ID: 1152729299

View in Genome Browser
Species Human (GRCh38)
Location 17:81961749-81961771
Sequence GGCCACTGGGCCGCCCGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152729299_1152729310 17 Left 1152729299 17:81961749-81961771 CCAGCGCGGGCGGCCCAGTGGCC 0: 1
1: 0
2: 1
3: 8
4: 194
Right 1152729310 17:81961789-81961811 CTGGCCCTGCGCCGTCCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 185
1152729299_1152729303 -2 Left 1152729299 17:81961749-81961771 CCAGCGCGGGCGGCCCAGTGGCC 0: 1
1: 0
2: 1
3: 8
4: 194
Right 1152729303 17:81961770-81961792 CCCCGTCCTCTCAGCGCCCCTGG 0: 1
1: 0
2: 3
3: 28
4: 282
1152729299_1152729313 26 Left 1152729299 17:81961749-81961771 CCAGCGCGGGCGGCCCAGTGGCC 0: 1
1: 0
2: 1
3: 8
4: 194
Right 1152729313 17:81961798-81961820 CGCCGTCCCGCTGGTGCGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152729299 Original CRISPR GGCCACTGGGCCGCCCGCGC TGG (reversed) Intronic
900201107 1:1407058-1407080 GGCCAAGGGGCGGCCGGCGCGGG - Intronic
900471821 1:2858842-2858864 GGCCACTGGGGCGTCCCCGCTGG - Intergenic
900513794 1:3072019-3072041 GGCCACTGGGGCACCCAAGCCGG + Intronic
901676570 1:10889010-10889032 GGCCCCTGGGCGGCCGGGGCGGG + Intergenic
901823084 1:11842692-11842714 GGCCAATGGGCCCCCGGCCCTGG + Exonic
903132754 1:21290289-21290311 GCCCACGGAGCGGCCCGCGCGGG + Intronic
904927225 1:34058685-34058707 GCCCACTGGGCTGCCCACCCTGG + Intronic
905028971 1:34868865-34868887 GGCCAGTGGGCCTACCGCGAGGG - Exonic
906204333 1:43979171-43979193 GGCCGCGGGGGCGCGCGCGCGGG + Intronic
906641093 1:47440788-47440810 GGCCCCTGGGCAGCCCAAGCAGG + Intergenic
908007283 1:59739899-59739921 GGCCAATGGGCAGCCCCAGCAGG + Intronic
912879137 1:113390982-113391004 GGCGCCCCGGCCGCCCGCGCGGG + Exonic
912993454 1:114510980-114511002 GGCCGCCGGGCCCGCCGCGCAGG - Exonic
914053605 1:144152222-144152244 TGCCACCGGCCCGCCCGCCCGGG + Intergenic
914125592 1:144814319-144814341 TGCCACCGGCCCGCCCGCCCGGG - Intergenic
914490929 1:148149654-148149676 GTCCCCTGGGCCGCCCGGGGGGG - Intronic
916666942 1:166975397-166975419 GCCCGCCGGGCCGGCCGCGCAGG + Intronic
918148193 1:181776236-181776258 GGCCCCTCGGCCGCCCCAGCGGG + Intronic
1062801500 10:384713-384735 GGACACTAGGCCGCACGGGCAGG + Intronic
1062890459 10:1056429-1056451 GGCCGCGGTGCCGGCCGCGCGGG - Intronic
1064278399 10:13928789-13928811 GCCCACTGGGCCGTCTGTGCTGG - Intronic
1064384541 10:14878804-14878826 CGCCCCTGGCCGGCCCGCGCGGG - Intronic
1067110677 10:43397348-43397370 GGCCACGGGGCCGCACCTGCAGG - Intronic
