ID: 1152735674

View in Genome Browser
Species Human (GRCh38)
Location 17:81995801-81995823
Sequence GCTGCAGACCAGACTCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152735664_1152735674 25 Left 1152735664 17:81995753-81995775 CCAGGCTGGGGGAGACACGGTCA 0: 1
1: 0
2: 1
3: 17
4: 201
Right 1152735674 17:81995801-81995823 GCTGCAGACCAGACTCAAGCTGG 0: 1
1: 0
2: 3
3: 18
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152735674 Original CRISPR GCTGCAGACCAGACTCAAGC TGG Intronic
900528570 1:3141389-3141411 GCTGCAGACAGCGCTCAAGCCGG - Intronic
900966405 1:5961830-5961852 GCTGCAGACCAGACACCAGAAGG + Exonic
901415685 1:9114477-9114499 GCTCCAGACCAGCCTCCTGCAGG - Intronic
901742927 1:11354078-11354100 ACAGCAGACCAGACTCAAAATGG - Intergenic
902733564 1:18385460-18385482 GCTGCAGACCAGGCCAGAGCGGG + Intergenic
904482406 1:30802171-30802193 GCTGCAGATCTGACTCCAGCAGG + Intergenic
904813831 1:33181228-33181250 GCTGGCGCCCAGCCTCAAGCTGG - Exonic
906223671 1:44103549-44103571 TCTGCATCCCAGACTCCAGCCGG + Intergenic
907724298 1:57004544-57004566 GCTGAGGATCAGACTAAAGCTGG + Intronic
908067135 1:60418463-60418485 GCTGCAAACAAGCCTCAGGCAGG + Intergenic
910095751 1:83519805-83519827 TCTGAAGACCAGACTGAAGGAGG + Intergenic
914437896 1:147676309-147676331 GCAGAAGACCTGATTCAAGCTGG + Intergenic
915308456 1:154994508-154994530 GATGAAGACCCTACTCAAGCTGG - Intergenic
915619839 1:157074452-157074474 TCTGCATCCCAGACTCCAGCCGG - Intergenic
916064145 1:161122470-161122492 CCTGCAGAGCAGTCTCATGCTGG + Exonic
920504746 1:206507845-206507867 GCTGCAGACCAGGCCGGAGCGGG - Exonic
922612613 1:226941208-226941230 GCTGTAGGCCCGACTCAGGCTGG - Intronic
922825144 1:228512584-228512606 GCTGTAGCCCAGTCTCTAGCTGG + Intergenic
923304764 1:232678333-232678355 TCTGCAGACCAGACTCAACTGGG + Intergenic
924819193 1:247471782-247471804 GCTGGAGACGACACTCAGGCCGG + Intergenic
1064072278 10:12240851-12240873 GCAGAAGACCAGACACAACCTGG - Intronic
1065195589 10:23262104-23262126 GCTGCTCACCAGAGTCAAGCCGG - Intergenic
1067047402 10:42992318-42992340 GCTGCAGAGCAGACCCATGGTGG - Intergenic
1067073991 10:43162386-43162408 GGTGGAGACCAGGCTTAAGCTGG - Intronic
1067280721 10:44870118-44870140 GCTACAGACCCAGCTCAAGCCGG + Intergenic
1075574309 10:123567686-123567708 ACAGCAGACCAGACTCATCCCGG + Intergenic
1076536234 10:131179439-131179461 TCTGCAGACCAGCCTCACGTGGG - Intronic
1076912121 10:133395723-133395745 GATGCAGAGCAGCCTGAAGCTGG + Exonic
1077370165 11:2178014-2178036 GCTCCATGCCAGACTCAGGCTGG - Intergenic
1077370243 11:2178314-2178336 GCTCCATGCCAGACTCAGGCTGG + Intergenic
1077677964 11:4214310-4214332 GCTGCACAACAGACTAAAACCGG + Intergenic
