ID: 1152735062

View in Genome Browser
Species Human (GRCh38)
Location 17:81993133-81993155
Sequence AAGCCCAAGGTGCCACACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152735062_1152735065 4 Left 1152735062 17:81993133-81993155 CCTGGGTGTGGCACCTTGGGCTT 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1152735065 17:81993160-81993182 GCTTGGTCTGTTCTCATTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 166
1152735062_1152735067 8 Left 1152735062 17:81993133-81993155 CCTGGGTGTGGCACCTTGGGCTT 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1152735067 17:81993164-81993186 GGTCTGTTCTCATTTCAGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 166
1152735062_1152735066 5 Left 1152735062 17:81993133-81993155 CCTGGGTGTGGCACCTTGGGCTT 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1152735066 17:81993161-81993183 CTTGGTCTGTTCTCATTTCAGGG 0: 1
1: 0
2: 1
3: 19
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152735062 Original CRISPR AAGCCCAAGGTGCCACACCC AGG (reversed) Intronic
900164489 1:1239358-1239380 CAGCCCCAGGGTCCACACCCAGG + Intergenic
900923843 1:5690817-5690839 CATCACAAGGTGCCACACACTGG - Intergenic
901220213 1:7579365-7579387 AAGCCCACGCTGCCATGCCCAGG - Intronic
902978765 1:20108519-20108541 AAGCCCAAGGTCACACAGCTGGG + Intergenic
903650272 1:24917752-24917774 TAGCCCAAGGACCCACAGCCAGG + Intronic
903933750 1:26880199-26880221 AGGCCCAAGGTCCCTCTCCCGGG - Intronic
904289967 1:29478572-29478594 AAGCCAGGGGTCCCACACCCAGG - Intergenic
904615679 1:31748313-31748335 AAGCCCAAGGCCACACAGCCAGG + Intronic
907706638 1:56838296-56838318 TACCCCAAGGTGACACTCCCTGG + Intergenic
909942606 1:81627847-81627869 CAGCACAAGATGCCACAGCCTGG + Intronic
912369619 1:109163986-109164008 AAGCCCAAAGTCCCACAGCAAGG + Intronic
913297496 1:117336213-117336235 AAGCCCCAGCTGCCAGTCCCAGG + Intergenic
913977067 1:143468485-143468507 AAGCCCAAAGACCCACAACCAGG + Intergenic
914071470 1:144294112-144294134 AAGCCCAAAGACCCACAACCAGG + Intergenic
914107685 1:144672244-144672266 AAGCCCAAAGACCCACAACCAGG - Intergenic
914195538 1:145446353-145446375 AAGCCCCAGGTCTCACGCCCGGG + Intergenic
919857187 1:201713854-201713876 AATCCCAAATGGCCACACCCTGG - Intronic
919940828 1:202284877-202284899 AGGCCCAAGGAGCATCACCCAGG - Intronic
920498181 1:206470129-206470151 AAGTCCATGCTCCCACACCCAGG - Intergenic
1063427137 10:5959348-5959370 AAGTGCACGGTGCCACGCCCTGG + Intronic
1065234711 10:23637346-23637368 AATGCCAAAGTGCCAAACCCTGG - Intergenic
1070705329 10:78633569-78633591 AAGCCTAAGGTCCCACAGCACGG + Intergenic
1072017832 10:91366761-91366783 AAGCCAAAGAGGCCATACCCAGG - Intergenic
1072760101 10:98049485-98049507 TGGCCCAAGGTGGCACAGCCAGG - Intergenic
1079342901 11:19627856-19627878 TTGTCCAAGGTGGCACACCCAGG - Intronic
1081741190 11:45441928-45441950 AAGCTCAAGGAGGCAGACCCTGG + Intergenic
1083659472 11:64245539-64245561 CAGCCCAAGGTCCCCAACCCTGG - Intronic