1069019155 10:63466028-63466050 GGCTGCTGCCCCGCCCGCGCCGG - Intergenic
1069909509 10:71750863-71750885 GGACACTGGGCCACCCTCCCAGG - Exonic
1072903579 10:99430663-99430685 GGCCGCGGGCCCGCCCCCGCCGG - Intergenic
1073061726 10:100737419-100737441 GGCCGCTGTGCCACGCGCGCCGG - Intronic
1073414267 10:103368212-103368234 GGCACCGGGGCCGCCCCCGCCGG - Exonic
1076795063 10:132794313-132794335 GGCCACTGGGCACCCAGTGCCGG - Intergenic
1077173040 11:1176805-1176827 GCCCACTGGGCCTCCCTGGCTGG - Intronic
1077480529 11:2812450-2812472 GGCCACAGAGCCGGCCGGGCAGG - Intronic
1083258116 11:61508878-61508900 GGCCCCCGGGCCCCCCGCCCCGG - Exonic
1083388810 11:62333243-62333265 GGCCACTGGGCAGCCCGGCTCGG - Intergenic
1088058089 11:105610057-105610079 TGCCACTGGGCTGCGCGCGGGGG - Exonic
1089207112 11:116773103-116773125 GGCCACCGGGACGCGCTCGCAGG + Intergenic
1089609772 11:119662896-119662918 GGCTACTGGGCAGCCTGGGCTGG + Exonic
1094025898 12:25959119-25959141 CGCAACTGCGCCGCCCCCGCAGG - Exonic
1097269460 12:57765339-57765361 TGGCACGGGGCCGCCCGCCCTGG - Exonic
1098320596 12:69239733-69239755 GGCCGCAGCGCCGCCCGCGTCGG - Intronic
1102097696 12:110253324-110253346 GGCCACTGGGCCTCGTGAGCTGG + Intergenic
1102247175 12:111362887-111362909 GGGCACTGGGCCGGCGGGGCAGG + Exonic
1102339201 12:112108564-112108586 GGCCACTAGGCCGCAGCCGCGGG - Intronic
1102924915 12:116819344-116819366 GGCCTCCGGGCGTCCCGCGCCGG - Intronic
1102954259 12:117049133-117049155 GGCCACTGGGTCCCTTGCGCAGG + Exonic
1103509997 12:121467459-121467481 CGCCATTGGCCCGCCCGCCCGGG - Intronic
1103604777 12:122078664-122078686 GGCCAATCGGCTGCCCGCGTCGG - Intergenic
1103763722 12:123268087-123268109 GGCCACTGGGACGCCATTGCGGG - Intronic
1104889354 12:132132853-132132875 GGCCACTGTGCTGCCTGCCCCGG + Intergenic
1105931656 13:25058147-25058169 GGCCAGTGGGCAGCCCTGGCTGG - Intergenic
1112271897 13:97976467-97976489 GGCCAGTGAGGCGCCGGCGCCGG + Intronic
1112580601 13:100674270-100674292 GGCCGCTTGGCCGCCTGCCCTGG - Intronic
1115261380 14:31457495-31457517 GGCCACTGGGCAATCGGCGCAGG - Exonic
1115592116 14:34874630-34874652 GGACCCTCGGCCGCCCGCGCCGG + Exonic
1117424388 14:55580153-55580175 GGCGTCTGGGCCGGCGGCGCCGG - Intronic
1119522151 14:75294323-75294345 AGCCACTGCGCCGCCGGCCCGGG + Intergenic
1121452541 14:94018367-94018389 GGGCACTTGGCCGGCTGCGCAGG - Intergenic
1123034612 14:105466816-105466838 GGGCCCTGGGCCGCCCGCCGCGG - Intronic
1130028044 15:80286617-80286639 GGCCACTGGGCCACTCTCCCTGG + Intergenic
1130967122 15:88705642-88705664 AGCCACTCGGGCGCCCGCGGCGG + Intergenic
