ID: 1152728791

View in Genome Browser
Species Human (GRCh38)
Location 17:81960136-81960158
Sequence CCGCTGTCCCCGGCTGTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 207}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152728784_1152728791 -7 Left 1152728784 17:81960120-81960142 CCCACGCCCAAGTCTCCCGCTGT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1152728791 17:81960136-81960158 CCGCTGTCCCCGGCTGTCCTCGG 0: 1
1: 0
2: 1
3: 23
4: 207
1152728775_1152728791 26 Left 1152728775 17:81960087-81960109 CCCGGCGGGGGAGCCTTCCTGCC 0: 1
1: 1
2: 1
3: 19
4: 169
Right 1152728791 17:81960136-81960158 CCGCTGTCCCCGGCTGTCCTCGG 0: 1
1: 0
2: 1
3: 23
4: 207
1152728781_1152728791 -1 Left 1152728781 17:81960114-81960136 CCCGACCCCACGCCCAAGTCTCC 0: 1
1: 0
2: 2
3: 16
4: 321
Right 1152728791 17:81960136-81960158 CCGCTGTCCCCGGCTGTCCTCGG 0: 1
1: 0
2: 1
3: 23
4: 207
1152728777_1152728791 13 Left 1152728777 17:81960100-81960122 CCTTCCTGCCGAGCCCCGACCCC 0: 1
1: 0
2: 3
3: 61
4: 556
Right 1152728791 17:81960136-81960158 CCGCTGTCCCCGGCTGTCCTCGG 0: 1
1: 0
2: 1
3: 23
4: 207
1152728776_1152728791 25 Left 1152728776 17:81960088-81960110 CCGGCGGGGGAGCCTTCCTGCCG 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1152728791 17:81960136-81960158 CCGCTGTCCCCGGCTGTCCTCGG 0: 1
1: 0
2: 1
3: 23
4: 207
1152728774_1152728791 30 Left 1152728774 17:81960083-81960105 CCGACCCGGCGGGGGAGCCTTCC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1152728791 17:81960136-81960158 CCGCTGTCCCCGGCTGTCCTCGG 0: 1
1: 0
2: 1
3: 23
4: 207
1152728780_1152728791 0 Left 1152728780 17:81960113-81960135 CCCCGACCCCACGCCCAAGTCTC 0: 1
1: 0
2: 0
3: 17
4: 249
Right 1152728791 17:81960136-81960158 CCGCTGTCCCCGGCTGTCCTCGG 0: 1
1: 0
2: 1
3: 23
4: 207
1152728785_1152728791 -8 Left 1152728785 17:81960121-81960143 CCACGCCCAAGTCTCCCGCTGTC 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1152728791 17:81960136-81960158 CCGCTGTCCCCGGCTGTCCTCGG 0: 1
1: 0
2: 1
3: 23
4: 207
1152728778_1152728791 9 Left 1152728778 17:81960104-81960126 CCTGCCGAGCCCCGACCCCACGC 0: 1
1: 0
2: 1
3: 35
4: 354
Right 1152728791 17:81960136-81960158 CCGCTGTCCCCGGCTGTCCTCGG 0: 1
1: 0
2: 1
3: 23
4: 207
1152728783_1152728791 -6 Left 1152728783 17:81960119-81960141 CCCCACGCCCAAGTCTCCCGCTG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1152728791 17:81960136-81960158 CCGCTGTCCCCGGCTGTCCTCGG 0: 1
1: 0
2: 1
3: 23
4: 207
1152728779_1152728791 5 Left 1152728779 17:81960108-81960130 CCGAGCCCCGACCCCACGCCCAA 0: 1
1: 0
2: 8
3: 53
4: 684
Right 1152728791 17:81960136-81960158 CCGCTGTCCCCGGCTGTCCTCGG 0: 1
1: 0
2: 1
3: 23
4: 207
1152728782_1152728791 -2 Left 1152728782 17:81960115-81960137 CCGACCCCACGCCCAAGTCTCCC 0: 1
1: 0
2: 2
3: 42
4: 465
Right 1152728791 17:81960136-81960158 CCGCTGTCCCCGGCTGTCCTCGG 0: 1
1: 0
2: 1
3: 23
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152728791 Original CRISPR CCGCTGTCCCCGGCTGTCCT CGG Intronic