1083752022 11:64766170-64766192 AAGCCCAAGGTCACACGCGCGGG + Intronic
1084490897 11:69477755-69477777 AGCCCCAAGCTGCCACAGCCTGG + Intergenic
1087133558 11:94692115-94692137 AAGGCCAAGGTGTCAGACCAAGG + Intergenic
1091188768 11:133671659-133671681 CAGTCCAATGTGGCACACCCAGG - Intergenic
1092052783 12:5484273-5484295 AAGCCCAGGGTGCCAGAAACTGG - Intronic
1092747528 12:11688059-11688081 AGGCCCAGGGTCCCACACCAGGG + Intronic
1094846265 12:34362701-34362723 AAGGCAGAGGTGCCACACCACGG - Intergenic
1096148990 12:49297048-49297070 AAGTCCAAGGTGCAAGAGCCGGG + Exonic
1099805906 12:87518326-87518348 AAGCCCAAGGTGCCCTGCACAGG - Intergenic
1100530678 12:95458579-95458601 AAGCCCCAGGTCCCACTCTCTGG - Intergenic
1101242769 12:102854839-102854861 AAGCCCAAGGTGCTTCACTGAGG - Intronic
1102209782 12:111117939-111117961 ATGCCCAAGGTCACACAGCCAGG + Intronic
1102961782 12:117098308-117098330 TAGCCCAAGGTCACACAGCCAGG + Intronic
1104748846 12:131225667-131225689 CAGGCCAAGATGCCACACCCAGG - Intergenic
1104784277 12:131439897-131439919 CAGGCCAAGATGCCACACCCAGG + Intergenic
1104983904 12:132586029-132586051 AAGCCCAAGTTGGGACACACAGG - Intergenic
1105222159 13:18341331-18341353 AAGCCCAAAGACCCACAACCAGG - Intergenic
1105579677 13:21683479-21683501 AAGCCCAAGGTGAGGCAGCCAGG - Intronic
1110366883 13:74696677-74696699 AGGGCAAAGGTGCCACAGCCTGG - Intergenic
1110538282 13:76678168-76678190 AATCCCAAGGTGCTATGCCCAGG + Intergenic
1112331865 13:98483073-98483095 AATCCCAAAGTGCTACTCCCTGG + Intronic
1113105938 13:106771632-106771654 AGCCCCAAGGTGCTACACCAGGG - Intergenic
1114305465 14:21419414-21419436 AGGCACATGCTGCCACACCCAGG - Intronic
1117993589 14:61458442-61458464 CAGCCCTAGATGCCACACCTTGG + Intronic
1119191085 14:72682345-72682367 AATCACAAGTTGCCACACCAGGG - Intronic
1121844034 14:97157739-97157761 CTGCCCAAGGTGGCACAGCCAGG - Intergenic
1122217029 14:100211547-100211569 CAGCCCCAGGTGCCTCAGCCTGG + Intergenic
1202902096 14_GL000194v1_random:49982-50004 GAGCCCAAAGTCTCACACCCAGG - Intergenic
1123936473 15:25196512-25196534 AGGCTCAAGGTGCCACCACCAGG - Intergenic
1125679510 15:41522184-41522206 CAGCCCCAGGAGCCACACACTGG + Exonic
1130649788 15:85756044-85756066 GAGCGCCAGGTGCCAAACCCAGG + Intergenic
1132092896 15:98960161-98960183 ACGCCACAGGCGCCACACCCAGG + Exonic
1132711944 16:1272767-1272789 AAGCCTCCTGTGCCACACCCTGG + Intergenic
1133461818 16:5993013-5993035 AAGCCCAGGGTCCCCCAGCCTGG - Intergenic
1134516830 16:14894337-14894359 AAGCGGTAAGTGCCACACCCTGG - Intronic
1134704501 16:16292991-16293013 AAGCGGTAAGTGCCACACCCTGG - Intronic
1134963041 16:18419123-18419145 AAGCGGTAAGTGCCACACCCTGG + Intronic
1134967336 16:18501722-18501744 AAGCGGTAAGTGCCACACCCTGG + Intronic
1137874914 16:51986923-51986945 AAGCTCCAGCTGTCACACCCTGG - Intergenic
1138016783 16:53435188-53435210 GAGACCCAGGTGCCACAACCCGG - Intronic
1139283504 16:65789880-65789902 AAGGCCAGGGTGCCACCCACAGG + Intergenic