1132657099 16:1045957-1045979 GGGCCCTGGGCAGCCCGCTCTGG - Intergenic
1132774943 16:1588236-1588258 GGCTACTGGGCCGGCCGCAGTGG + Intronic
1133054428 16:3138468-3138490 GGCCACGGGGCCTCCCCCGACGG + Exonic
1133784374 16:8963430-8963452 GGCCCCGGGGCGGCCCGCGGCGG + Exonic
1136269701 16:29141453-29141475 GGGCACTGGGCAGCCCCAGCAGG - Intergenic
1137614561 16:49838910-49838932 GGTCCCGGGGCCGCCCCCGCGGG + Intronic
1139908326 16:70381409-70381431 GGCCGCTGGCCCGCCCCCGAAGG + Exonic
1141623667 16:85250199-85250221 GGCCACTTGGCCTCCCTCCCTGG - Intergenic
1142073325 16:88103383-88103405 GGGCACTGGGCAGCCCCAGCAGG - Intronic
1203123088 16_KI270728v1_random:1555652-1555674 TGCCACCGGCCCGCCCGCCCGGG - Intergenic
1143528165 17:7484269-7484291 CGCTACGGGGCCGCCTGCGCAGG - Intergenic
1145236769 17:21214044-21214066 GGCCGCTGAGCCGCCTGCACTGG + Intronic
1146303481 17:31710018-31710040 GGACATGGGGCGGCCCGCGCAGG - Intergenic
1146329729 17:31917340-31917362 GGCCTCTGGGGCGCCCAAGCGGG + Intergenic
1147325716 17:39668449-39668471 GGGCACTGGGCGGACCGCGGCGG + Exonic
1148894649 17:50832802-50832824 TGCCACTGAGCCGCTCCCGCTGG + Intergenic
1150266740 17:63837154-63837176 GGCCACTGGGCAGGCCTCCCAGG + Intronic
1150622069 17:66814972-66814994 GGGCACTGGGCAGCCCGGGGAGG + Intergenic
1152142410 17:78544513-78544535 GGCCACTTGGCCGGGCGCGGTGG + Intronic
1152635538 17:81429203-81429225 GGCCTCTGAGCCGCCCGCCTGGG + Intronic
1152729299 17:81961749-81961771 GGCCACTGGGCCGCCCGCGCTGG - Intronic
1152745593 17:82037269-82037291 GACCACCCGGCCGCCCACGCAGG + Intronic
1152834267 17:82519504-82519526 GGACAGTCGGCAGCCCGCGCGGG - Intergenic
1153219136 18:2847088-2847110 GGCCAGGGCGCCGCCCGCGAAGG - Exonic
1153773462 18:8433465-8433487 AGGCACTTGGCCGCCCGCGGAGG - Intergenic
1158005245 18:52664756-52664778 GGCCACTGGGCCGGGCGCGGTGG - Intronic
1160763516 19:797362-797384 AGCCAATGGGCAGCGCGCGCGGG + Exonic
1160859372 19:1231151-1231173 GGCCACGGCGTCGCCCGCCCGGG + Exonic
1161161105 19:2762278-2762300 GGCCGCAGGGCTGCCCGCGGAGG - Intronic
1164051159 19:21586641-21586663 GTCCGCTCGGCCGCCCGCCCCGG - Intergenic
1164617688 19:29676667-29676689 GGCCAGTGGGCCTCCCACACTGG - Intergenic
1166039106 19:40191567-40191589 GGCCCCTGGGGCGGCCGCCCCGG - Intergenic
1166639745 19:44485591-44485613 GGCCAGTGGGCTGCCAGAGCTGG - Intronic
1166671166 19:44710382-44710404 GGCCACTGGGTGGCCCGGGGTGG + Intronic
1167037813 19:47004327-47004349 GGCCAATGCGCGGCGCGCGCGGG + Exonic
1167134435 19:47608692-47608714 GGGGACTGGGCCCTCCGCGCCGG - Intronic
