ID: 1152736520

View in Genome Browser
Species Human (GRCh38)
Location 17:82000008-82000030
Sequence CAGAGTTCCCAGAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 641
Summary {0: 1, 1: 0, 2: 7, 3: 90, 4: 543}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152736520 Original CRISPR CAGAGTTCCCAGAGGGAGGA TGG (reversed) Intronic
900099799 1:956956-956978 CAGAGTCCCCAGAGGGCTGAAGG - Exonic
900628833 1:3623204-3623226 CAGAGATTCCAGAGAGAGGGAGG - Intergenic
901065666 1:6493050-6493072 TGGAGTTCCCACTGGGAGGAGGG - Intronic
901067549 1:6501534-6501556 CAGAGTTCCCAGCAGGTGGTTGG - Intronic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
901989066 1:13097765-13097787 CAGCGATCCCAGAGGGAGGCGGG + Intergenic
901992747 1:13129002-13129024 CAGCGATCCCAGAGGGAGGCGGG - Intergenic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902218498 1:14949859-14949881 CAGAGTTCCCATGGGGAGATGGG - Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902359151 1:15932613-15932635 GAGAGTCCCCAAAAGGAGGATGG + Exonic
902548644 1:17206237-17206259 CTGAGTCCCAAGAGGGAGAAAGG - Intronic
902933535 1:19747658-19747680 CAAATATCCCAGAGGGAGGTGGG - Intronic
903015630 1:20359924-20359946 CAGAGTTACCAGTGGGGCGAGGG - Intergenic
903519215 1:23934758-23934780 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905363842 1:37438187-37438209 GAGACTTCCCAGAGGGAGCAAGG - Intergenic
905622862 1:39463943-39463965 CAAAGTTCCTAGGGGGATGAAGG + Intronic
906191555 1:43902480-43902502 GAGAGTTCTCAGATGGAAGAAGG - Intronic
906200628 1:43957962-43957984 CAGAGCTCCTGGAGGAAGGAGGG - Exonic
906537362 1:46558904-46558926 CAGATTTCCCAGAGCTGGGACGG + Intronic
906545987 1:46619833-46619855 CAGAGTTCCCACTGCGAGGGGGG - Intergenic
907489586 1:54800556-54800578 CAGTCCTCCCAGAGGGAGGTAGG + Intronic
907750400 1:57257728-57257750 CAGAGCCCCCAGAGGGAGTATGG - Intronic
908656609 1:66395056-66395078 CAGAGAACCCAGAGGGATAAGGG + Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
909647568 1:77934621-77934643 CAGAGTCCGAAGAGGGAAGAAGG - Intronic
910195981 1:84640112-84640134 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911972399 1:104454455-104454477 CAGAGCTCCCAGAGAGGGGCAGG - Intergenic
913523812 1:119671113-119671135 CACAGGTCCTAGAGGGAGGAGGG + Intronic
914267142 1:146047947-146047969 CTGAGTTCCAAAAGGAAGGAGGG - Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914679702 1:149930487-149930509 AAGAGTTCCCAGCTGGAGGCTGG + Exonic
915098892 1:153484495-153484517 CCTAATTCCCAGAGTGAGGAGGG - Intergenic
915354411 1:155247628-155247650 AAGAGACCCCAGAGGTAGGAGGG + Exonic
915734446 1:158075909-158075931 CATGGGTCTCAGAGGGAGGAAGG + Intronic
916189697 1:162166998-162167020 CAGAATACCCAGAGGCAGCAGGG - Intronic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
917337300 1:173938772-173938794 CAGAGGACCCTGAGGGAGGAGGG - Exonic
917530767 1:175833060-175833082 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
919639752 1:200036417-200036439 GTGAGTGCTCAGAGGGAGGAGGG + Intronic
920054256 1:203181139-203181161 GTGAGTTCCCAGAAGGAGGGAGG - Intronic
921293874 1:213683848-213683870 CAGCTTTCCCAGGGTGAGGAGGG - Intergenic
922199544 1:223390241-223390263 CAGATTTCCCAGGGGAAGGTGGG - Intergenic
922337385 1:224628784-224628806 CTGAATTCCAAAAGGGAGGAGGG - Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
924290685 1:242533749-242533771 CAGACCTCCCAGGGGGAGGAAGG - Intergenic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
1063361895 10:5466306-5466328 CAGACTTGCCTGGGGGAGGAGGG - Intergenic
1064121860 10:12625687-12625709 CAGATTTCCCTGAGGGTGGCTGG - Intronic
1065012510 10:21432371-21432393 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1065800378 10:29346342-29346364 CCACGTTCCCAGAAGGAGGATGG + Intergenic
1065838848 10:29683448-29683470 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1067281023 10:44872971-44872993 CCGAGGTCCCATGGGGAGGAAGG - Intergenic
1067873179 10:49980252-49980274 CAGAGTTCCAACAGAGAGGGAGG + Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1068779118 10:60900275-60900297 AAGAATTCCGAGAGAGAGGATGG + Intronic
1069397139 10:68001723-68001745 ACTAGTTCCTAGAGGGAGGAGGG - Intronic
1069829491 10:71273826-71273848 CAGACTTGCCAGAAGCAGGAAGG + Intronic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070430813 10:76335891-76335913 CTGAATTCCAACAGGGAGGAGGG + Intronic
1070528955 10:77319459-77319481 CAGAGTTCCTTGAGGTAGAAAGG + Intronic
1070568945 10:77626393-77626415 AAGTGTTCCCAGATGCAGGAAGG + Intronic
1070625207 10:78046175-78046197 CAGAATTCTCAGAGGCAGAACGG - Intronic
1070665153 10:78337431-78337453 CCTAGGTCCCAGAGGAAGGATGG - Intergenic
1070720499 10:78753673-78753695 CAGAGATCCCAGAGCAAGCAGGG + Intergenic
1070786538 10:79165413-79165435 CAGAGCTTCCAGAGGGAGGGAGG + Intronic
1070920633 10:80183383-80183405 CTGAGATCCCAGAGGAAGGAAGG - Intronic
1071959463 10:90796080-90796102 CTGAATTCCAAAAGGGAGGAAGG + Intronic
1072588145 10:96800537-96800559 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1073071207 10:100794310-100794332 CAAAGTTCCCAGAGCAAGTAGGG - Intronic
1073360491 10:102894584-102894606 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1073379032 10:103063727-103063749 AAGAATTCCCAGAGGGAAGTAGG - Intronic
1073440119 10:103547567-103547589 CAGAATCCCCAGAGGAAGGAGGG + Intronic
1073455455 10:103634135-103634157 CAGGGATCCCGGATGGAGGATGG - Intronic
1074322906 10:112420211-112420233 CAGAGTTGGGAGAGAGAGGAAGG - Intronic