1139428719 16:66899669-66899691 AAGCCAGAGGTGCCAGGCCCAGG - Intergenic
1141171605 16:81695161-81695183 CTGGCCAAGGTCCCACACCCAGG + Intronic
1142010762 16:87712659-87712681 AAGGCCCAGGTGCCTCTCCCAGG - Intronic
1142738221 17:1915120-1915142 AAGCTCAAAGAACCACACCCAGG - Intergenic
1143676480 17:8436340-8436362 CAGCCCACGGTGCCACGTCCCGG - Intronic
1143817147 17:9526178-9526200 AAGCCCAAGGGACAAAACCCAGG + Intronic
1145078615 17:19875972-19875994 AAGCCTAAGGTCCTACAGCCAGG - Intergenic
1146820969 17:35983580-35983602 ATGCCGAGGGTGCCACACCCTGG + Intronic
1147605179 17:41770363-41770385 GTGCCCAAGCAGCCACACCCTGG + Intronic
1147810659 17:43167576-43167598 ACACCCCAGGTGCCACACCCTGG - Intergenic
1151161654 17:72171083-72171105 AAACCCAGGGGGCCACAGCCTGG + Intergenic
1151228976 17:72668376-72668398 ATTCCCAAGGTGCCAAACTCCGG + Intronic
1151817971 17:76480876-76480898 AAGCCCACGCTGCCACAAGCCGG + Intronic
1152266961 17:79300793-79300815 CAGCCCCAGGTGCCTCACCAAGG - Intronic
1152602631 17:81272468-81272490 AAGCCCCGGGTCCCACTCCCCGG + Intronic
1152735062 17:81993133-81993155 AAGCCCAAGGTGCCACACCCAGG - Intronic
1152772694 17:82179932-82179954 AAGGCCATGGGGCCACACACTGG + Intronic
1153091454 18:1349974-1349996 AAACCTAAGGTGCCACTCCACGG - Intergenic
1153964859 18:10170035-10170057 CAGCTCAAGGTCCCACATCCTGG - Intergenic
1157204712 18:45688286-45688308 AAGGCCAAGGAGCCACAGCGGGG - Intergenic
1159449179 18:68577911-68577933 AAGCCAAAGGTTGGACACCCTGG - Intergenic
1160237776 18:77099574-77099596 GAGCCCCAGGTGGCACAGCCGGG - Intronic
1161035800 19:2083719-2083741 AAACCCAACCTGCCACAGCCTGG + Intronic
1161734941 19:5985996-5986018 GAGCCCAGAGTGCCACAGCCGGG + Intergenic
1161881358 19:6955833-6955855 ATGCCCAAGGTCACACAGCCAGG + Intergenic
1162763780 19:12905221-12905243 ATGCCCAAGGTTCCAGACCAAGG + Intronic
1168294996 19:55373933-55373955 TAGCCCAATGTGTCCCACCCTGG - Intergenic
925669343 2:6294342-6294364 AAGCCCAAGCTGTCCCTCCCAGG - Intergenic
925999610 2:9319604-9319626 AAGGCCCAAGTGCCACAGCCTGG - Intronic
926059037 2:9793848-9793870 CAGCCCAAAGTGCCACAGCTCGG + Intergenic
927844249 2:26463337-26463359 AAGGCCCAGTGGCCACACCCAGG + Intronic
928197833 2:29227982-29228004 ATGCCCATGGTGCCTCTCCCAGG + Intronic
930142337 2:47965052-47965074 AAACCCAACTTTCCACACCCAGG + Intergenic
932556444 2:72829121-72829143 TAGCCCATGCTGCCCCACCCAGG + Intergenic
934181768 2:89629463-89629485 AAGCCCAAAGACCCACAACCAGG + Intergenic
934292073 2:91703682-91703704 AAGCCCAAAGACCCACAACCAGG + Intergenic
935902229 2:107805369-107805391 AAGCACAAAGTGCCAGGCCCAGG + Intergenic
937039278 2:118808404-118808426 AAGCCGAAGGCCGCACACCCTGG - Intergenic
937100162 2:119262516-119262538 AAGCACATGCTGCCACAGCCTGG + Intronic
937930904 2:127204681-127204703 AGCCCCAAGGCCCCACACCCTGG - Intronic
946584504 2:221169799-221169821 ATACCAAAGGTCCCACACCCTGG + Intergenic
948281684 2:236751898-236751920 AAGGCCCAGATCCCACACCCCGG - Intergenic
1174242602 20:49149824-49149846 AAGCCCAAGTTGGGTCACCCTGG + Intronic