1077723601 11:4651409-4651431 GCTGGAGACAAGCCTCAGGCTGG + Intronic
1077730300 11:4722964-4722986 TCTGCATCCCAGACTCCAGCCGG + Intronic
1083803746 11:65061335-65061357 GCTGCAGTCAAGATTCCAGCAGG - Intergenic
1085287065 11:75369969-75369991 GCTGGAGACCAGTCTCAGCCTGG - Intergenic
1088989988 11:114944954-114944976 AGTGATGACCAGACTCAAGCAGG - Intergenic
1089966813 11:122660099-122660121 GCTGCAGGGCTGGCTCAAGCAGG + Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1097649428 12:62278286-62278308 GCTGTAGAACAGCCTCAGGCAGG - Intronic
1098264731 12:68706822-68706844 TCTGCATCCCAGACTCCAGCTGG - Intronic
1100308857 12:93376569-93376591 GCTGCAGAGCGGAGGCAAGCTGG - Intergenic
1115307476 14:31947262-31947284 CCTGCAGACCTGACTAAACCTGG - Intronic
1116326873 14:43541103-43541125 TCTGCAATCCAGACTCCAGCAGG + Intergenic
1123935250 15:25190952-25190974 GATGCAGCCCAGATTCGAGCAGG + Intergenic
1125057777 15:35382767-35382789 GCTGCAGACAAGCCTTAAGAAGG + Intronic
1125574176 15:40744149-40744171 ACTGCAGACCAGACAGAAACGGG + Exonic
1128842273 15:70859912-70859934 TCTGCATCCCAGACTCCAGCCGG - Intronic
1131879189 15:96844512-96844534 GAAGTTGACCAGACTCAAGCTGG + Intergenic
1132145901 15:99429775-99429797 GCACCAGACCACACCCAAGCAGG - Intergenic
1132857666 16:2054148-2054170 GCTGCAGACCTGTCTCTTGCAGG + Intronic
1133279694 16:4658179-4658201 GCTGCAGACCAGATGGACGCTGG - Intronic
1137518321 16:49169854-49169876 ACTGAAGACCAGACTAAAGAGGG + Intergenic
1137734203 16:50712031-50712053 GCTGCGGGCCAGACACCAGCGGG - Exonic
1141514875 16:84537212-84537234 GCTGGACACCTGACCCAAGCTGG - Intronic
1142892108 17:2950516-2950538 ACTGCAGACCAGACCCTGGCTGG + Intronic
1143729535 17:8873176-8873198 GCTCCAGAGCAGACTGAAGGGGG - Intergenic
1146094875 17:29919834-29919856 GCTGCAGACAACACTACAGCAGG + Intronic
1146889706 17:36498448-36498470 GCTGCAGACCAGGCTCCTGGAGG - Exonic
1148026389 17:44591873-44591895 GCAGCACATCAGACTCCAGCTGG + Intergenic
1148863093 17:50614722-50614744 GCTCCATCCCAGACTCAAGCTGG - Intronic
1149659191 17:58325542-58325564 GCTGCAGGCCAGGCTCACTCTGG - Exonic
1150067580 17:62124494-62124516 GCTGCAGACCCAACTGAAGATGG - Intergenic
1151597951 17:75089221-75089243 GGTCCATTCCAGACTCAAGCAGG - Exonic
1152076598 17:78163929-78163951 GCAGCAGCCCAGACACAAGGTGG + Intronic
1152243428 17:79172420-79172442 GCCTCAGACCAGACTCAGACCGG - Intronic
1152735674 17:81995801-81995823 GCTGCAGACCAGACTCAAGCTGG + Intronic
1152866446 17:82726581-82726603 CCTGCAGAGCAGACCAAAGCTGG - Exonic
1152928775 17:83099701-83099723 GCTGCAGGCCAGACACCAGCAGG - Intergenic
1153735755 18:8065370-8065392 GCTGGAAACCTGGCTCAAGCTGG + Intronic
1155139692 18:23033220-23033242 GCTGCACACCAGAATCACACAGG - Intergenic