1075221406 10:120588100-120588122 CAGACTTCCCATAGGCAGGCAGG - Intronic
1075279321 10:121126286-121126308 CGAAGTCCCAAGAGGGAGGAGGG - Intergenic
1075933917 10:126323468-126323490 CAGAGTTGCCAAAAGGAGGTAGG + Intronic
1076429339 10:130390932-130390954 CACAGTTCCCAAGGGAAGGAGGG + Intergenic
1076489222 10:130845715-130845737 GAGACATTCCAGAGGGAGGATGG + Intergenic
1076489261 10:130845878-130845900 TAGATACCCCAGAGGGAGGATGG + Intergenic
1076688507 10:132208901-132208923 CAGAGTCCCCAAAGAGAGCAGGG + Intronic
1076923862 10:133471504-133471526 GAGACAGCCCAGAGGGAGGAAGG - Intergenic
1076977336 11:184251-184273 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1077265936 11:1650186-1650208 CTGAGTTCCCACAAGAAGGAAGG - Intergenic
1077737822 11:4809821-4809843 TAGAGCTCCCAGAAGCAGGAAGG - Intronic
1078440303 11:11359543-11359565 CAGAGTCCACAGAGTCAGGAAGG - Intronic
1078758350 11:14232541-14232563 CAGAGTTGCCAGAGTGGGGAGGG - Intronic
1079315524 11:19404947-19404969 CAGAGAGCACAGAGAGAGGAGGG - Intronic
1079469959 11:20768799-20768821 TAGAGCTTCCAGAGGGAGTATGG + Intronic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081100463 11:38995478-38995500 CAGATTTCTCAGAAGAAGGAAGG - Intergenic
1083097604 11:60267558-60267580 CAGTAGTCCCAGAGAGAGGATGG + Intergenic
1083389772 11:62339351-62339373 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1083672642 11:64307536-64307558 CAGTGTACCCAGAGGGTGCAGGG - Intronic
1083935039 11:65865631-65865653 CAGAGTTCCCACAGGGAGGGAGG + Intronic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1084193875 11:67512321-67512343 CAGAGTTCCGTGAGGGAGGTGGG + Intergenic
1084324016 11:68388663-68388685 CTGAGCACCTAGAGGGAGGAAGG - Intronic
1084604851 11:70166471-70166493 CAGGGTTTCCAGATGGAGGCTGG + Intronic
1084683567 11:70680842-70680864 GAGAGTCCCCACAAGGAGGACGG - Intronic
1085277463 11:75309256-75309278 CAAAGCTCCCTGAGGGAGCAGGG - Intronic
1085751612 11:79167233-79167255 CTGAGTTCACAGTGGGAAGAAGG + Intronic
1085862048 11:80245734-80245756 GACAGTTCCCAGAGGGAAAAAGG + Intergenic
1086033967 11:82394587-82394609 CAGGGTTCCCAGAAGAAAGATGG + Intergenic
1086767611 11:90717710-90717732 CAGAGTTTCCAGGGCAAGGATGG + Intergenic
1087204026 11:95375133-95375155 CAGAACTCCAAGATGGAGGAGGG + Intergenic
1087369311 11:97261629-97261651 CAGAGGTGCCCGAGGGAAGATGG - Intergenic
1088313764 11:108486918-108486940 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1088458359 11:110056658-110056680 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1088576730 11:111279443-111279465 CAGAGGCTCCAGAGGGAGCATGG - Intronic
1088966374 11:114725694-114725716 CAGAGGTCCCAGAGAGATTAGGG - Intergenic
1089326864 11:117663428-117663450 AAGAGCTCCCAGAGGGATGCTGG - Intronic
1089376756 11:118000059-118000081 CAGAGCTTCCAGCAGGAGGAAGG + Exonic
1089403650 11:118180217-118180239 CAGAGTTGCCAGAAGGCAGAAGG + Intergenic
1089622021 11:119727826-119727848 CAGAGTTCCGAGGGGGAGCCCGG + Intronic
1089633542 11:119797883-119797905 CTGACTTCCCAAAGGGAAGATGG - Intergenic
1089647473 11:119889687-119889709 AAGGACTCCCAGAGGGAGGATGG - Intergenic
1089679404 11:120110952-120110974 TAGAGTTCCCAGGGGGAGAAGGG - Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1090096961 11:123751911-123751933 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1090185281 11:124735004-124735026 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1090189465 11:124758976-124758998 CCGAGTTCTCAAAGGGCGGAGGG + Intronic
1090420580 11:126572548-126572570 CAGAGACCCCAGTGGGAAGAGGG + Intronic
1091104254 11:132903554-132903576 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1091311120 11:134575977-134575999 GAGAGTGCCCAGGGGAAGGAAGG + Intergenic
1091311135 11:134576038-134576060 GAGAGTGCCCAGGGGAAGGAAGG + Intergenic
1091676703 12:2496273-2496295 GATAGTTTCCACAGGGAGGAGGG + Intronic
1091831664 12:3554610-3554632 CAGAGTTCCAAAAGGTGGGAAGG + Intronic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092928312 12:13291965-13291987 CAGAGTACCCAGGGTGAAGAAGG - Intergenic
1093081806 12:14821360-14821382 CAGAGCCCCCAGAGGGAGAGAGG - Intronic
1093550747 12:20407548-20407570 CCAAGTTCCCAGAGGGAGGTTGG + Intronic
1094642761 12:32292152-32292174 TAGAGCTGCCAGAGGGAGCATGG - Intronic
1095332001 12:40977369-40977391 AATAATTCCCAAAGGGAGGAGGG + Intronic
1095698230 12:45164745-45164767 CAGAGCACCCAGTGGGAGGGGGG - Intergenic
1096159960 12:49367733-49367755 CGAAGTGCCCAGAGGGTGGAAGG + Intronic
1096580664 12:52582740-52582762 AAGAGTTCTCAGAGGAGGGAGGG + Intergenic
1097761759 12:63474283-63474305 CAGAGATTCCAGAGGGGGGAGGG - Intergenic
1098811384 12:75097981-75098003 CAGAGTTCTCATAGAGAGAAGGG - Intronic
1099050974 12:77781291-77781313 CAGAATTCCAAAAGGGAGGAGGG - Intergenic
1100020987 12:90069408-90069430 CAGAGTTCCAAGAGGGTGAGAGG + Intergenic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1101364365 12:104058070-104058092 CAGAGTTTCCAGAGCTGGGATGG + Intronic
1102416033 12:112763720-112763742 CTGAATTTCAAGAGGGAGGAGGG + Intronic
1103980338 12:124732963-124732985 CTGAGTTCCCAGAAGGTGGTCGG + Intergenic
1104277297 12:127341417-127341439 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1104579189 12:129997297-129997319 CAGAGGTAGCAGAGGAAGGAAGG + Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1104752677 12:131250056-131250078 CTTATTTCCCAGAGGGAGAAGGG - Intergenic
1105701776 13:22939978-22940000 CAGGGTCCCCAGAGGAAGGCGGG + Intergenic
1105854399 13:24361766-24361788 CAGGGTGCCCAGAGGAAGGCGGG + Intergenic