1202693003 1_KI270712v1_random:104643-104665 TGCCACCGGCCCGCCCGCCCGGG + Intergenic
925872340 2:8282224-8282246 GGCCACTGGGCGGGCCACACAGG + Intergenic
927809549 2:26173648-26173670 TGCCCCTGGGCCCCCCGCCCCGG + Intronic
927823699 2:26292172-26292194 GGCAACTGGGCCGGGCGCGGTGG + Intergenic
933953394 2:87349319-87349341 TGCCACCGGCCCGCCCGCCCGGG - Intergenic
934275600 2:91571162-91571184 TGCCACCGGCCCGCCCGCCCGGG + Intergenic
934474799 2:94586914-94586936 GGCCTCTGAGCCCCCAGCGCTGG - Intergenic
936083867 2:109453267-109453289 GGCCACAGGGCAGCCCCTGCAGG - Intronic
941934670 2:170973647-170973669 GGTCTCCGGGCCGCCCTCGCAGG + Intergenic
942268230 2:174248663-174248685 GGCCAATGGGCGGGACGCGCGGG - Exonic
942463871 2:176188612-176188634 CGCCACGTGGCCGCCCCCGCCGG + Exonic
944495994 2:200307294-200307316 GGGAACGGGGGCGCCCGCGCGGG - Intronic
945833255 2:214810111-214810133 GGCGCCTGGGCCCCGCGCGCCGG - Intergenic
946372043 2:219286752-219286774 GGCCACTGGGCTCCCCAGGCAGG - Exonic
948370599 2:237487115-237487137 GACACCTGGGGCGCCCGCGCGGG - Intronic
948809027 2:240465661-240465683 GGCCCCTTGGCCGCCCGGCCAGG - Intronic
1168777750 20:462282-462304 GCCCCCCGGGCCGCCCTCGCAGG + Intronic
1170598837 20:17825395-17825417 GGCCAATGGGGGGCCCGGGCAGG - Intergenic
1170605229 20:17870478-17870500 GGACACCGGGCTGCCTGCGCTGG - Intergenic
1171107979 20:22453880-22453902 GGCCGGTGGGCCACCTGCGCTGG + Intergenic
1172568979 20:35954236-35954258 GGCCACTGGGAGTCCCGCGGCGG - Exonic
1173913531 20:46689091-46689113 AGCCTCGGGGCCGCCCACGCCGG + Intronic
1175922894 20:62458388-62458410 GGCCACGGGGCAGCCAGGGCCGG + Intergenic
1176030066 20:63007456-63007478 GGCCACAGGGCGCCCCGAGCAGG - Intergenic
1176271534 20:64237591-64237613 TGCCAGTGGGCCGCCGGAGCTGG + Intronic
1176706261 21:10121567-10121589 TGCCCCTGGCCCGCCCGCCCGGG - Intergenic
1178327752 21:31659523-31659545 GGCCAAGGGGCCGCGTGCGCCGG - Intergenic
1178610300 21:34073775-34073797 GGCAGCGGGGGCGCCCGCGCGGG - Intronic
1178623373 21:34195693-34195715 GGCCACTGGGACTCCAGAGCAGG - Intergenic
1178671560 21:34595784-34595806 GGCCACTGGGCAGGCCGGACAGG + Intronic
1179466948 21:41582039-41582061 GGCCTCTGGGAGGACCGCGCAGG + Intergenic
1179805202 21:43832873-43832895 GGCAACTTGGCCTCCCGAGCAGG + Intergenic
1180168258 21:46041262-46041284 GGCTACTGGGCCACACACGCTGG - Intergenic
1180215913 21:46323828-46323850 AGCCCAGGGGCCGCCCGCGCGGG + Exonic
1180613831 22:17114642-17114664 GGCCAGTGGGACACCCGTGCAGG - Exonic
1181356225 22:22297855-22297877 TGCCACCGGCCCGCCCGCCCGGG + Intergenic