1157063528 18:44321015-44321037 TCTGCATCCCAGACTCCAGCTGG + Intergenic
1160616721 18:80136399-80136421 GCTGGAGACCAGAGTCATGTGGG - Exonic
1160660520 19:296150-296172 CCTGCAGCCCAGACCCAGGCAGG - Intergenic
1160666051 19:329165-329187 GCTCCTGCCCAGACTCAACCTGG + Intronic
1162156090 19:8678937-8678959 ACTGAAGACCAGACTGAAGGAGG + Intergenic
1162188045 19:8922554-8922576 GCTGCAGACTAGCCTCACTCAGG - Exonic
1164717183 19:30401319-30401341 TATGTAGACCAGACTGAAGCAGG - Intronic
1165445094 19:35852399-35852421 CCTGCAGCCCAGAGTCCAGCAGG + Intronic
1165793986 19:38507878-38507900 TCTGCAGACCAGACTCACCTAGG + Intronic
1166830314 19:45635469-45635491 GCTGAGGACCAGACTCAACAAGG + Intronic
927437989 2:23086915-23086937 CCAGCTGACCAGATTCAAGCAGG - Intergenic
927476038 2:23414748-23414770 GCTGCAGACCAGTCTGAGACCGG - Intronic
929412084 2:41708218-41708240 GATGCAGAACAGACTCACCCAGG - Intergenic
930836758 2:55802443-55802465 GCTGCAGAGCAGAGACAGGCAGG - Intergenic
932444805 2:71772208-71772230 ACTGTAGAACAGCCTCAAGCAGG + Intergenic
932618275 2:73249948-73249970 GCAGAAGACCAGACCCAGGCAGG - Intronic
932621701 2:73268766-73268788 GCTGCTGGCCTCACTCAAGCAGG - Exonic
935031881 2:99330515-99330537 TCTGCAGAACAGAATCAAGCAGG + Intronic
937343067 2:121104353-121104375 TCTGCAGATCAGACTCATCCTGG + Intergenic
937384751 2:121418683-121418705 GCTGCACCCCTGACTCATGCTGG + Exonic
942558677 2:177198301-177198323 TCTGCATCCCAGACTCCAGCCGG - Intergenic
944139594 2:196440831-196440853 GCTGCAGCACAGACTCACCCTGG - Intronic
947159268 2:227195711-227195733 GCTGTAGAACAGCCTCAGGCAGG + Intronic
1179289168 21:40003757-40003779 GCTGCAGAGCAGACTCAGGCTGG + Intergenic
1179726863 21:43345789-43345811 GCTCCAGACCACACTCTGGCTGG + Intergenic
1179926948 21:44540007-44540029 GGTGCAGACCAGGGTCAGGCAGG + Exonic
1179928453 21:44551315-44551337 GGTGCAGACCAGGGTCAGGCAGG + Exonic
1179929615 21:44558572-44558594 GGTGCAGACCAGGGTCAGGCAGG + Exonic
1179931513 21:44573910-44573932 GGTGCAGACCAGGCTCAGGCAGG - Exonic
1179932660 21:44580453-44580475 GGTGCAGACCAGGGTCAGGCAGG + Exonic
1179934239 21:44592311-44592333 GGTGCAGACCAGGCTCAGGCAGG + Exonic
1179935395 21:44600773-44600795 GGTGCAGACCAGGCTCAGGCAGG - Exonic
1179939191 21:44627293-44627315 GGTGCAGACCAGGGTCAGGCAGG - Exonic
1179940697 21:44637524-44637546 GGTGCAGACCAGGGTCAAGCTGG - Exonic
1179942038 21:44646580-44646602 GGTGCAGACCAGGCTCAGGGAGG - Exonic
1179948629 21:44697338-44697360 GGTGCAGACCAGGCTCAGGCAGG - Exonic
1179949595 21:44702317-44702339 GGTGCAGACCAGGGTCAGGCAGG - Intronic
1182360235 22:29742224-29742246 GCTGAGGACCAGACTCTAGGAGG + Intronic
1185338213 22:50280176-50280198 GCTGCAGGCCACACCCAGGCTGG - Intronic
