ID: 1152728948

View in Genome Browser
Species Human (GRCh38)
Location 17:81960652-81960674
Sequence GTTGAGCTGCTGCGCGGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152728943_1152728948 14 Left 1152728943 17:81960615-81960637 CCGAGGTGTTGAGTAGGAGGTGC 0: 1
1: 0
2: 0
3: 7
4: 186
Right 1152728948 17:81960652-81960674 GTTGAGCTGCTGCGCGGAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 111
1152728940_1152728948 30 Left 1152728940 17:81960599-81960621 CCGTCGTTGCAGGTCACCGAGGT 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1152728948 17:81960652-81960674 GTTGAGCTGCTGCGCGGAGCAGG 0: 1
1: 0
2: 1
3: 14
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152728948 Original CRISPR GTTGAGCTGCTGCGCGGAGC AGG Exonic
900796165 1:4709515-4709537 GATGAGATGCTGCTCTGAGCAGG - Intronic
901352929 1:8614298-8614320 GCTGGGCTGCTGCAAGGAGCAGG - Intronic
902514631 1:16983522-16983544 GCTGAACTGCTGCTCTGAGCCGG - Intergenic
903017015 1:20367723-20367745 GCTAAGCGGCAGCGCGGAGCAGG - Intergenic
903501074 1:23800487-23800509 TTTGGGCTGTAGCGCGGAGCGGG + Intronic
904556830 1:31370759-31370781 GTTAAGCTGCTGGGGGGAGAGGG - Intronic
904921733 1:34013468-34013490 GCTGAGCTCCTGCTGGGAGCTGG + Intronic
906201738 1:43964818-43964840 GTTGAGCTGCTGCTAGGAGGTGG + Intronic
919355443 1:196516332-196516354 GTAGAGCTGCTGTGCTGTGCTGG - Intronic
919453595 1:197799177-197799199 GCTGAGCTGCTGGCCTGAGCTGG + Intergenic
922794905 1:228335170-228335192 GCTGTGCTGCTGCGCAGAGCTGG - Exonic
924436822 1:244049286-244049308 GTGCAGCTGCGGCGCGGGGCGGG + Intronic
1068955637 10:62817190-62817212 CTTCAGCTGCTGCGCGGAGCGGG + Intronic
1072915012 10:99532585-99532607 TTTCAGCTGCTGCGCGGGGCAGG - Intergenic
1076530254 10:131140287-131140309 GCTGAGCTCCTGCCAGGAGCAGG - Intronic
1077159324 11:1105507-1105529 GTTGTTCTGCTGGGAGGAGCTGG - Intergenic
1077755573 11:5024677-5024699 TTTGAGCAGCTGCGCTGTGCTGG - Intergenic
1081713668 11:45233862-45233884 CAGCAGCTGCTGCGCGGAGCGGG - Intronic
1083328302 11:61884916-61884938 GTTGAGCAGCTGCTCTGTGCCGG - Intronic
1083424142 11:62574331-62574353 GAACAGCTGCTGCGCGGAGGTGG + Exonic
1083901805 11:65646956-65646978 GTCCAGCTGCTGCTCGGAGAAGG - Exonic
1084040489 11:66539746-66539768 GGTGCGCTGCTGTGCGGGGCTGG - Exonic
1088884327 11:113995078-113995100 AGTGAGGTGCTGCCCGGAGCAGG + Intergenic
1090881864 11:130840182-130840204 GTTGGGCAGCTGCTGGGAGCTGG + Intergenic
1096176917 12:49527788-49527810 ATTGAGCTCCTGCGTGTAGCAGG + Intergenic
1103412647 12:120723676-120723698 GTTGTGTTGCTGAGGGGAGCAGG + Intergenic
1105240825 13:18608971-18608993 GATGAGCTGCTGCTGGGAACTGG - Intergenic
1108676078 13:52739121-52739143 CTTGAGCAGCCGCGCGGGGCTGG + Exonic
1112840674 13:103573582-103573604 GCTGAGCTGGTGAGCTGAGCTGG + Intergenic
1114270323 14:21097174-21097196 GGTGAGCTGCAGAGTGGAGCGGG - Intronic
1123490531 15:20776169-20776191 GATGAGCTGCTGCTGGGAACTGG + Intergenic
1123547033 15:21345256-21345278 GATGAGCTGCTGCTGGGAACTGG + Intergenic
1129264995 15:74388652-74388674 GTTGAGCTTCTGCTTGAAGCTGG + Intergenic
1129265851 15:74392730-74392752 GTTGGGGTGCTGTGGGGAGCGGG - Intergenic
1130352801 15:83107091-83107113 GGCGGGCTGCTGCACGGAGCCGG - Intergenic
