ID: 1152728787

View in Genome Browser
Species Human (GRCh38)
Location 17:81960126-81960148
Sequence CCCAAGTCTCCCGCTGTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 226}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152728777_1152728787 3 Left 1152728777 17:81960100-81960122 CCTTCCTGCCGAGCCCCGACCCC 0: 1
1: 0
2: 3
3: 61
4: 556
Right 1152728787 17:81960126-81960148 CCCAAGTCTCCCGCTGTCCCCGG 0: 1
1: 0
2: 1
3: 45
4: 226
1152728774_1152728787 20 Left 1152728774 17:81960083-81960105 CCGACCCGGCGGGGGAGCCTTCC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1152728787 17:81960126-81960148 CCCAAGTCTCCCGCTGTCCCCGG 0: 1
1: 0
2: 1
3: 45
4: 226
1152728780_1152728787 -10 Left 1152728780 17:81960113-81960135 CCCCGACCCCACGCCCAAGTCTC 0: 1
1: 0
2: 0
3: 17
4: 249
Right 1152728787 17:81960126-81960148 CCCAAGTCTCCCGCTGTCCCCGG 0: 1
1: 0
2: 1
3: 45
4: 226
1152728778_1152728787 -1 Left 1152728778 17:81960104-81960126 CCTGCCGAGCCCCGACCCCACGC 0: 1
1: 0
2: 1
3: 35
4: 354
Right 1152728787 17:81960126-81960148 CCCAAGTCTCCCGCTGTCCCCGG 0: 1
1: 0
2: 1
3: 45
4: 226
1152728779_1152728787 -5 Left 1152728779 17:81960108-81960130 CCGAGCCCCGACCCCACGCCCAA 0: 1
1: 0
2: 8
3: 53
4: 684
Right 1152728787 17:81960126-81960148 CCCAAGTCTCCCGCTGTCCCCGG 0: 1
1: 0
2: 1
3: 45
4: 226
1152728775_1152728787 16 Left 1152728775 17:81960087-81960109 CCCGGCGGGGGAGCCTTCCTGCC 0: 1
1: 1
2: 1
3: 19
4: 169
Right 1152728787 17:81960126-81960148 CCCAAGTCTCCCGCTGTCCCCGG 0: 1
1: 0
2: 1
3: 45
4: 226
1152728776_1152728787 15 Left 1152728776 17:81960088-81960110 CCGGCGGGGGAGCCTTCCTGCCG 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1152728787 17:81960126-81960148 CCCAAGTCTCCCGCTGTCCCCGG 0: 1
1: 0
2: 1
3: 45
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152728787 Original CRISPR CCCAAGTCTCCCGCTGTCCC CGG Intronic