131063411 AAGGTCCCCCGCCCGCGCAGGGG - Intergenic
1017717212 6:157221416-157221438 GAGAACGGCTGCCGGCGCCGCGG - Intergenic
1017793703 6:157823303-157823325 GAGGAGCGGCCGCCGCGCCGGGG + Exonic
1019426972 7:982555-982577 GAGGGCTGCCGCCCGGGCAGGGG - Intergenic
1019795232 7:3043780-3043802 GAGGGGCGCCGCCCGCCCAGGGG + Exonic
1023965976 7:44963230-44963252 GGGGAGCGCCGCCCTCGCCAGGG + Intronic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1035455423 7:159005925-159005947 GAGGACGGCCTCCCGCGCTCCGG + Intergenic
1038808006 8:30812495-30812517 GGGGAGCGGCGCCCGGGCCGGGG - Exonic
1045118739 8:99012967-99012989 GGGAACCGCCGCCGGCGCAGCGG + Intergenic
1049457338 8:142700402-142700424 GGGGAGCCCCGCCCGCCCCGGGG - Exonic
1049944465 9:580808-580830 GAGCACCGCCCCCTGCTCCGCGG - Intronic
1053381223 9:37650942-37650964 GGGCTCCGCCTCCCGCGCCGAGG - Intronic
1059769799 9:117414671-117414693 CTGGAGCGGCGCCCGCGCCGGGG - Exonic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060555299 9:124504796-124504818 GATGACGGCCGCTCGGGCCGGGG + Intronic
1061408587 9:130406063-130406085 GGGGACCGCAGCCTGCGCCTTGG + Intronic
1062313031 9:135949723-135949745 GAGGACGGCCGCACGCTCCCCGG + Intronic
1062389290 9:136327648-136327670 CGGGAGCGCCCCCCGCGCCGTGG - Exonic
1189534512 X:41923174-41923196 CGGCCCCGCCGCCCGCGCCGGGG - Intronic
1199772674 X:150984257-150984279 GAGGAGTGCGCCCCGCGCCGGGG + Intronic
1200128824 X:153830400-153830422 GCGGCCCGCCCCCCGCGCCAGGG - Exonic