1202955364 15_KI270727v1_random:72472-72494 GATGAGCTGCTGCTGGGAACTGG + Intergenic
1132847167 16:2005942-2005964 GTGGAGGAGCTGCGGGGAGCTGG + Intronic
1139549589 16:67666260-67666282 CTTGAGCTGTGGGGCGGAGCCGG + Exonic
1140927703 16:79599597-79599619 GTTCAGCTGCTGCGGGTAGCCGG + Exonic
1141580004 16:84991013-84991035 GGTGAGCTGCTGAGCAGAGCAGG - Intronic
1142001517 16:87667018-87667040 CTCGAGCTTCTGCCCGGAGCTGG - Intronic
1142012502 16:87722999-87723021 GCTGTGCTGCTGCGCGGCCCAGG - Intronic
1142137237 16:88457084-88457106 GTTGGGCTGCTGGGGAGAGCAGG - Intronic
1142187714 16:88702304-88702326 GCTGAGCTGCGGCGAGGAGCTGG + Intronic
1142261111 16:89042800-89042822 GTGAAGCTGCTGGGGGGAGCAGG + Intergenic
1145227986 17:21147158-21147180 GTTGAGGTGCTGAACAGAGCTGG + Intronic
1146398462 17:32486626-32486648 GTTGGGCGGCGGCGCGGAGCGGG + Exonic
1147469730 17:40648093-40648115 GTTTAGCGGCTGTGAGGAGCCGG + Exonic
1147510039 17:41060074-41060096 GTTGGGCTGTTGAGAGGAGCTGG + Exonic
1147953926 17:44122167-44122189 GTTGAGATGCTGGGCTGGGCTGG - Intronic
1151190155 17:72392519-72392541 GATGGGCTGCTGAGCAGAGCTGG + Intergenic
1151712323 17:75813850-75813872 GTGGAACTGCTGCTCGGTGCGGG - Exonic
1152108512 17:78344014-78344036 GTTTACCTGCTGCCCAGAGCTGG + Intergenic
1152522707 17:80868922-80868944 GATGAGCTGCTGCTGGGGGCAGG + Intronic
1152728948 17:81960652-81960674 GTTGAGCTGCTGCGCGGAGCAGG + Exonic
1154448144 18:14450936-14450958 GATGAGCTGCTGCTGGGAACTGG + Intergenic
1157590297 18:48832576-48832598 GTCGAGCTGCTGTGAGGAGAGGG - Intronic
1159387321 18:67742655-67742677 GTGGAGCTGATGCGCCGTGCTGG - Intergenic
1163830333 19:19544494-19544516 CTGCAGCTGCTCCGCGGAGCCGG - Exonic
1164888745 19:31805170-31805192 GTTGAGCTCCTTGGAGGAGCAGG + Intergenic
1166307096 19:41941058-41941080 GGGGCGCTGCTGCGCGGAGCCGG - Intergenic
1166809182 19:45505746-45505768 GTTGAGCTGCTGAGCCGGGCGGG + Intergenic
1168256259 19:55167029-55167051 GTTGTGCTGGGGCGGGGAGCGGG - Intergenic
925636265 2:5943687-5943709 GTTGAGATGATGCGGGGTGCAGG + Intergenic
928988577 2:37206136-37206158 GTTGATCTGCTGTGCTGAGGAGG + Intronic
929583707 2:43100886-43100908 TTTGTGCGGCGGCGCGGAGCCGG + Intergenic
930411209 2:51028192-51028214 CCTGGGCTGCTGGGCGGAGCTGG - Exonic
933688477 2:85161458-85161480 GTGGAGCTGCTTCACTGAGCTGG + Intronic
935250134 2:101253404-101253426 GTTGAGCAGGTGCGCGAAGCTGG - Exonic
938357079 2:130660364-130660386 GTAGAGCTGCTGTGCTGTGCTGG + Intergenic
947860544 2:233354616-233354638 GATGAGCTTCTGTGGGGAGCCGG - Exonic
948920900 2:241065467-241065489 CTGGAGCTGGTGCGAGGAGCGGG - Exonic
1172174903 20:32966421-32966443 CCTGAGATGCTGCGCAGAGCAGG - Intergenic
1172409534 20:34711040-34711062 GTTGAGAAGCTGCAGGGAGCAGG + Exonic
1174446231 20:50593139-50593161 GGTGGGCTGCTCCCCGGAGCTGG - Exonic
1175517709 20:59579420-59579442 GCTGGGATGCTGCGGGGAGCAGG + Intronic
1175895241 20:62333129-62333151 GCTGAGCTGCTCCGTGGGGCAGG + Exonic
1179175279 21:39003586-39003608 GTTGAGCAGGTGCTAGGAGCTGG - Intergenic
1181009339 22:20031422-20031444 GTTGCCCTGCTGCGCTGTGCTGG + Intronic
1184969320 22:48003935-48003957 GTGGAGCTCCTCCGCTGAGCAGG - Intergenic
956678644 3:71757619-71757641 GCTGAGCTGCTGCCCAAAGCTGG - Intergenic