1105900090 13:24746097-24746119 CAGGGATCCCGGAGCGAGGAAGG - Intergenic
1106114695 13:26807106-26807128 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1106115771 13:26816316-26816338 CAGAGTAGCCAGAGGCAGAAGGG + Intergenic
1106168406 13:27269235-27269257 CAGAGTTCCAAGAGAGTGGGTGG - Intergenic
1106696130 13:32175397-32175419 GTGAGTGCCCAGAGGGTGGAAGG - Intronic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1107541680 13:41394709-41394731 CAGCCTTCCCAGAGGCAGTATGG - Intergenic
1108248422 13:48540865-48540887 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1108876186 13:55053895-55053917 CAAAGCTCCCATAGGAAGGAGGG - Intergenic
1108877206 13:55061209-55061231 CAGAGCTCCCATAGGAAGGGAGG - Intergenic
1109200057 13:59420379-59420401 CAGAGTTGACAGAGGTAGAAGGG + Intergenic
1109442880 13:62398058-62398080 CTGAATTCCCAAAGGAAGGAGGG - Intergenic
1109666995 13:65553002-65553024 GTGATTTCCCACAGGGAGGAAGG - Intergenic
1110035130 13:70673165-70673187 CAGAGCTCTCAGAGGGAGGGTGG - Intergenic
1110324678 13:74200250-74200272 CAGAGTTCACCAAGGGTGGATGG + Intergenic
1112437328 13:99399689-99399711 CAGAGTTCCCAGGGGGCAGTAGG - Intergenic
1112488352 13:99840064-99840086 CAGAGTTCCCAGCGTGGGGTGGG - Intronic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1113844748 13:113380464-113380486 CAGAGTTCACTTCGGGAGGATGG - Intergenic
1114237904 14:20838174-20838196 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1115904331 14:38190042-38190064 CAGAATTCCAAAAGGGAGAAAGG - Intergenic
1117038875 14:51752265-51752287 CAGAGATGCCAGAGTGTGGAGGG + Intergenic
1117267116 14:54100849-54100871 CAGAGCACCCAGAGAGGGGATGG - Intergenic
1117819409 14:59632195-59632217 CAGAGCTCCCACAGGGCTGATGG + Intronic
1117841494 14:59865019-59865041 CAGAGTTCCTAGACATAGGAAGG + Intronic
1118284415 14:64458426-64458448 CAGACTTCCCTGAGGGGAGAGGG + Intronic
1118347755 14:64951992-64952014 CAGAGGTCCCATAGGGACTAGGG - Intronic
1118379860 14:65208772-65208794 CAGAGTTCCCATTGGAAGGGGGG + Intergenic
1118633179 14:67724635-67724657 CAGAGGCCCCAGTGGGAAGAAGG - Intronic
1119259309 14:73228162-73228184 CCAAGTTCCCAGTGGGAAGATGG - Intergenic
1119552503 14:75525234-75525256 AAGGGTTCCCAGATGGCGGAGGG - Intronic
1119909643 14:78337961-78337983 CAGAGTACCCAGTGGGAAGGTGG + Intronic
1121013930 14:90536928-90536950 CAGAGTCCTTAGAGGGAGGCAGG + Exonic
1121526251 14:94621450-94621472 CTGAGTCCCCTGAAGGAGGAAGG - Intronic
1121724663 14:96138375-96138397 CACAGATCCCAGAGAGAAGAAGG - Intergenic
1121900136 14:97686409-97686431 CAGAGTTCCCAGCAGCAAGAAGG - Intergenic
1122056889 14:99105133-99105155 CAGAGTCCCCGGAGAGAAGAGGG + Intergenic
1122179134 14:99943061-99943083 CAGAGTCCCCAGAGTGAGACAGG - Intergenic
1122640939 14:103158896-103158918 CAGAACTCACAAAGGGAGGAGGG - Intergenic
1122672411 14:103382871-103382893 CAGAGTTAGCTGTGGGAGGATGG - Intergenic
1122843167 14:104476605-104476627 CAGGGTGCCCAGAGGAAGGTGGG + Intronic
1122942744 14:104989718-104989740 CCAAGGCCCCAGAGGGAGGAGGG + Intronic
1124075945 15:26444309-26444331 CTGAATTCCAAAAGGGAGGATGG + Intergenic
1125236843 15:37524618-37524640 CAGAGGCTCCAGAGGGAGCATGG - Intergenic
1125448423 15:39782794-39782816 CAGCGGTCCCACAGGCAGGAGGG - Exonic
1125526902 15:40382347-40382369 CAGTGTTCTCAGTGGGTGGAAGG - Intergenic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1128190469 15:65689604-65689626 AGGAGCTGCCAGAGGGAGGAGGG - Intronic
1128260513 15:66229697-66229719 CAAGGCTCCCACAGGGAGGAAGG + Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129253339 15:74320461-74320483 GAGAGTTCCCGGTGGGAGGCAGG - Intronic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129532829 15:76282361-76282383 TAGAGCCCCCAGAGGGAGTATGG + Intronic
1130103168 15:80909314-80909336 CAGAGTTCCCTGAGGGAAGGAGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1132321439 15:100928444-100928466 CAGTGTTCCCTGAGTGAGGCTGG - Intronic
1132336964 15:101053875-101053897 CAGAGTGGCCAGAGGGTGAAAGG + Intronic
1132936405 16:2483474-2483496 CACAGCTCCGAGTGGGAGGAGGG + Intronic
1133237816 16:4395876-4395898 CAGATTATCCAAAGGGAGGATGG + Intronic
1133461248 16:5988499-5988521 CTAAGTTCCCAGAGGAAGGAGGG + Intergenic
1133862620 16:9610422-9610444 CAGAGCTCAGAGAGGCAGGAAGG + Intergenic
1134008226 16:10832680-10832702 CAGAGTCTCCAGTGGGAGGGGGG + Intergenic
1134040099 16:11061861-11061883 CAGAGTTGGGAGACGGAGGAAGG - Intronic
1134368660 16:13603307-13603329 CAGAGCTCCCAGAAGGAGAAAGG - Intergenic
1134420831 16:14087358-14087380 CAAAGTGCCCAGAGTTAGGAAGG - Intronic
1135201195 16:20439069-20439091 CATACTTCCCACAGGGAGGAAGG - Intronic
1135217913 16:20588795-20588817 CATACTTCCCACAGGGAGGAAGG + Intergenic
1135435708 16:22425473-22425495 CGCTGTTCCCAGAGTGAGGATGG - Intronic
1136061082 16:27726887-27726909 GAGAGGTCCCAGAGGGAGGTGGG + Intronic
1136172445 16:28497053-28497075 CAGAAGTCCCAGAGGCAGGCGGG + Exonic
1136271899 16:29153533-29153555 CAGAGCCCCCGGAGGGAGTACGG - Intergenic
1136271912 16:29153567-29153589 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271923 16:29153601-29153623 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271934 16:29153635-29153657 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271944 16:29153669-29153691 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1136271977 16:29153771-29153793 CAGAGCCCCCAGAGGGAGTACGG - Intergenic
1137536698 16:49332702-49332724 CAGAGATTCCTGAGGAAGGAGGG + Intergenic
1137550114 16:49431769-49431791 AAGAATTCCCAGAGGTAGCAGGG + Intergenic
