ID: 1152735570

View in Genome Browser
Species Human (GRCh38)
Location 17:81995396-81995418
Sequence GTGGCTCATCCCCTCAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152735570_1152735581 12 Left 1152735570 17:81995396-81995418 CCTCCCTTGAGGGGATGAGCCAC 0: 1
1: 0
2: 1
3: 7
4: 115
Right 1152735581 17:81995431-81995453 CCAGGCCCAGCACTGTCCTGAGG 0: 1
1: 1
2: 4
3: 53
4: 453
1152735570_1152735586 27 Left 1152735570 17:81995396-81995418 CCTCCCTTGAGGGGATGAGCCAC 0: 1
1: 0
2: 1
3: 7
4: 115
Right 1152735586 17:81995446-81995468 TCCTGAGGCTGTGGCCCTCAGGG 0: 1
1: 0
2: 1
3: 46
4: 363
1152735570_1152735585 26 Left 1152735570 17:81995396-81995418 CCTCCCTTGAGGGGATGAGCCAC 0: 1
1: 0
2: 1
3: 7
4: 115
Right 1152735585 17:81995445-81995467 GTCCTGAGGCTGTGGCCCTCAGG 0: 1
1: 0
2: 2
3: 39
4: 295
1152735570_1152735584 18 Left 1152735570 17:81995396-81995418 CCTCCCTTGAGGGGATGAGCCAC 0: 1
1: 0
2: 1
3: 7
4: 115
Right 1152735584 17:81995437-81995459 CCAGCACTGTCCTGAGGCTGTGG 0: 1
1: 0
2: 6
3: 72
4: 844
1152735570_1152735577 -6 Left 1152735570 17:81995396-81995418 CCTCCCTTGAGGGGATGAGCCAC 0: 1
1: 0
2: 1
3: 7
4: 115
Right 1152735577 17:81995413-81995435 AGCCACGGGGCTCAGGACCCAGG 0: 1
1: 0
2: 0
3: 24
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152735570 Original CRISPR GTGGCTCATCCCCTCAAGGG AGG (reversed) Intronic
903648399 1:24908700-24908722 GTGGCTCATGCCCCCAAGGGAGG + Intronic
909986994 1:82173211-82173233 TGGGCTCAACCCCTCATGGGAGG - Intergenic
917262337 1:173183657-173183679 GTAGCTCATCCTCTGAAGAGGGG - Intergenic
919831239 1:201541525-201541547 GTGGCTCATGCCCGTAAGAGGGG + Intergenic
921127338 1:212189398-212189420 GTGGCCCATCCCCTCAGGGATGG + Intergenic
1064693600 10:17943207-17943229 GTGTCTCCTCCCCTTAAGTGTGG + Intergenic
1065213304 10:23425171-23425193 GTGGCTCACCCCAACAAGTGTGG - Intergenic
1069548312 10:69344608-69344630 GTGGCTCATACCCTGCAGTGGGG + Intronic
1069879498 10:71583039-71583061 GTGCCTCATCCACTCAACGCAGG + Intronic
1069895841 10:71679557-71679579 CCGCCTCATCCCCACAAGGGAGG - Intronic
1070306787 10:75244602-75244624 GTGGCTCATGCCCACAGGGATGG + Intergenic
1073082869 10:100871078-100871100 GTGGTTCCTCCCTTGAAGGGAGG - Intergenic
1076655424 10:132020388-132020410 GTGATTCATCCCATCAAGTGTGG - Intergenic
1077503989 11:2921862-2921884 GGGGCTCCTCTCCACAAGGGAGG - Intronic
1083640474 11:64142642-64142664 GCGGCTCATCCCCACAAGATCGG - Intronic
1089367975 11:117932582-117932604 GTGACTCACCCCCTTGAGGGTGG - Intergenic
1091727094 12:2853863-2853885 GTGGCTGAGCCCCTCCAGGCAGG - Intronic
1091969305 12:4772427-4772449 GTCTCTCTTCCCCTCCAGGGAGG + Exonic
1092284262 12:7119832-7119854 GTGGCTCATCTGCTGAAGGCTGG + Intergenic
1094315330 12:29133269-29133291 GTTGCTCATCCCTTCAAAAGTGG + Intergenic
1094385364 12:29888205-29888227 GTTGCTCATTCCTTCCAGGGGGG + Intergenic
1096604824 12:52757154-52757176 GTGGGTCATCCTCTCAGAGGTGG - Intergenic
1098416104 12:70237153-70237175 CTGGCTCCTCACCTCCAGGGAGG + Intergenic
1102679726 12:114683192-114683214 GAGGCTCATCCACTCCAGGCGGG + Exonic
1103944079 12:124516701-124516723 CTGGCTCGACCCCTCAAGGATGG - Intronic
1104040954 12:125130302-125130324 GTGGGGCATCCCCCCAGGGGTGG + Intronic
1104794901 12:131510539-131510561 GTGTCTCACCTCCTCCAGGGAGG - Intergenic
1106248764 13:27968711-27968733 GTGGCTCACGGCCTCAACGGTGG - Exonic