960492889 3:118338713-118338735 GTTGAACTGCTGTGCTGAGAGGG + Intergenic
961484461 3:127207319-127207341 GCTGAGCTGCAGGGCGGAGCAGG + Intergenic
966974662 3:185073419-185073441 GTTGAGCTGCTAGGTGGGGCTGG + Intergenic
967876994 3:194274178-194274200 GTGGAGATGCTCCGAGGAGCTGG - Intergenic
968732139 4:2274208-2274230 GTGGAGCTGCTGCATGGAGAAGG + Exonic
969655647 4:8496483-8496505 GTTGAGCTCCTGCATGGGGCGGG - Intergenic
969842408 4:9892138-9892160 GTTGTTCTGCTGGGCAGAGCCGG + Intronic
971605482 4:28652208-28652230 GTAGAGCTGCTGTGCTGTGCTGG + Intergenic
985845808 5:2346189-2346211 GTGGAGCTGCTGTGCTGTGCCGG + Intergenic
986578131 5:9233854-9233876 ATTTAGCTGCTGAGCTGAGCTGG - Intronic
987397432 5:17437961-17437983 CTTGAGCCACTGCGCCGAGCTGG + Intergenic
987542494 5:19274109-19274131 GTAGAGCAGCTGCTAGGAGCAGG - Intergenic
989579472 5:43018276-43018298 CTTTTGCCGCTGCGCGGAGCCGG + Intergenic
992461351 5:76963379-76963401 GTGGAGCTGCTGGGAGGAACTGG + Exonic
996592327 5:125161321-125161343 GTAGAGCTGGTGTGCTGAGCTGG - Intergenic
998292144 5:140926263-140926285 GTGGAGCTGCCGAGCGGAGGCGG - Intronic
1003942764 6:11044633-11044655 GTTGAGCCGCCGCGCGAAACCGG - Intergenic
1010295791 6:74194496-74194518 GTAGAGCTGCTGTGCTGTGCTGG + Intergenic
1014747829 6:125220734-125220756 GTGGAGCTGCTGTGGGGATCCGG + Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1017536216 6:155350042-155350064 ATAGAGCTGCTGCGCTGTGCTGG + Intergenic
1018231799 6:161682540-161682562 GTGGAGGGGCTGCGGGGAGCAGG + Intronic
1023171518 7:37394258-37394280 GTTGAGCTGCTCCTTGGTGCTGG - Intronic
1034420902 7:150990158-150990180 GTTGAGCTCCTGCACTGAGTGGG - Intergenic
1034461494 7:151200156-151200178 GGTGAGCTGCTGCCAGGGGCCGG + Intronic
1034622226 7:152464540-152464562 GGTGAGCCGCTGGGCGGAGCCGG + Intergenic
1040578086 8:48671843-48671865 GGTGAGCTCCTGCTTGGAGCAGG + Intergenic
1041089080 8:54285357-54285379 CGTGAGCTGCTGCGCCCAGCTGG - Intergenic
1042591599 8:70403041-70403063 GGCGAGCTGCAGCGCGGGGCGGG - Intronic
1042649534 8:71024201-71024223 GTTCAGCTGCTGGTGGGAGCAGG + Intergenic
1043301842 8:78744105-78744127 GTAGAGCAGCTGCGCAGTGCTGG + Intronic
1049755326 8:144308988-144309010 GTTGAGCTGCCGCACGAAGCTGG - Exonic
1051821984 9:21180019-21180041 GTAGAGCTGCTGGGCTGTGCAGG - Intergenic
1051825025 9:21210618-21210640 GTAGAGCTGCTGGGCTGGGCTGG - Intronic
1051827018 9:21232681-21232703 GTAGAGCTGCTGGGCTGTGCTGG - Intronic
1057724149 9:97556373-97556395 TTGGAGGTGCTGGGCGGAGCAGG + Intronic
1059414987 9:114156736-114156758 CAGGAGCGGCTGCGCGGAGCTGG + Intronic
1061260135 9:129475679-129475701 GCTGAGCTGCTGCACATAGCAGG + Intergenic
1061798412 9:133101598-133101620 GTAGAGCGGCAGCGCGGAGCTGG + Exonic
1061951904 9:133941124-133941146 CGTGAGCTGCTGCGCCCAGCCGG - Intronic
1186509285 X:10118309-10118331 GTTCAGCTCCTCCTCGGAGCTGG + Intronic
1191877315 X:65809783-65809805 GTAGAGCTGCTGCACTGTGCTGG - Intergenic
1192522782 X:71816193-71816215 TTGGAGCTGCTGGGCAGAGCAGG + Intergenic
1195104754 X:101593376-101593398 GTTGAGCAGCTGTGCTGGGCTGG + Intergenic
1202306090 Y:23472522-23472544 GCTGGGCTGCTGCAAGGAGCAGG + Intergenic
1202564719 Y:26198067-26198089 GCTGGGCTGCTGCAAGGAGCAGG - Intergenic