1137558462 16:49488319-49488341 CAGAGTGCCCAGAAGCAGGCAGG - Exonic
1138529681 16:57628289-57628311 CAAAGTTCCCACAGAGAGGCCGG - Intronic
1140020899 16:71237623-71237645 TAGAGCTTCCAGAGGGAGTACGG + Intergenic
1140418597 16:74797020-74797042 TTGAATTCCCAGAGGGAGGGAGG + Intergenic
1140612243 16:76614287-76614309 CAGAGTTTCCAGATGGATGCTGG + Intronic
1140859320 16:79005498-79005520 TAGAGTTTTCAGAGAGAGGATGG - Intronic
1141241168 16:82266599-82266621 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1141518159 16:84560034-84560056 TAGAGCTTCCAGAGGGAGCATGG - Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1142075552 16:88115655-88115677 CAGAGCCTCCAGAGGGAGTACGG - Intronic
1142075574 16:88115723-88115745 CAGAGCCCCCAGAAGGAGTACGG - Intronic
1142442916 16:90112431-90112453 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1142464787 17:128961-128983 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1142869317 17:2809921-2809943 CAGAGGAGCCAGCGGGAGGAAGG - Intronic
1142887546 17:2922192-2922214 CAGTGTCCTCACAGGGAGGAAGG + Intronic
1143008547 17:3852912-3852934 AAGGCTTCCCAGAGGAAGGAAGG - Intergenic
1143103878 17:4518965-4518987 CAGACTTCCCGGTGGAAGGACGG - Intronic
1143591682 17:7888895-7888917 CCTAGTTCCCAAAGGGAGCAGGG + Intronic
1143786665 17:9260763-9260785 CTGAGTTTCCAGGGTGAGGAGGG - Intronic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1144415558 17:15042876-15042898 CAGATTTTTCAGAGGGAGGAAGG + Intergenic
1144595863 17:16569488-16569510 CAGATTTCCTAGAGGAAGAATGG + Intergenic
1145024419 17:19457239-19457261 CAGAATTCCAACAGGGAGAAGGG + Intergenic
1145223363 17:21107304-21107326 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1145266660 17:21382979-21383001 CACAGTTCCCGGAGGAAGGCTGG + Intronic
1146689729 17:34865135-34865157 GAGTGATCGCAGAGGGAGGATGG - Intergenic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1147325102 17:39666266-39666288 CTGAGTTCCCAAAGGGAGGGTGG + Exonic
1148063625 17:44853177-44853199 CGGGGTTTCCAGAGAGAGGAGGG + Intronic
1148200984 17:45749904-45749926 CTCAGATCCCAGTGGGAGGAAGG + Intergenic
1148208127 17:45792270-45792292 CAGAGTTGGCAGAAAGAGGAAGG - Intronic
1148856927 17:50583996-50584018 CTTAGTGTCCAGAGGGAGGAAGG + Intronic
1149275291 17:55027093-55027115 AAGAGTTCACACAGGGAGTAGGG - Intronic
1149356039 17:55840308-55840330 TAGATTCCCCAGAGGGAAGATGG + Intronic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1149572709 17:57684997-57685019 CAGAGGACCCAGATGGTGGAAGG + Intergenic
1149729025 17:58925992-58926014 CACAATTCCCAGTTGGAGGAGGG - Intronic
1149982655 17:61323658-61323680 CAGAGATGCCATATGGAGGAAGG - Intronic
1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG + Intronic
1150135268 17:62691962-62691984 CACAGTAACCAGAGGTAGGATGG + Intronic
1150287474 17:63962189-63962211 CCGAGTTCCCAGGGAGAGGCGGG + Intronic
1150493300 17:65589071-65589093 CAGGGTTCCCACAGTGAGGTGGG - Intronic
1151542089 17:74769816-74769838 CAGAATTCCCAGGGGCAGGCTGG + Intergenic
1151662149 17:75524950-75524972 CAGGCTTCCCGAAGGGAGGAGGG + Intergenic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152103663 17:78316726-78316748 CAGGGGTCCCAGAGGGTGGTGGG - Intergenic
1152299088 17:79485024-79485046 CAGGGCTCCCAGAGCCAGGATGG + Intronic
1152307300 17:79528796-79528818 TAGAGTTTTCAGAGGGAGCACGG + Intergenic
1152603013 17:81274580-81274602 CAGAGCTCCCAAGGGGAGGCAGG + Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1152823902 17:82451691-82451713 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1153867993 18:9290883-9290905 CTGACTTCCCAAAGGGAGGAGGG - Intergenic
1155323954 18:24647353-24647375 AAGAGTTCCCAGGAGCAGGAAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156451244 18:37267524-37267546 GGGACTGCCCAGAGGGAGGATGG + Intronic
1156963964 18:43067767-43067789 CTGAATTCCAAAAGGGAGGAAGG + Intronic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1157550805 18:48580691-48580713 CAGAGTACCCAGAAAGACGACGG - Intronic
1157699452 18:49751658-49751680 CAGTTTTCCCGGAGTGAGGATGG - Intergenic
1159016984 18:63109264-63109286 CAGAATTCACAGAGGGTGGGAGG + Intergenic
1159438204 18:68445337-68445359 TAGAGCTTCCAGAGGGAGCACGG - Intergenic
1161237499 19:3205135-3205157 CACAGTGCCCAGAGGGAGGCGGG - Intronic
1162512911 19:11130547-11130569 CAGAGGGCCAGGAGGGAGGAAGG + Intronic
1162657205 19:12140142-12140164 CGGAGTCCCCAGACGGGGGAGGG - Intronic
1163102031 19:15103637-15103659 CAGGGATCTCATAGGGAGGAGGG + Intergenic
1163834264 19:19563554-19563576 CAGAGTCCGCAGGGTGAGGAAGG + Exonic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164613616 19:29650907-29650929 CTGAATTCCAAGAGGGAGGAGGG + Intergenic
1166803746 19:45472996-45473018 AAGAGTTCACAGAGCGAGGAGGG - Exonic
1166990536 19:46690078-46690100 CAGGGTTGCAGGAGGGAGGAGGG + Intronic
1167201101 19:48066137-48066159 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1168333190 19:55581077-55581099 CCGGGCTCCCAGAGGGCGGAGGG + Intergenic
1168412482 19:56148336-56148358 CTGAGTCCCCAGTGGCAGGAGGG + Intronic
924995413 2:356270-356292 AGGAGTTCTCGGAGGGAGGAGGG + Intergenic
925033127 2:666700-666722 CAGAGTTCTCGGAGGCAGGAAGG - Intergenic
926522010 2:13927308-13927330 TAGAGTTCCAAGAGTGTGGAGGG - Intergenic
927571969 2:24167762-24167784 CAGAGTCCACAGTGGGAGGGAGG + Intronic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
928682063 2:33712765-33712787 CTGAATTCCAAGAGGTAGGAGGG - Intergenic
