ID: 1152729844

View in Genome Browser
Species Human (GRCh38)
Location 17:81964247-81964269
Sequence GGGTGCTCAAAACTCCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152729844_1152729853 4 Left 1152729844 17:81964247-81964269 CCCACCCGGAGTTTTGAGCACCC No data
Right 1152729853 17:81964274-81964296 CCTGGCAGCAGCTCCCGTGGCGG No data
1152729844_1152729862 29 Left 1152729844 17:81964247-81964269 CCCACCCGGAGTTTTGAGCACCC No data
Right 1152729862 17:81964299-81964321 CCTATGGGCCAGCAGGTGCTGGG No data
1152729844_1152729851 1 Left 1152729844 17:81964247-81964269 CCCACCCGGAGTTTTGAGCACCC No data
Right 1152729851 17:81964271-81964293 GAGCCTGGCAGCAGCTCCCGTGG No data
1152729844_1152729859 22 Left 1152729844 17:81964247-81964269 CCCACCCGGAGTTTTGAGCACCC No data
Right 1152729859 17:81964292-81964314 GGCGGGTCCTATGGGCCAGCAGG No data
1152729844_1152729856 14 Left 1152729844 17:81964247-81964269 CCCACCCGGAGTTTTGAGCACCC No data
Right 1152729856 17:81964284-81964306 GCTCCCGTGGCGGGTCCTATGGG No data
1152729844_1152729855 13 Left 1152729844 17:81964247-81964269 CCCACCCGGAGTTTTGAGCACCC No data
Right 1152729855 17:81964283-81964305 AGCTCCCGTGGCGGGTCCTATGG No data
1152729844_1152729860 28 Left 1152729844 17:81964247-81964269 CCCACCCGGAGTTTTGAGCACCC No data
Right 1152729860 17:81964298-81964320 TCCTATGGGCCAGCAGGTGCTGG No data
1152729844_1152729854 5 Left 1152729844 17:81964247-81964269 CCCACCCGGAGTTTTGAGCACCC No data
Right 1152729854 17:81964275-81964297 CTGGCAGCAGCTCCCGTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152729844 Original CRISPR GGGTGCTCAAAACTCCGGGT GGG (reversed) Intergenic
No off target data available for this crispr