1181941834 22:26483764-26483786 GGCCTCTCTGCCGCGCGCGCAGG - Exonic
1184087724 22:42275244-42275266 GGACACTGGGCAGCTCGGGCAGG + Intronic
1184160119 22:42692829-42692851 GGGCACTGGGCCGCCCTTCCCGG - Exonic
1184686976 22:46100646-46100668 GGCCACGCGGCCGCCGGCTCTGG - Intronic
1185055185 22:48575633-48575655 CGCCCCTGGGCTGCCCACGCTGG - Intronic
1185406699 22:50656271-50656293 GGCCACATGGCCGGCCGGGCAGG + Intergenic
961359399 3:126357493-126357515 GGCCAATGGGGCGCGCGCCCGGG - Intergenic
961452266 3:127007709-127007731 GGACACTGTGCCGCCCCTGCTGG - Intronic
963236680 3:142963390-142963412 GGGCGCTGGGCAGCCCCCGCCGG + Exonic
967859638 3:194141376-194141398 GGCCGCAGGGCCGCCAGGGCTGG - Intergenic
968519807 4:1030203-1030225 GGGCACTGGGCCCCTCGGGCTGG + Intergenic
968528925 4:1079911-1079933 GGCCGCTGGCCGGCCCGCCCTGG + Intronic
968730519 4:2267352-2267374 GGCTACCGGGTCGGCCGCGCTGG + Intergenic
972960669 4:44448528-44448550 GGTCACTGGGCCGGCGGCGGGGG - Exonic
977538003 4:98278933-98278955 GGCCACTAGGCCGGGCGCGGTGG + Intronic
985515825 5:344102-344124 GACTCCTGCGCCGCCCGCGCCGG - Intronic
985891172 5:2716072-2716094 GGCCCCTGGGCCTCCTGGGCAGG - Intergenic
991245712 5:64506560-64506582 AACAACCGGGCCGCCCGCGCCGG + Exonic
992385499 5:76280637-76280659 GGCCACGAGGCCGCCGGGGCAGG - Intronic
993386507 5:87268398-87268420 GGCCCCTGGGGCTCCCGGGCGGG + Exonic
997652914 5:135535549-135535571 CGCTTCGGGGCCGCCCGCGCCGG - Exonic
998200574 5:140114739-140114761 GACCATTGCGCTGCCCGCGCAGG + Exonic
998406270 5:141876367-141876389 GCCCGCTGCGCCGCTCGCGCCGG - Intronic
1002255976 5:177958838-177958860 GGCCACTGGGCAGCCGGCACAGG + Intergenic
1002456497 5:179348177-179348199 GGCCACTGGGCCAACGCCGCCGG + Intergenic
1002590919 5:180291539-180291561 GGCCCCTGGGCACCCGGCGCAGG + Intronic
1007105819 6:39282249-39282271 GGCCCCTGGGCCACCTGCTCTGG - Intergenic
1007473622 6:42105673-42105695 GGCCACTAGGCTGCCCACACAGG - Exonic
1008074700 6:47133446-47133468 TGCCACTCAGCCACCCGCGCTGG - Intergenic
1019111982 6:169724136-169724158 CGCCAGCGCGCCGCCCGCGCGGG + Intronic
1019662471 7:2232568-2232590 CGCCCCTCGGCCGCCCGCCCTGG + Intronic
1020292076 7:6729981-6730003 GGCCGCAGGGCCGCCGGCTCAGG - Intergenic
1020395809 7:7716658-7716680 AGCCACCGCGCCGGCCGCGCCGG - Intronic
1023831256 7:44040115-44040137 GGCCACTGGCACGCCCACGTAGG - Intergenic
1029741586 7:102494421-102494443 GGCCACTGGCACGCCCACGTAGG - Intronic
1029759577 7:102593590-102593612 GGCCACTGGCACGCCCACGTAGG - Intronic
1029776944 7:102689500-102689522 GGCCACTGGCACGCCCACGTAGG - Intergenic