949437128 3:4041597-4041619 TCTACAGACCAGACACAAGTTGG + Intronic
949825366 3:8159324-8159346 ACTGAAGACCAGACACCAGCTGG + Intergenic
950629769 3:14274752-14274774 ACTCCAGACCAGACTGAAGCAGG - Intergenic
952611513 3:35215932-35215954 TCTGCATCCCAGACTCCAGCCGG + Intergenic
953907948 3:46877787-46877809 GCTGCAGAGCAGACTCAAGTTGG - Intronic
955839449 3:63096602-63096624 TCTGCATCCCAGACTCCAGCCGG + Intergenic
963063328 3:141242319-141242341 ACTGCACACCAGCCTCCAGCGGG - Intronic
964802270 3:160568994-160569016 TCTGCATCCCAGACTCCAGCTGG - Intergenic
965605810 3:170496632-170496654 TCTGCATCCCAGACTCCAGCCGG - Intronic
967863147 3:194168582-194168604 GCTGCAGATCACATTCAATCGGG - Intergenic
968793694 4:2687846-2687868 GCTGCTGCCCACACTCAACCTGG + Intronic
968917894 4:3505204-3505226 GCTGAAGAGCAGCCTCGAGCTGG - Intergenic
969926480 4:10590468-10590490 ACTGCATACCACACTCAAGGGGG - Intronic
970497972 4:16646578-16646600 GCTGCAGATCAGATTCATTCAGG - Intronic
979363981 4:119798129-119798151 GCTGCAGAACAGATTCAAGGAGG + Intergenic
979780766 4:124648941-124648963 GCTGTAAAACAGCCTCAAGCAGG - Intergenic
984350556 4:178587079-178587101 GCTGCAAAGCAGAATCAAGGTGG + Intergenic
984868644 4:184307930-184307952 GCTGTAAACCAGCCTCAGGCAGG - Intergenic
990900460 5:60743791-60743813 TCTGCATCCCAGACTCCAGCCGG + Intergenic
992493743 5:77271298-77271320 GCTCCAAACCAGACTTCAGCTGG - Intronic
992493896 5:77272560-77272582 GCTCCAAACCAGACTGCAGCTGG - Intronic
995834051 5:116382926-116382948 GCTGCAGGCTAGGCTCAGGCAGG + Intronic
996432879 5:123401122-123401144 TCTGCATCCCAGACTCCAGCCGG + Intronic
997664817 5:135621579-135621601 GCTTAAGAACAGACTCAAGTGGG + Intergenic
997846296 5:137289032-137289054 GTTGAAGCCAAGACTCAAGCTGG - Intronic
997894651 5:137705273-137705295 GCTGCAAGCCAGACTCTACCAGG - Intronic
998066995 5:139167291-139167313 ACTGTAAACCAGCCTCAAGCAGG + Intronic
1001897520 5:175394239-175394261 GCTCCTGACCAGGCTCAGGCTGG - Intergenic
1005488323 6:26322452-26322474 GCTGCACTCCAGACTCCAGCCGG - Intergenic
1005583631 6:27255261-27255283 GCTACAGACCTGGCTCAAGCTGG + Exonic
1005650116 6:27878446-27878468 CCTGAAGACCAGTCTCAAGTGGG + Intergenic
1005682781 6:28223558-28223580 GCTCCAGCCCAGAGTCAAGTGGG - Intergenic
1006355110 6:33551297-33551319 GCTGTACTCCAGACTCCAGCCGG + Intergenic
1015362514 6:132355696-132355718 GCTGCATACCCAACCCAAGCTGG + Intronic
1017257633 6:152351898-152351920 GCTGCAGAACGGACACATGCGGG + Intronic
1017662113 6:156685029-156685051 GCTACAGTCCAGATTCAAGGCGG + Intergenic
1019181350 6:170188919-170188941 GGTGCATGCCAGACCCAAGCTGG + Intergenic
1023875955 7:44286520-44286542 GCTGCTGGCCAGACTCAGACAGG + Intronic
1025156153 7:56607329-56607351 GCTGCAGACCAGGAAAAAGCAGG - Intergenic