1174615720 20:51833956-51833978 TTGCCCAAGGTGACACAACCTGG - Intergenic
1175825441 20:61934173-61934195 AGGCCCATGGTGCCGCACCCAGG + Exonic
1176621465 21:9064749-9064771 GAGCCCAAAGTCTCACACCCAGG - Intergenic
1176730708 21:10493754-10493776 AAGCCCAAAGACCCACAACCAGG - Intergenic
1179788867 21:43744140-43744162 AGGGGCAAGGGGCCACACCCAGG + Intronic
1179876902 21:44273207-44273229 GAGCCCAAGGTGCCCCACAGGGG - Intergenic
1180876823 22:19178597-19178619 AAGGCCAAGCTGACGCACCCGGG - Exonic
1181901443 22:26159692-26159714 AATCCCAAGCTGTCACACCGAGG + Intergenic
1182349001 22:29687968-29687990 GAGCCCAAGGTGTCCCATCCGGG - Intronic
1182711803 22:32327877-32327899 ATGCCCGAGGTGCCCCATCCCGG - Intergenic
1183363610 22:37395748-37395770 CAGCCCACGGTGCCAAGCCCAGG - Intronic
1183503648 22:38196354-38196376 GAGGCCAAGGGACCACACCCTGG - Intronic
1184235977 22:43183224-43183246 CCACCCGAGGTGCCACACCCAGG + Intronic
1184261649 22:43320876-43320898 GAGCCCAAGGGGCCTAACCCCGG + Intronic
1184610844 22:45602199-45602221 CAGTCCAAGGAGCCACATCCGGG + Intergenic
1185127989 22:49022388-49022410 AACCCCATGGTGCCAACCCCAGG - Intergenic
1185319657 22:50194640-50194662 AAGCCCACCTTGCCACTCCCAGG - Intronic
1203234234 22_KI270731v1_random:140947-140969 AAGGCCAAGGTGCCCTCCCCAGG - Intergenic
949152064 3:781303-781325 AAGGCCAAGGAGCCACATTCTGG - Intergenic
952027330 3:29099186-29099208 AAGCCGAAGTTGCCACACTCCGG + Intergenic
954061611 3:48072355-48072377 AGGCACACGCTGCCACACCCAGG - Intronic
954971299 3:54653790-54653812 AAGGCCCCAGTGCCACACCCAGG - Intronic
956027601 3:65000206-65000228 AAGCCCAAGGTCACACAGCCAGG + Intergenic
960159933 3:114339342-114339364 AAGCACATGGTGACACACACAGG - Exonic
961466826 3:127087145-127087167 AAGCCCACGGTGTCCCAGCCTGG - Intergenic
965616894 3:170603167-170603189 AAGCCAAAGGGGCCACAAGCAGG - Intronic
968056226 3:195694034-195694056 ACCCCCAACGTCCCACACCCTGG - Intergenic
970945618 4:21687967-21687989 AAGCCCAAAGTACCAAACCTAGG - Intronic
971076811 4:23158628-23158650 TAGCCCAAGGTTCCACTCCTTGG + Intergenic
974208724 4:58741893-58741915 AGGCGCATGCTGCCACACCCAGG - Intergenic
976297575 4:83487390-83487412 AAGCCTGAGTGGCCACACCCTGG + Intronic
985480870 5:109473-109495 CACCCCCAGGTGCCACACCCTGG + Intergenic
985579810 5:690665-690687 AAGGCCAAAGCGCCACACGCAGG - Intronic
985594656 5:782724-782746 AAGGCCAAAGCGCCACACGCAGG - Intergenic
992029920 5:72710811-72710833 AGACCCAATGTGCCACACACGGG + Intergenic
993867328 5:93211022-93211044 AAGGCCTAGGTTCCACACCTTGG - Intergenic
996505535 5:124264007-124264029 AAGACCAAGGAGCAACCCCCTGG + Intergenic
997809987 5:136957614-136957636 AATCCTATGATGCCACACCCTGG - Intergenic
1000909338 5:167002524-167002546 AGGCACAAGCTACCACACCCGGG - Intergenic
1003012244 6:2436684-2436706 AAGCCCACGGTTCCAGCCCCAGG - Intergenic
1006742614 6:36320292-36320314 AAGCTCCAGTTGCCACCCCCTGG - Intronic
1015360243 6:132331720-132331742 AAGCCCAAAGTACCACAGCTGGG + Intronic
