ID: 1152728776

View in Genome Browser
Species Human (GRCh38)
Location 17:81960088-81960110
Sequence CGGCAGGAAGGCTCCCCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152728776_1152728787 15 Left 1152728776 17:81960088-81960110 CCGGCGGGGGAGCCTTCCTGCCG 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1152728787 17:81960126-81960148 CCCAAGTCTCCCGCTGTCCCCGG 0: 1
1: 0
2: 1
3: 45
4: 226
1152728776_1152728791 25 Left 1152728776 17:81960088-81960110 CCGGCGGGGGAGCCTTCCTGCCG 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1152728791 17:81960136-81960158 CCGCTGTCCCCGGCTGTCCTCGG 0: 1
1: 0
2: 1
3: 23
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152728776 Original CRISPR CGGCAGGAAGGCTCCCCCGC CGG (reversed) Intronic