1029848517 7:103439012-103439034 ACTGCAGACCAGACACAAAGTGG - Intronic
1032211386 7:129917457-129917479 CCTGCACCCCAGACTCCAGCAGG - Intronic
1035795540 8:2353312-2353334 GCTGCAGACCAGATTCTTGTAGG + Intergenic
1036107274 8:5854563-5854585 GCTCCAGAGCAGACTCAATGAGG + Intergenic
1038003262 8:23408174-23408196 GCTACAGAGAAGACTAAAGCTGG + Intronic
1038310171 8:26440420-26440442 GCTGCACTCCAGACACAAACAGG + Intronic
1040816287 8:51511631-51511653 GCTGCAGGCCAGACTCAGGCAGG + Intronic
1041343132 8:56866810-56866832 GGTGGACACCTGACTCAAGCTGG + Intergenic
1044199028 8:89412847-89412869 TCTGCATCCCAGACTCCAGCTGG + Intergenic
1044774405 8:95673347-95673369 ACTGCAGTCCAAACTCAATCTGG + Intergenic
1049675726 8:143888051-143888073 GGTGGAGCCCAGACTCCAGCCGG + Intergenic
1052476079 9:28961193-28961215 GCTACAGATCAGACTCTTGCCGG - Intergenic
1052863013 9:33448141-33448163 GCAGCAGTCCAGACTCAGGTGGG + Intergenic
1053025253 9:34723983-34724005 GCTGAAGACCAGAGGCCAGCAGG - Exonic
1053036782 9:34833045-34833067 GCTGAAGACCAGAGGCCAGCAGG - Intergenic
1053525793 9:38829445-38829467 GCTCCAGACCAGCCTCAACGTGG + Intergenic
1054198025 9:62053881-62053903 GCTCCAGACCAGCCTCAACGTGG + Intergenic
1054640331 9:67534490-67534512 GCTCCAGACCAGCCTCAACGTGG - Intergenic
1055550644 9:77429369-77429391 CCTGGATACCAGACTCAAGAGGG + Intronic
1055674179 9:78638554-78638576 GCTCCAGTCCACACTCCAGCAGG - Intergenic
1056712504 9:89002123-89002145 GTTGCAGACCAGACGGAAGAAGG - Exonic
1056777595 9:89525092-89525114 GCTGCAGCCGAGACTGAGGCCGG - Intergenic
1058195598 9:101971108-101971130 GCTGCTGACCAGGATCAAGTTGG - Intergenic
1059093777 9:111390698-111390720 GCTGCAGACAACAATGAAGCAGG + Intronic
1061153249 9:128841481-128841503 GCTGCACTCCAGACTCCAGCCGG + Intronic
1185495912 X:554613-554635 TCTCCAGAGCAGACCCAAGCTGG - Intergenic
1186090184 X:6038385-6038407 CCTGGAGAACAGACTCTAGCTGG + Intronic
1188559382 X:31450741-31450763 GCTGGAGACCAGCATCAATCTGG + Intronic
1188832409 X:34915678-34915700 GGTGCAGGTCAGACTCAGGCAGG - Intergenic
1189182798 X:39019323-39019345 GCTGCACACCAGGCCCCAGCTGG - Intergenic
1191220770 X:57985743-57985765 GCTGCAGGGCAGCCTCCAGCTGG - Intergenic
1194480136 X:94411707-94411729 GCTGTAAAACAGTCTCAAGCAGG - Intergenic
1196507003 X:116458822-116458844 GCTGCAGACCAGCTTCTAACTGG + Exonic
1196872165 X:120122998-120123020 TCTGCAGAACAGACTCAGGCTGG + Intergenic
1198158494 X:133985296-133985318 ACTGCAGCCCGGACTCAAGTGGG - Exonic
1199927298 X:152480772-152480794 TCTGCATCCCAGACTCTAGCTGG - Intergenic
1200155253 X:153971646-153971668 ACTGCACACCAAACTCAAGGCGG + Exonic
1200278090 X:154752732-154752754 ATTTGAGACCAGACTCAAGCAGG - Intergenic