929609277 2:43257917-43257939 CAGAGAAGCCAGTGGGAGGAAGG + Intronic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
930552464 2:52852673-52852695 CAGAGTTCCCGGAGGGGAGGGGG - Intergenic
931231165 2:60376051-60376073 CAGAGCTCCCCAAGGGAAGAAGG - Intergenic
931654559 2:64499205-64499227 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
931857481 2:66318340-66318362 TAGAGTTCCCAGTGGGTGGCAGG - Intergenic
932702454 2:74001138-74001160 CTGTGTTCCCAGGGGGAGGCAGG + Intronic
932770375 2:74497837-74497859 CAGAGTTCCAGGGTGGAGGAAGG - Exonic
933603853 2:84360747-84360769 GGGAGCTCCCAGACGGAGGAAGG + Intergenic
933798517 2:85941276-85941298 CAGAGCCTCCAGAGGGAGCAAGG - Intergenic
933934287 2:87188501-87188523 CAGAGATCCCAGGGGGTAGAGGG - Intergenic
935769253 2:106401260-106401282 AAAAGTTCCCAGAGAGAGGCAGG + Intronic
935910839 2:107894663-107894685 AAAAGTTCCCAGAGAGAGGCAGG - Intergenic
936249381 2:110855875-110855897 CAAAGTTTCCACAGGGTGGAAGG + Intronic
936280382 2:111135096-111135118 CAGAGTTCCAAAAGAGAGGAAGG - Intronic
936358855 2:111777394-111777416 CAGAGATCCCAGGGGGTAGAGGG + Intronic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
938294813 2:130171620-130171642 CAGATTCCCCAGAGGGTGGAGGG - Intronic
938303085 2:130229768-130229790 CAGAGTCCCCAGAGGGCTGAAGG + Intergenic
938453586 2:131444458-131444480 CAGAGTCCCCAGAGGGCTGAAGG - Intergenic
938461818 2:131502224-131502246 CAGATTCCCCAGAGGGTGGAGGG + Intergenic
938966457 2:136392995-136393017 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
939284410 2:140110511-140110533 CAGAGTTGCCACTGGCAGGAAGG + Intergenic
939818543 2:146927241-146927263 CCGACTTCCCAGAGGAAGAAGGG - Intergenic
940357285 2:152757744-152757766 CAGTGTTCCCAGTGGGAATATGG + Intronic
940378578 2:152987001-152987023 CAGAGCTCCCAGAGCCAAGAAGG - Intergenic
940904938 2:159160715-159160737 CAGGGTTCTCAGAGGCAGGGAGG - Intronic
941618843 2:167754527-167754549 CAGATTTCACAGAAAGAGGAAGG + Intergenic
942132470 2:172893814-172893836 CAGAGATGCCTGAGGCAGGATGG - Intronic
942605040 2:177681747-177681769 CTGAATTCCAAAAGGGAGGAAGG - Intronic
943657250 2:190522611-190522633 CTGAATTCCAAAAGGGAGGAGGG - Intronic
943667730 2:190627990-190628012 GCCAGTTCCCAGTGGGAGGAGGG - Intergenic
944863874 2:203841449-203841471 CAGGGCTTCCAGAGGGTGGAGGG + Intergenic
945417598 2:209594156-209594178 CAGGCATCCCAGAGGGAGTATGG + Intronic
945653298 2:212591842-212591864 CAGGGTACCTTGAGGGAGGAGGG - Intergenic
945681955 2:212924966-212924988 TAGAGTTCCCAGAGGGAGCATGG - Intergenic
946153760 2:217793770-217793792 CAGAATCCCCTGAGGGAGGGAGG + Intergenic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948724030 2:239920825-239920847 CACAGTTCCTAGAAGGCGGAGGG + Intronic
948732844 2:239978063-239978085 CAGGGATCCCAGAGGCAGGGAGG - Intronic
948732858 2:239978120-239978142 CAGGGATCCCAGAGGCAGGGGGG - Intronic
948771605 2:240253985-240254007 CTGGCTTCCCAGAGGGAGGCAGG + Intergenic
948798953 2:240421509-240421531 CAAGGATCCCAGAGGGGGGATGG + Intergenic
948830920 2:240597883-240597905 CTCAGGTCCCAGAGGGTGGAAGG + Exonic
1168768324 20:397197-397219 CACAGTTCCCAGAGTGAGCTGGG - Exonic
1169224240 20:3846513-3846535 CAAAGTTCCCAGGGGGAGGAGGG + Intergenic
1170371600 20:15654654-15654676 CAGAGTTCTCAGAGTCAGAATGG + Intronic
1170508549 20:17054199-17054221 CAGAGCTCCCAGAGGGGTGGGGG - Intergenic
1170590361 20:17766872-17766894 GAGAGTTCCCAGTGGGAAGCTGG + Intergenic
1170747711 20:19115512-19115534 CAGAGGTCCCAGAAGGGGGGAGG + Intergenic
1170823772 20:19776206-19776228 CTGAATTCCCAAAGGGAGGAGGG - Intergenic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1172003173 20:31797557-31797579 CAGACTTCCCAGTGGGATGCTGG + Intronic
1172194316 20:33081724-33081746 CAGAGTTCACATCGGGAGGCTGG + Intronic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173027723 20:39325039-39325061 CAGAGGTCTCAGAGGAAGGAAGG + Intergenic
1173262706 20:41451073-41451095 CCCAGTCCCCAGAGGGAGGAAGG - Exonic
1173347545 20:42214784-42214806 CCATGTACCCAGAGGGAGGAGGG - Intronic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1175171378 20:57083884-57083906 CAGAGCAGCCAGAGTGAGGATGG - Intergenic
1175285635 20:57834897-57834919 CAGAGCCTCCAGAGGGAGTACGG - Intergenic
1175457821 20:59128491-59128513 GACAGTGCCCAGATGGAGGATGG + Intergenic
1175507272 20:59494827-59494849 CAGAGTTCCCAGAGGAGGAAGGG - Intergenic
1175626126 20:60489546-60489568 CAGCGTTCCTGGAGGGAGCACGG + Intergenic
1175728774 20:61337857-61337879 CAGAATTACCAGAGGAAAGAAGG - Intronic
1175751266 20:61499579-61499601 CTGAGGTCACACAGGGAGGAGGG + Intronic
1175824668 20:61930488-61930510 CAGGGATCCCAGTGGGAGGCAGG + Intronic
1175967286 20:62665976-62665998 CAGAGGCCCCTGGGGGAGGAGGG + Intronic
1176423816 21:6535531-6535553 CACAGCTGCCAGAGGCAGGATGG - Intergenic
1176676579 21:9784289-9784311 CAGAGATCCCTGGGGGAGGGGGG - Intergenic
1177152911 21:17472576-17472598 CGGAGTTCCCAGAGGATAGAAGG - Intergenic
1178570597 21:33732298-33732320 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178788689 21:35677812-35677834 CAGAGTCCCCTGAGGGAGTGAGG + Intronic
1178814461 21:35915296-35915318 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178897385 21:36570351-36570373 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179699309 21:43143846-43143868 CACAGCTGCCAGAGGCAGGATGG - Intergenic
1180858529 22:19063301-19063323 CAGAGATCTCAGCGGCAGGAGGG + Intronic
1181114081 22:20620497-20620519 CAGATGCCCCAGAGGGTGGAGGG - Intergenic
1181309633 22:21937634-21937656 CACAGTTTCCAGAGGGAGTGAGG - Intronic
