ID: 1152729161

View in Genome Browser
Species Human (GRCh38)
Location 17:81961376-81961398
Sequence AGCGCCTCCGGCGGCCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 620}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152729161_1152729182 22 Left 1152729161 17:81961376-81961398 CCGCCGCGGCCGCCGGAGGCGCT 0: 1
1: 0
2: 5
3: 41
4: 620
Right 1152729182 17:81961421-81961443 GCAGCGCGGCCGGGCGGCCCCGG 0: 1
1: 0
2: 5
3: 51
4: 436
1152729161_1152729171 -1 Left 1152729161 17:81961376-81961398 CCGCCGCGGCCGCCGGAGGCGCT 0: 1
1: 0
2: 5
3: 41
4: 620
Right 1152729171 17:81961398-81961420 TCCCGGCCCGGCTCCGTGGGGGG 0: 1
1: 0
2: 2
3: 13
4: 155
1152729161_1152729179 12 Left 1152729161 17:81961376-81961398 CCGCCGCGGCCGCCGGAGGCGCT 0: 1
1: 0
2: 5
3: 41
4: 620
Right 1152729179 17:81961411-81961433 CCGTGGGGGGGCAGCGCGGCCGG 0: 1
1: 0
2: 0
3: 21
4: 228
1152729161_1152729170 -2 Left 1152729161 17:81961376-81961398 CCGCCGCGGCCGCCGGAGGCGCT 0: 1
1: 0
2: 5
3: 41
4: 620
Right 1152729170 17:81961397-81961419 CTCCCGGCCCGGCTCCGTGGGGG 0: 1
1: 0
2: 5
3: 19
4: 163
1152729161_1152729181 16 Left 1152729161 17:81961376-81961398 CCGCCGCGGCCGCCGGAGGCGCT 0: 1
1: 0
2: 5
3: 41
4: 620
Right 1152729181 17:81961415-81961437 GGGGGGGCAGCGCGGCCGGGCGG 0: 1
1: 0
2: 5
3: 107
4: 857
1152729161_1152729169 -3 Left 1152729161 17:81961376-81961398 CCGCCGCGGCCGCCGGAGGCGCT 0: 1
1: 0
2: 5
3: 41
4: 620
Right 1152729169 17:81961396-81961418 GCTCCCGGCCCGGCTCCGTGGGG 0: 1
1: 0
2: 6
3: 25
4: 190
1152729161_1152729173 0 Left 1152729161 17:81961376-81961398 CCGCCGCGGCCGCCGGAGGCGCT 0: 1
1: 0
2: 5
3: 41
4: 620
Right 1152729173 17:81961399-81961421 CCCGGCCCGGCTCCGTGGGGGGG 0: 1
1: 0
2: 3
3: 29
4: 268
1152729161_1152729168 -4 Left 1152729161 17:81961376-81961398 CCGCCGCGGCCGCCGGAGGCGCT 0: 1
1: 0
2: 5
3: 41
4: 620
Right 1152729168 17:81961395-81961417 CGCTCCCGGCCCGGCTCCGTGGG 0: 1
1: 0
2: 0
3: 17
4: 119
1152729161_1152729180 13 Left 1152729161 17:81961376-81961398 CCGCCGCGGCCGCCGGAGGCGCT 0: 1
1: 0
2: 5
3: 41
4: 620
Right 1152729180 17:81961412-81961434 CGTGGGGGGGCAGCGCGGCCGGG 0: 1
1: 0
2: 1
3: 40
4: 322
1152729161_1152729177 8 Left 1152729161 17:81961376-81961398 CCGCCGCGGCCGCCGGAGGCGCT 0: 1
1: 0
2: 5
3: 41
4: 620
Right 1152729177 17:81961407-81961429 GGCTCCGTGGGGGGGCAGCGCGG 0: 1
1: 0
2: 2
3: 24
4: 312
1152729161_1152729183 25 Left 1152729161 17:81961376-81961398 CCGCCGCGGCCGCCGGAGGCGCT 0: 1
1: 0
2: 5
3: 41
4: 620
Right 1152729183 17:81961424-81961446 GCGCGGCCGGGCGGCCCCGGCGG 0: 1
1: 0
2: 8
3: 88
4: 605
1152729161_1152729167 -5 Left 1152729161 17:81961376-81961398 CCGCCGCGGCCGCCGGAGGCGCT 0: 1
1: 0
2: 5
3: 41
4: 620
Right 1152729167 17:81961394-81961416 GCGCTCCCGGCCCGGCTCCGTGG 0: 1
1: 0
2: 8
3: 42
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152729161 Original CRISPR AGCGCCTCCGGCGGCCGCGG CGG (reversed) Intronic