1114437113 14:22715298-22715320 GTGGCTCATAACCTCCAGGGGGG + Intergenic
1114437137 14:22715375-22715397 GTGGCTCATAACCTCCAGGAGGG + Intergenic
1117402376 14:55370003-55370025 GTCCCTCATCCCCTCAGGTGAGG - Intronic
1118884375 14:69854044-69854066 ATGGCTCCTCCTCCCAAGGGTGG - Intergenic
1119792990 14:77369901-77369923 GTGGCTCATGCCTGTAAGGGAGG + Intronic
1121655703 14:95594114-95594136 CTGGCTCATCCCCTCACTGTTGG + Intergenic
1122274528 14:100584930-100584952 GTGGCTCCTCCCCCTAAGGGAGG - Intronic
1125376148 15:39031721-39031743 GTGGCTCATCCTCTCTCCGGAGG + Intergenic
1130755713 15:86760838-86760860 GTGGCTTTTCCTCTCTAGGGTGG - Intronic
1131479960 15:92772243-92772265 GTGGTTCATCCTCACACGGGGGG + Intronic
1132339290 15:101067930-101067952 GAGGCTCCTCCCCTAAGGGGAGG + Intronic
1134088032 16:11371969-11371991 GTTGATCATCCACTCAAGAGAGG - Intronic
1141573795 16:84951298-84951320 GTGCCACATCCCCTCAAAAGGGG + Intergenic
1143608749 17:8005577-8005599 CTGACTCATCCCCTGAAGGATGG + Intronic
1144864348 17:18325331-18325353 CTGGCACACACCCTCAAGGGTGG + Intergenic
1145997879 17:29114982-29115004 GTGGCACAGCTCCTCAAAGGAGG + Exonic
1148656268 17:49286034-49286056 GTGCCTCAGTCCCTGAAGGGAGG + Intergenic
1152458072 17:80427391-80427413 GTGGCCCATCCTTGCAAGGGAGG + Intronic
1152735570 17:81995396-81995418 GTGGCTCATCCCCTCAAGGGAGG - Intronic
1152743672 17:82029622-82029644 GTGGCTCACCTCCTCCAGGCGGG - Exonic
1153223418 18:2880801-2880823 GTGGCCGATTCCCTGAAGGGAGG + Intronic
1155618652 18:27750279-27750301 GTGGCTCATCAGCTCAATGCTGG - Intergenic
1156469095 18:37366468-37366490 GTGGCTCATCCGGTCAGGGGAGG + Intronic
1158989121 18:62850882-62850904 GTGGCTCATTTTGTCAAGGGAGG + Intronic
1161493330 19:4574792-4574814 GGGGCTCCTCCCCTCCGGGGAGG + Intergenic
1161739485 19:6011853-6011875 GTGGCCCCTGCCCTCAGGGGGGG + Intronic
1162198036 19:9000571-9000593 GTGGCTCAGCCCTTCCTGGGTGG - Intergenic
1162829707 19:13276637-13276659 GAGACTCATCCTCTCAAGGGGGG + Intronic
1163609146 19:18292156-18292178 GTGGCCCCTCCCCTAATGGGAGG + Intergenic
1165226609 19:34359521-34359543 TTGGCTCATCGCCTCCGGGGAGG - Intronic
1166197023 19:41213712-41213734 GTGGCCCAGCACCTCCAGGGAGG - Intergenic
925070602 2:964643-964665 GTGTCTCTTCCCCACAGGGGAGG - Intronic
927204431 2:20598261-20598283 GTCTCTCATCCCCTGAAGGTGGG - Intronic
928468976 2:31554634-31554656 TTGGCTCATCCCTTCTAAGGTGG + Intronic
932757689 2:74420016-74420038 GTGGCTCATGCCTGCAAGGTGGG - Intronic
941933725 2:170967172-170967194 GATGCTCATCCCCTGCAGGGAGG + Intergenic
941986708 2:171517824-171517846 GTGCCTCATCTCCTGATGGGTGG + Intergenic
1171033172 20:21694791-21694813 GACGCTCATTCCCTCAAGGCTGG - Intergenic
1174860928 20:54090319-54090341 GTGGCTTATCCCCTTAGGGATGG + Intergenic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1179907132 21:44428392-44428414 GTGGCTCCTCCCCTTAGGTGTGG + Intronic
1179907138 21:44428411-44428433 GTGGCTCCTCCCCTTAGGTGTGG + Intronic
1179907162 21:44428486-44428508 GTGGCTCCTCCCCTGAGGTGTGG + Intronic
1179907233 21:44428727-44428749 GTGGCTCCTCCCCTTAGGTGTGG + Intronic
1181862356 22:25828871-25828893 GTGGCACAGCTCCTCAAAGGTGG - Exonic
1182914740 22:34019060-34019082 GTGGCTAAACCACTCATGGGGGG - Intergenic
1185333801 22:50262718-50262740 GCAGCTCAGCCGCTCAAGGGTGG + Intergenic