1181345022 22:22213424-22213446 GAGAGTTGGCAGAGGGAGGGAGG + Intergenic
1181386668 22:22550853-22550875 CAGCACTCCCAGAGGGAGGCAGG + Exonic
1181472993 22:23152283-23152305 CACAGTCCCCAGAGGGGAGACGG - Intronic
1181802693 22:25357919-25357941 CTCAGCACCCAGAGGGAGGAAGG + Intronic
1182369742 22:29802324-29802346 CAAAGTTCCCACAGGCAGGAGGG - Intronic
1182455440 22:30447532-30447554 CTGAATTCCGAAAGGGAGGAGGG + Intergenic
1183214303 22:36469163-36469185 CAGTGTTCTCAGATGCAGGATGG + Intronic
1183306033 22:37083733-37083755 CTTAGTTACCAGAGGGAGCAAGG + Intronic
1183374450 22:37454823-37454845 CGGACATCACAGAGGGAGGAAGG - Intergenic
1183457560 22:37930888-37930910 CAGAGTCCCCAGCGGGGAGAGGG + Intronic
1183484662 22:38082527-38082549 CAGGGTTCCCACAGGCAGGAAGG + Intronic
1184085724 22:42262623-42262645 CAGAGATCACCGAGGGAGAAAGG + Intronic
1184583121 22:45430340-45430362 CAGAGTTTTCACAGTGAGGAGGG + Intronic
1185214689 22:49591703-49591725 CTGACTTTCCAAAGGGAGGAGGG - Intronic
1185276713 22:49953081-49953103 CACAGCGCCCAGTGGGAGGAGGG + Intergenic
949421525 3:3871516-3871538 CAGAGATGCCAGAGGGAACATGG - Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950457247 3:13100044-13100066 GAGAGTTCCGAGTAGGAGGATGG + Intergenic
952068428 3:29601933-29601955 CAGAGTTCCCAAGGTGGGGAAGG - Intronic
952673676 3:36000796-36000818 CAGAGTGCCCAGGGGAAGGAGGG - Intergenic
953374867 3:42420117-42420139 CTGAGTTCCAAGAGGAAGCAGGG - Intergenic
953422333 3:42764229-42764251 CTGAATTCCAAAAGGGAGGAGGG + Intronic
953896626 3:46808219-46808241 CTGAGTACCCACAGGGAGGAGGG - Intronic
954392507 3:50274996-50275018 CCGAGTCCTGAGAGGGAGGAGGG - Exonic
954923502 3:54212601-54212623 CTGAATTCCAAAAGGGAGGAGGG + Intronic
955747572 3:62155070-62155092 CAGACTTGCCAGTGGGCGGAGGG + Intronic
956392044 3:68784668-68784690 CAAAGTTTCCACAGGGTGGAAGG + Intronic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
958018638 3:87970960-87970982 CAGAGTTGCTATAGGAAGGAAGG - Intergenic
958807867 3:98833820-98833842 CAGAGCTCCCACTGGGAGGGTGG - Intronic
959817925 3:110697881-110697903 CTGAGTTTCCAGAGGGAGCATGG - Intergenic
959950545 3:112175578-112175600 CAGAGCGCCCAGAGGGAGGGTGG - Intronic
960610396 3:119550118-119550140 AAGAGTTGGCAGTGGGAGGAGGG - Intronic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
961209776 3:125116706-125116728 CAGAGTCCCTAAAGGGTGGAAGG + Intronic
961381628 3:126499480-126499502 CACAGGGCCCAGAGGGAGGCTGG + Intronic
961563697 3:127748364-127748386 CAGAGGTGGGAGAGGGAGGAGGG + Intronic
962445164 3:135457315-135457337 TAGAGTTCCCAGAAGGGCGAGGG - Intergenic
962604648 3:137023458-137023480 AAGGGCTCCCAGAGGGAGCATGG + Intergenic
963641059 3:147862318-147862340 AAGGGGTCCCAGATGGAGGAGGG + Intergenic
964060652 3:152518311-152518333 CAGAGTTGCCAGGAGGAGCAGGG - Intergenic
964967291 3:162511767-162511789 AAACGTTCCCAGAGGGAGGGTGG - Intergenic
966276062 3:178171294-178171316 CAGAATTCCCAGGGGCAGGGAGG + Intergenic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967862103 3:194160088-194160110 CAGATTTCCTAGAGTGAGGAAGG + Intergenic
968054608 3:195681788-195681810 CAAAGTTACCAGAGGGAAAAAGG - Intergenic
968101283 3:195967370-195967392 CAAAGTTACCAGAGGGAAAAAGG + Intergenic
968295939 3:197576792-197576814 CAGAGACCCCAGGGGGTGGAGGG - Intergenic
968363188 3:198163391-198163413 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
969058026 4:4414132-4414154 CAGGTTCCCCACAGGGAGGAGGG + Intronic
969322286 4:6419748-6419770 CAGAGCTTCCAGAGGGAGCCAGG - Intronic
969641461 4:8401584-8401606 CCCAGCTCCCACAGGGAGGATGG - Intronic
969703557 4:8780496-8780518 CACAGTTCCTGGAGGAAGGAGGG - Intergenic
971331938 4:25688847-25688869 CAGAGTCCCCAGTGGCAAGAGGG + Intergenic
973021581 4:45209325-45209347 CATGGTTCCAAGAGGGAGAATGG - Intergenic
973841520 4:54865800-54865822 CAGAGTTCCCACAAGCAAGAAGG + Intergenic
974109844 4:57512548-57512570 CAGAGTGCCCAGAGGTGGGGTGG - Intergenic
975103478 4:70541337-70541359 GAGACTTCCCAGGGGGAGCAGGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975632782 4:76419519-76419541 CAGAGCCTCCAGAGGGAGGGAGG - Intronic
975922412 4:79408045-79408067 AAGAGTTCCCAAAAGAAGGATGG - Exonic
976112072 4:81686269-81686291 CTGAGTTCCAAAAGGGAGAAAGG + Intronic
976482044 4:85556831-85556853 TAGAGCTCCTAGAGGGAGGCAGG - Intronic
977002103 4:91518037-91518059 CAGAGCCCTCAGAGGGAGCATGG - Intronic
978423044 4:108554253-108554275 CTGAATTCCAAAAGGGAGGACGG - Intergenic
979547710 4:121956216-121956238 AAGAGATCCCATAGTGAGGAGGG + Intergenic
980264674 4:130500054-130500076 CCAAATTCCCAAAGGGAGGAGGG - Intergenic
980568978 4:134585754-134585776 CAGACTTCCCAGTGTGAGGGAGG + Intergenic
980731256 4:136826675-136826697 CAGAGTGCAGAGAGGTAGGAGGG - Intergenic
982449322 4:155533246-155533268 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
983530437 4:168804862-168804884 AAGAGTTCCCAAAGCGAGGCCGG + Intronic
985504207 5:269678-269700 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
986602529 5:9487383-9487405 CAAAGGTCACAGAGGTAGGAAGG + Intronic
986684192 5:10261263-10261285 CTGGGTTCCCAGAGTGAGGGAGG + Intronic
986736005 5:10667750-10667772 CTGAGGCCCCAGAGGGAGCATGG - Intergenic
987542289 5:19271160-19271182 CTGAATTCCAAAAGGGAGGAAGG + Intergenic
988935915 5:36082946-36082968 CAGAGCTCCCAGAGGGACAGTGG + Intergenic
989326151 5:40197788-40197810 CAGAGTGCCCAGAGGGCCCAGGG - Intergenic
989605711 5:43242487-43242509 CACAGTTCTCAGGGGGATGATGG + Intronic
990984989 5:61632914-61632936 CACAGTTCCAAGAGGGAACAGGG - Intergenic