1017875008 6:158517037-158517059 AATGCCAAGGTGCCACATTCTGG - Intergenic
1017974185 6:159340190-159340212 AAGCCAAGGGTGCTATACCCAGG + Intergenic
1019256981 7:58868-58890 AAGCTGAAGGTGCCACCCCCAGG - Intergenic
1019410562 7:904854-904876 AAGCCTCAGCTGCCCCACCCTGG + Intronic
1023859062 7:44206209-44206231 CAGCCCAATGGGCCACACACAGG - Intronic
1025724478 7:64044475-64044497 ATGCCCAAGGTTCCACATACAGG - Intronic
1027171996 7:75879098-75879120 AAGCACCAGCTGCGACACCCGGG - Exonic
1027400213 7:77798871-77798893 GAGCCCAAGGAGCCACAACGAGG - Exonic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1031977295 7:128102231-128102253 ATGCCCAAGGAGCCACCTCCAGG - Intergenic
1034598876 7:152227772-152227794 AAGCCCAAAGACCCACAACCAGG + Intronic
1038540189 8:28385425-28385447 GAGCCCACGGTGCCACCGCCGGG + Intronic
1040899431 8:52403015-52403037 CAGCCCAATGTCCCACCCCCAGG - Intronic
1040975295 8:53186872-53186894 AAGCCCAAGGAGTCACAGACAGG - Intergenic
1041380288 8:57247863-57247885 AAGGCCCAAGTGCCACAGCCTGG + Intergenic
1049924181 9:392940-392962 AAGCACATGTTACCACACCCAGG - Intronic
1050635401 9:7607071-7607093 TAAACCAATGTGCCACACCCAGG - Intergenic
1051029808 9:12659381-12659403 AAGCCCAAGGTGACTCAGCAAGG + Intergenic
1053164222 9:35833332-35833354 AAGCCCAAGATGACACCTCCAGG - Intronic
1057194972 9:93111744-93111766 TAGCCTCAGGTGCCACAGCCTGG + Intronic
1057448323 9:95134743-95134765 GAGCCCAGGGTGCCAGACACTGG + Intronic
1058847131 9:108972097-108972119 CAGCCCAAGGTGACCCTCCCGGG - Intronic
1059339186 9:113587850-113587872 CAGCACAGGGCGCCACACCCAGG - Intronic
1062327001 9:136017295-136017317 CAGCCCATGGTGCCACCCCGAGG + Intronic
1203744651 Un_GL000218v1:35161-35183 GAGCCCAAGGTCTCACACCCAGG - Intergenic
1203565453 Un_KI270744v1:84323-84345 GAGCCCAAGGTCTCACACCCAGG + Intergenic
1185796813 X:2972527-2972549 TACCCCAAGCTGCCTCACCCTGG + Intergenic
1185857701 X:3551086-3551108 AAGCTGAAGGTCCCACATCCTGG - Intergenic
1186316738 X:8378802-8378824 AAGCCAAAAGAGCCACACACAGG - Intergenic
1186352576 X:8755298-8755320 AAGCCCAAGGTGGCACCACCTGG - Intergenic
1188739690 X:33763523-33763545 GGGCCCAAGGTGCCATACACTGG + Intergenic
1190261995 X:48803043-48803065 AACCCAAAGGTTCCCCACCCTGG + Intronic
1193163558 X:78256975-78256997 AATACCAAGGTGCTACATCCAGG - Intergenic
1195617041 X:106920648-106920670 AAACCCAAGGTGGCCCAGCCTGG - Intronic
1197728233 X:129790642-129790664 AAGACCACGGTGGCACAACCTGG - Intronic
1197963751 X:132034170-132034192 AGGCCCAAGGGGACACACACAGG + Intergenic
1200234496 X:154461742-154461764 AGGGCAAAGGTGCCACTCCCAGG - Intronic
1201010982 Y:9548045-9548067 AGGGCCAAGGGGCCGCACCCAGG - Intergenic
1201794859 Y:17883907-17883929 AAGCCCAAGCTGTCCCACCAGGG - Intergenic
1201806696 Y:18022078-18022100 AAGCCCAAGCTGTCCCACCAGGG + Intergenic
1202356231 Y:24051686-24051708 AAGCCCAAGCTGTCCCACCAGGG - Intergenic
1202514547 Y:25618423-25618445 AAGCCCAAGCTGTCCCACCAGGG + Intergenic