1030598081 7:111562586-111562608 GGTCTCTGGACCGCCCGCCCAGG + Intergenic
1032306112 7:130733791-130733813 GGGCGCGGCGCCGCCCGCGCCGG + Exonic
1035022686 7:155808623-155808645 GGCCTCTCCTCCGCCCGCGCTGG + Intronic
1035159804 7:156942548-156942570 GGCCGCTGGGCCATCTGCGCTGG - Intergenic
1035279548 7:157769131-157769153 GGACACTGGGCTGGCCGCGGTGG - Intronic
1035573314 8:688197-688219 GGCCCCTGAGCCGCCCACGCAGG + Intronic
1036787841 8:11699612-11699634 GGCCACTGCGCCTCCAGCGCTGG + Intronic
1038720024 8:30027366-30027388 CGCAGCTGGGCCGCCCGAGCCGG + Intergenic
1039618237 8:38974161-38974183 GGCCACGGCGCCGCCTCCGCCGG - Exonic
1048833446 8:138497327-138497349 GGCCGCCGGGCGGCCCGCCCCGG - Intergenic
1049606545 8:143532284-143532306 GGCCACTGGGCCGCACGGCAAGG + Intronic
1049687749 8:143945750-143945772 GGCCACTGGGCAGGCCACCCAGG + Intronic
1051896564 9:21994731-21994753 GGCCCCTGGGCCGTCACCGCGGG - Intronic
1052855251 9:33402845-33402867 GGCCTCTGAGCCCCCAGCGCTGG + Intergenic
1053643547 9:40108684-40108706 TGCCCCTGGCCCGCCCGCCCGGG - Intergenic
1054541205 9:66267920-66267942 TGCCCCTGGCCCGCCCGCCCGGG + Intergenic
1054981957 9:71217235-71217257 GGCCACTGGGCCGGGCGCGGTGG - Intronic
1055932809 9:81576881-81576903 GGCCACTGGACCTCCCCAGCTGG - Intergenic
1057044473 9:91874250-91874272 GGCCACTTGGCCACCTGCACCGG + Intronic
1057083574 9:92189703-92189725 GGCCACTGGGCCACGGGGGCAGG - Intergenic
1057546319 9:96022059-96022081 GGCCACTTGGCCGGGGGCGCCGG - Intergenic
1057623124 9:96654673-96654695 GGGCACTGGGCCGCCCACGCTGG + Intronic
1058885856 9:109320738-109320760 AGCCCCTCGGCAGCCCGCGCAGG - Exonic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060549435 9:124478023-124478045 GGCCACTCAGCGGCCCGAGCTGG + Intronic
1060662825 9:125414363-125414385 GGCCACGGGGCCACCTGCGAGGG - Intergenic
1061490247 9:130940229-130940251 GGCCACAGGGTCCCCCGCTCCGG - Intergenic
1061873902 9:133534610-133534632 GGCCGCTCCCCCGCCCGCGCCGG - Intronic
1062288999 9:135786248-135786270 GGGCCCTGGGGCTCCCGCGCTGG + Exonic
1062595719 9:137298259-137298281 GCCCACAGGGCTGCCCGGGCAGG + Intergenic
1202791297 9_KI270719v1_random:91656-91678 TGCCCCTGGCCCGCCCGCCCGGG - Intergenic
1189274867 X:39778344-39778366 GCCCAGTGGGCAGCCCGAGCAGG - Intergenic
1196828448 X:119758632-119758654 GGACACTGGGACGGCCGCGGCGG + Exonic
1197765559 X:130057373-130057395 GGCCTCTGGGCCTCCAGCGCTGG + Exonic
1198184082 X:134237179-134237201 GGCAACCGCGCGGCCCGCGCTGG + Exonic
1200119795 X:153784863-153784885 GGGCACAGGGCAGCCCGGGCGGG - Intronic