992583667 5:78209243-78209265 CTGAATTCCAAAAGGGAGGAGGG - Intronic
996192910 5:120567434-120567456 CAGAGTACACAGAGGGTGGTAGG + Intronic
996688716 5:126313938-126313960 CTGGATTCCAAGAGGGAGGAGGG + Intergenic
997150365 5:131487303-131487325 CAAAGCTTCCAGAGGGTGGAAGG + Intronic
997212687 5:132086724-132086746 GAGAGGTCCCAGTGGGAGAAGGG - Intergenic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
999174917 5:149625424-149625446 GAGATTCCCCAGAGGGAGAATGG + Intronic
999583680 5:153067208-153067230 CAACGTTCCAAGAGGGTGGAAGG - Intergenic
999959119 5:156735375-156735397 CAGAGCTCCCAGAGGCAGTGGGG - Intronic
1001284966 5:170416153-170416175 CAGCCTTCCCAGAGTGAGGCTGG - Intronic
1001513024 5:172336979-172337001 CAGCGGTCCCATAGGGAGGCAGG - Exonic
1001786183 5:174415729-174415751 CAGAGGTCCCAGCGGGAGACAGG - Intergenic
1001978514 5:176021114-176021136 CACAGATCCCAGAGAGAGGAGGG + Intronic
1002238903 5:177822648-177822670 CACAGATCCCAGAGAGAGGAGGG - Intergenic
1002408031 5:179051601-179051623 CAGAGTTCCCGAAAGGTGGAGGG - Intergenic
1003081354 6:3024139-3024161 CAGAGTTGCCGGAGGGAGGGTGG - Intergenic
1003959779 6:11198290-11198312 AAGATTTCCAAGAGGAAGGAGGG - Intronic
1005825860 6:29631655-29631677 CAGGCTCCCCAGTGGGAGGAAGG + Intronic
1006051673 6:31350145-31350167 CTGAATTCCAAGAGGGAAGAGGG + Intronic
1006055329 6:31379680-31379702 CATAGTTGCCAGAGGGTGGAAGG + Intergenic
1007509071 6:42361771-42361793 CAGAGCTGCCTGAAGGAGGATGG - Intronic
1007769314 6:44180414-44180436 AAGAGTTACCAGGGGGAGGGAGG - Intronic
1007935127 6:45726217-45726239 CAGAGTGCCCAGAGTGAGGTGGG + Intergenic
1010034404 6:71307165-71307187 TAGAGTTCAGAGAGGGAGAAGGG + Exonic
1010524503 6:76884203-76884225 CAGAGTCCACATGGGGAGGATGG + Intergenic
1012167305 6:95973387-95973409 ATGAGTTGCCAGAGGGAAGAAGG + Intergenic
1012859762 6:104545192-104545214 CAGAGTTCCCAGTCAAAGGAAGG - Intergenic
1013313766 6:108922077-108922099 CAGAGTACTCTGATGGAGGAAGG + Intronic
1013911655 6:115282680-115282702 CTGAGGCCCCAGAGGGAGGGTGG - Intergenic
1014501458 6:122195209-122195231 CAGAGTTTCCGGAGGGAGTGTGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015814376 6:137192950-137192972 CTAAGTTCCAAAAGGGAGGAGGG + Intergenic
1016356733 6:143226800-143226822 CAGAGTTCCCTGAGAGAGGATGG - Intronic
1016458013 6:144251295-144251317 CAGTGTCCTCAGAGGGAGCATGG - Intergenic
1016907786 6:149168922-149168944 CACAGTTCCCAAGGGGAGGAGGG + Intergenic
1016964825 6:149709204-149709226 CTGAATTCCAACAGGGAGGAGGG - Intronic
1017054720 6:150426481-150426503 CAGTGTTCTCAGAGGAAGGAGGG + Intergenic
1017193515 6:151677798-151677820 CAGAGTTTGCAAAGGGAGGAGGG + Intronic
1018323768 6:162641703-162641725 TAGAGTTAACAGAGGGCGGATGG - Intronic
1018923007 6:168188786-168188808 CAGTGTCCTCAGTGGGAGGATGG + Intergenic
1019252492 7:25320-25342 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1019377259 7:699434-699456 CAGAGGTCACAGCTGGAGGAAGG + Intronic
1019471923 7:1225579-1225601 CAGAGTCCCCAGAGGGTGAGCGG - Intergenic
1021103324 7:16608560-16608582 CAGATTTGCCAGAGGGAGGGAGG + Intronic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1021891500 7:25190204-25190226 TAGAGTTCCAAGAGTGATGAGGG + Intergenic
1022517484 7:30985113-30985135 CAGAGACCCCAGAGGGCGGGTGG - Intronic
1022621677 7:31990517-31990539 TAGACTTCCCAGAAGAAGGATGG + Intronic
1023595980 7:41829866-41829888 CACAGGTCCCAGAAGGAGGCTGG - Intergenic
1023965994 7:44963272-44963294 CAGGGCCCCGAGAGGGAGGAGGG - Intronic
1024216948 7:47255957-47255979 CACAGATCCCAGAGAGAAGAAGG - Intergenic
1024485230 7:49910138-49910160 CAGAGTTCAGGGAGGGAGAAGGG + Intronic
1024797528 7:53036452-53036474 CAGAAGTCCCAGATGGCGGATGG - Exonic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1026606435 7:71819996-71820018 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1027467240 7:78531047-78531069 TTGAGTTCCCTGAGGGAGCAGGG - Intronic
1027504286 7:78996119-78996141 TATTGTTCCCAGAGGGAGAATGG - Intronic
1029514672 7:101017826-101017848 AAGGGGTCCCAGGGGGAGGAAGG - Intronic
1030112775 7:106040801-106040823 CAGAGGTCACAGAGCCAGGATGG + Intergenic
1030143281 7:106327261-106327283 GACAGTTCCTAGAAGGAGGAGGG - Intergenic
1030333290 7:108296011-108296033 GAGAGTTCCCAGAGGGTGTCTGG + Intronic
1030860653 7:114621772-114621794 CAGTGTACCCAGCGGCAGGAGGG + Intronic
1031924602 7:127627567-127627589 CAGAGTTACAGCAGGGAGGATGG - Intergenic
1032077357 7:128842408-128842430 CAGGGGTCCCTGAGGGAGGGCGG + Intronic
1034147398 7:148884724-148884746 CAGAGTTCCCGGGCGGGGGAGGG + Intergenic
1035109321 7:156467378-156467400 CAGAGTCCCCAAAGGTTGGAGGG - Intergenic
1035610318 8:957995-958017 CAGAGTTTCTACAGGGATGACGG - Intergenic
1036978777 8:13445131-13445153 AAGAGAGCACAGAGGGAGGAAGG + Intronic
1037143271 8:15542391-15542413 CAGAATTCCAAGAAGAAGGAGGG + Intronic
1037824846 8:22155021-22155043 CAGAGTTCCCAGAAAGAGCTGGG - Intronic
1038227262 8:25669007-25669029 CAGAGTTCTCAGAAGCAGCATGG + Intergenic
1038701846 8:29856256-29856278 CAGAGCCTCCAGAGGGAGCACGG + Intergenic
1038739506 8:30204578-30204600 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1038905463 8:31897254-31897276 CTGAGTTCCAGAAGGGAGGAGGG - Intronic
1039515665 8:38131211-38131233 AAGAGTTCCGGGAGGCAGGATGG - Intronic
1039722202 8:40176245-40176267 CTGAATTCCAAAAGGGAGGAAGG - Intergenic
1039832102 8:41223616-41223638 CAGAGAGCCAAGAGGGAGGAAGG + Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040485173 8:47864275-47864297 CTGAGTTCCCAGAGTGAGCGTGG + Intronic