949105640 3:197591-197613 GTGGCTCCTCCTCTCAGGAGAGG + Intronic
950708395 3:14797938-14797960 GTGAGTCACCCCCTCAAGGTGGG + Intergenic
953751424 3:45611481-45611503 ATGGCCCATCCCCTTGAGGGAGG + Intronic
954035013 3:47846715-47846737 GTGGCTCACGCCCTCCAGGCTGG - Exonic
955960374 3:64334564-64334586 GTGGCTCTGCCCTTCAAGGATGG - Intronic
956622889 3:71238798-71238820 GTGGCTCCCCCACACAAGGGAGG + Intronic
957292524 3:78295414-78295436 TGGGCTCAACCCCTCACGGGAGG - Intergenic
964899583 3:161642271-161642293 GTAGCCCATGCCCTCAAGAGAGG + Intergenic
967872782 3:194246060-194246082 CTGACTCATCCCCTAAAGGGCGG - Intergenic
970955574 4:21807028-21807050 GTCTCTCATCACCTCAAGGTGGG - Intronic
973036447 4:45413247-45413269 GGGGCTAATCCCCTCAAAGGTGG - Intergenic
975254546 4:72217080-72217102 GTGCCCCATGCCCCCAAGGGAGG - Intergenic
985060263 4:186070964-186070986 GTGGCTCATCCCCACAATCCCGG - Intronic
985243175 4:187952207-187952229 GTGGGTCATCCCCACTAGAGAGG - Intergenic
985949863 5:3215017-3215039 GTGTCTCTGCCCCTCATGGGTGG - Intergenic
987275425 5:16356998-16357020 GTAACTAATCCCCTCACGGGTGG - Intergenic
993508452 5:88741117-88741139 GGGGCTCCTATCCTCAAGGGTGG - Intronic
997013469 5:129904901-129904923 CTGGCTCATCGCCCCCAGGGTGG + Exonic
998677563 5:144426700-144426722 GAGGGTCATACCATCAAGGGAGG + Intronic
1001815757 5:174668127-174668149 GTGGCTCATCAGCTCCAGAGAGG + Intergenic
1002374683 5:178780181-178780203 GTGGGGCATCCCCCCAGGGGTGG - Intergenic
1003483851 6:6557382-6557404 GTGGCTAAACCCCTCATGGAAGG + Intergenic
1004603131 6:17169985-17170007 CTGGCTCAGCCCCTAGAGGGTGG - Intergenic
1004628018 6:17394259-17394281 GTGACTCATCGCCTCAAGTCAGG - Intronic
1004907507 6:20250339-20250361 TGGGCTCAACCCCTCATGGGAGG + Intergenic
1007369033 6:41414076-41414098 GTCCCTCATCCCCTGAAGGTGGG + Intergenic
1009966727 6:70586122-70586144 GTGTCACATTCCCTCAAGGTGGG - Intronic
1011212263 6:84967444-84967466 GTGGCTCAACCCCTCATGTTAGG + Intergenic
1016996058 6:149963146-149963168 GTGGCTCTTGGCCGCAAGGGAGG - Intergenic
1019116252 6:169764868-169764890 GAGGCTCATCTACTCAAAGGTGG + Intronic
1019765178 7:2844422-2844444 TTGGCTCATCTCGCCAAGGGAGG + Intergenic
1020098762 7:5382689-5382711 CTGGCCCATCACCTCTAGGGTGG - Intronic
1021484690 7:21154705-21154727 TTTGCTCATCCTCTCCAGGGTGG - Intergenic
1029693184 7:102196065-102196087 TTGGCTCATCCCCCAAATGGTGG + Intronic
1032468164 7:132159723-132159745 ATGGCTCATCCTCTCCAGGATGG + Intronic
1034244958 7:149637005-149637027 GTGGCTCAGCCACTGGAGGGAGG - Intergenic
1038693011 8:29780333-29780355 GTGGCTCCTCCACTCCAGAGAGG - Intergenic
1045959245 8:107947907-107947929 GTGCCTCATGCACCCAAGGGAGG - Intronic
1050147130 9:2580945-2580967 GGGGCCCATCCCATTAAGGGTGG - Intergenic
1053367789 9:37535930-37535952 CTGGCTCAAGCCCTCAAGGAGGG - Intronic
1057210780 9:93199997-93200019 GTGCTCCATCCCCTCAAGGAGGG + Intronic
1058551495 9:106120149-106120171 ATGGCTCCTCACATCAAGGGTGG + Intergenic
1059304366 9:113342152-113342174 GTAGCTCTTCCCATCAAGGCTGG + Intergenic
1060550913 9:124485068-124485090 CTGGCTCTCCCCCTCCAGGGAGG - Intronic
1186128559 X:6442411-6442433 TGCGCTCAACCCCTCAAGGGAGG + Intergenic
1187134014 X:16529465-16529487 TAGGCCCATCCCCTCAAGAGAGG - Intergenic
1195364723 X:104114994-104115016 CTGGCTCTTCCTCTGAAGGGAGG - Exonic
1199677636 X:150201194-150201216 ATGACTCATGCCCTCAAGGCAGG - Intergenic