1041005204 8:53491453-53491475 CAGAGCCCCCAGAGGGAGTATGG - Intergenic
1042844367 8:73155715-73155737 CAGACTTCCCAGAAGCAGCAGGG + Intergenic
1043363200 8:79499735-79499757 CTGAGTTTCCAGGGGGAGGGAGG - Intergenic
1043727454 8:83629110-83629132 TAGAGCTCCCAGAGGGAGGGAGG - Intergenic
1045391425 8:101718782-101718804 CTGAATTCCAAGAGGAAGGAGGG - Intronic
1045501756 8:102749015-102749037 CAGGGATCCCAGAGGGAAGCAGG + Intergenic
1045533523 8:103006085-103006107 CTGAATTCCAAAAGGGAGGATGG + Intergenic
1045974845 8:108120659-108120681 AAGAATTGCCAGAGGGTGGATGG - Intergenic
1046078735 8:109344219-109344241 GAGAGTTCCAAGTGGCAGGATGG - Exonic
1046487748 8:114909169-114909191 TGGAGCTCCCAGAGGTAGGAGGG + Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1047766700 8:127996048-127996070 CAGAGGTCCTTGAGGGAGGGAGG - Intergenic
1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG + Intronic
1048352846 8:133629908-133629930 CAGAGTTCCCTGGGTGAGGTGGG + Intergenic
1049180660 8:141220477-141220499 CAGACTCCCCTGAGGCAGGAGGG - Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049467588 8:142759121-142759143 CTGAATTCCAGGAGGGAGGAGGG - Intergenic
1049514388 8:143045693-143045715 CAGGCTTGCCAGAGAGAGGAAGG + Intronic
1049622192 8:143603547-143603569 CAGAGGTCCCAGGGGGAGACAGG + Intergenic
1050418459 9:5438006-5438028 CAGTGTTACCAGAGGTGGGAGGG + Intergenic
1050682140 9:8124133-8124155 CAGCACTCCCAGAGGAAGGAGGG - Intergenic
1052173012 9:25425516-25425538 CAGAGGCCCCAGAGGAAAGAAGG + Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1054798834 9:69326479-69326501 CAGCGTTCCCGGTTGGAGGAGGG - Intronic
1055449526 9:76418378-76418400 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1056681982 9:88727369-88727391 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
1056720022 9:89063540-89063562 CCTACTTCCCAGAGGGATGAAGG + Intronic
1056725065 9:89107216-89107238 GAGACTTCCCAGAGGAGGGAGGG - Intronic
1056995344 9:91452116-91452138 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1057519728 9:95751610-95751632 CTGAGCTGCAAGAGGGAGGATGG + Intergenic
1058125494 9:101189464-101189486 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1058552404 9:106128948-106128970 CAGAGCTACGAGATGGAGGAGGG + Intergenic
1059412242 9:114139643-114139665 CAGGGTCCCCAGAGGAAGGGAGG + Intergenic
1059752327 9:117259435-117259457 CCAAATTCCCAAAGGGAGGAGGG - Intronic
1060591221 9:124818126-124818148 CAGAGCTCACAGAGGGGAGATGG - Intergenic
1060660480 9:125402402-125402424 CTCAGTTGCCAGGGGGAGGATGG + Intergenic
1061657613 9:132104804-132104826 CTGGGTTCCTAGAGGTAGGAGGG + Intergenic
1061872679 9:133529089-133529111 CAGAGGTCCCAGAGCTAGGATGG - Intergenic
1062601108 9:137318944-137318966 CAGGGTTCCCAGAGCGAGGCTGG - Intronic
1062747875 9:138227051-138227073 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1185478133 X:427437-427459 CAGAGACCCCAGAGACAGGACGG + Intergenic
1185924403 X:4130669-4130691 CTGAGATGCAAGAGGGAGGAAGG - Intergenic
1186485115 X:9928237-9928259 CACAGTTCCCAGAGGGGAGAGGG - Intronic
1187013076 X:15299593-15299615 CTGAGTTCCAAAAGGGAGGAGGG + Intronic
1187213681 X:17254141-17254163 CACTGTTCCCAGGGGGATGAAGG - Intergenic
1188312858 X:28639169-28639191 CATTGCTCCCAGAGGGAGAATGG - Intronic
1188365643 X:29312096-29312118 GAAAGTTTCCAGAGGGAGAATGG + Intronic
1188575522 X:31645273-31645295 GAGACTTCCCACAAGGAGGATGG - Intronic
1188876209 X:35433555-35433577 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1189082366 X:37988293-37988315 TAGAGTCCCCAGAGGGAGTATGG + Intronic
1189401114 X:40669572-40669594 CAGATTTCACAGAGAAAGGAGGG - Intronic
1189758752 X:44299286-44299308 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1190360313 X:49643151-49643173 CAGAATTCTAAAAGGGAGGAGGG - Intergenic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1192173692 X:68873046-68873068 CTGAGGCCCCAGAGGGAGAAAGG - Intergenic
1193295820 X:79830138-79830160 TGGAGCTCCCAGAGGGAGGAGGG - Intergenic
1193888481 X:87013072-87013094 CAAAGTTTCCAGAGCGTGGAAGG + Intergenic
1193959208 X:87902625-87902647 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1194856817 X:98940646-98940668 TACAGATCCCAGAGGGAAGAAGG - Intergenic
1194935875 X:99948214-99948236 CAGATTTCCCAGAGTGATGAAGG - Intergenic
1197203944 X:123773709-123773731 CATAGATCCCAGAGAGAAGAAGG + Intergenic
1197286672 X:124603120-124603142 CAGAGTCTCCAGAGGGAGTGTGG + Intronic
1197351370 X:125387551-125387573 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1197487282 X:127068726-127068748 GATAGTTACCAGAGGCAGGAAGG - Intergenic
1197838756 X:130723028-130723050 CAGAGATCCCAAGGTGAGGATGG + Intronic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1199316349 X:146382737-146382759 TAGAAGTCCCAGAGGGAGGGAGG + Intergenic
1199864940 X:151836315-151836337 CAAAGTTACCAAAGGAAGGATGG + Intergenic
1200336290 X:155354247-155354269 CAGAGCTCCCGGAGGGAGGGAGG + Intergenic
1200350180 X:155486980-155487002 CAGAGCTCCCGGAGGGAGGGAGG - Intergenic
1200360874 X:155604668-155604690 CAGAGCACCAAGAGGGAGCATGG + Intronic
1200444904 Y:3248642-3248664 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1200961845 Y:9003101-9003123 CAGAGATTTCAGAGAGAGGAAGG + Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic
1201567871 Y:15385399-15385421 CAGAGTTCCCAGGGGGTTCATGG + Intergenic
1201756673 Y:17494040-17494062 CCCAGTTCCCGGAGGGAGGGAGG + Intergenic
1201844880 Y:18411944-18411966 CCCAGTTCCCGGAGGGAGGGAGG - Intergenic