ID: 1152736708

View in Genome Browser
Species Human (GRCh38)
Location 17:82000825-82000847
Sequence TGTCTTTGAAGTGCCTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152736700_1152736708 -5 Left 1152736700 17:82000807-82000829 CCCGGCGCCCCCTGGCCCTGTCT 0: 1
1: 0
2: 1
3: 35
4: 419
Right 1152736708 17:82000825-82000847 TGTCTTTGAAGTGCCTCCACTGG 0: 1
1: 0
2: 1
3: 10
4: 145
1152736701_1152736708 -6 Left 1152736701 17:82000808-82000830 CCGGCGCCCCCTGGCCCTGTCTT 0: 1
1: 0
2: 2
3: 28
4: 341
Right 1152736708 17:82000825-82000847 TGTCTTTGAAGTGCCTCCACTGG 0: 1
1: 0
2: 1
3: 10
4: 145
1152736696_1152736708 21 Left 1152736696 17:82000781-82000803 CCGGGCGCTGGGAGAGGCTGGGG 0: 1
1: 5
2: 12
3: 136
4: 1379
Right 1152736708 17:82000825-82000847 TGTCTTTGAAGTGCCTCCACTGG 0: 1
1: 0
2: 1
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152736708 Original CRISPR TGTCTTTGAAGTGCCTCCAC TGG Intronic
903726220 1:25447748-25447770 TGTCTTTGAGATCCCTCCAAGGG - Intronic
913234426 1:116767653-116767675 CGTCTTTGCAGTGGCTCCAGAGG - Intronic
919441703 1:197642353-197642375 TTTCTTTCAAGTGGCTCCAATGG + Intronic
923716052 1:236425506-236425528 TGTTTGTGAAGTGCATCCCCAGG - Intronic
1063390468 10:5646923-5646945 TGTCTTAGAAGTATCTCCATTGG - Intronic
1065766728 10:29037245-29037267 TCTGTTTGAAGTGCCTGCAGTGG - Intergenic
1083743876 11:64724634-64724656 TCTCTTTGAAGTGCCTGGGCAGG - Intergenic
1085792630 11:79509019-79509041 TGTCTGTGAAGTGCCTATAATGG + Intergenic
1087151915 11:94867206-94867228 TGTGTTTGAAGTCCCTCCACTGG + Intronic
1088973021 11:114790113-114790135 TGTCTCTGAAGAGCCCCCTCTGG + Intergenic
1091227483 11:133966253-133966275 TCTCTTTTCAGTGCCTCCACTGG - Intergenic
1091661151 12:2384744-2384766 TGTCCCTGCAGTGCCTCTACTGG - Intronic
1096300217 12:50420650-50420672 TGTCTTTAAAGTGCCTGAAAGGG + Intronic
1097334510 12:58366976-58366998 TGTCTTTGCCATGCCTCCCCAGG - Intergenic
1097487934 12:60229627-60229649 TGTCTATCAAGAGCCTGCACAGG + Intergenic
1101074438 12:101113922-101113944 TTTCTTGGAAGTGCCTACAGAGG + Intronic
1101708215 12:107240614-107240636 TGACTTTGCAGTGCCTCCCATGG + Intergenic
1105304642 13:19160057-19160079 TGTCGAAGCAGTGCCTCCACTGG + Intergenic
1106592058 13:31106300-31106322 TATCTTTGAGCTGCTTCCACGGG + Intergenic
1107659694 13:42626088-42626110 TGTCTTTGAGGGGCCCCCAGTGG + Intergenic
1109445387 13:62431840-62431862 TCTCTTTTATGTGTCTCCACTGG - Intergenic
1111487858 13:88927186-88927208 AGGCTTTGAAGTGCCTACTCCGG - Intergenic
1112336600 13:98522023-98522045 TGACTTTGAAGGGACTCCAGAGG - Intronic
1116298002 14:43136739-43136761 TTTTTTTGCAGTGCTTCCACAGG + Intergenic
1116799759 14:49430110-49430132 GGTCTTTGAGGAGCCTCCTCTGG - Intergenic
1119814036 14:77549251-77549273 ATTCTTTGACATGCCTCCACTGG + Intronic
1121603356 14:95222556-95222578 TGTCCTTGGTGGGCCTCCACGGG - Intronic
1121665342 14:95667640-95667662 AGTCTGGGAAGGGCCTCCACTGG - Intergenic
1124560763 15:30771287-30771309 TGTTTATGATGTGCCTTCACGGG + Intronic
1124670449 15:31634166-31634188 TGTTTATGATGTGCCTTCACGGG - Intronic
1124926381 15:34074296-34074318 TGTTTTTTAAGTTCCTCCATGGG - Intergenic
1125542894 15:40481195-40481217 TGTGATTGAAGTTCCTCCACAGG + Intergenic
1126519499 15:49575969-49575991 TTTCTTTTAAGTGCATCCAGAGG + Intronic
1127116148 15:55729789-55729811 TGTCTTTGAAGAACCACCAATGG - Intronic
1127374608 15:58371961-58371983 TGTCTATGTAGTTCCTTCACAGG - Intronic
1128273382 15:66331913-66331935 TGTCTTTGAAGTACATGCACTGG - Exonic
1128279094 15:66379795-66379817 TGTGATTGAAGTCCCTCCGCAGG + Intronic
1128989152 15:72244216-72244238 TATCTTTTATGTGCCTCCTCTGG - Intronic
1130262885 15:82372768-82372790 TGTGATTGAAGTCCCTCCGCAGG + Intergenic
1131421187 15:92306840-92306862 TGTCTTTGCTGTGTCTCCAAGGG + Intergenic
1131880962 15:96861524-96861546 TGTGTTTCAAGGTCCTCCACAGG + Intergenic
1138203567 16:55107782-55107804 GGTCTTTGCAGAGCCTCCAGGGG + Intergenic
1139560696 16:67739950-67739972 AGTCCTTGGAGAGCCTCCACTGG - Intronic
1143728714 17:8867618-8867640 TGTCTTGGGGGAGCCTCCACGGG + Exonic
1144035268 17:11359568-11359590 TGACTTTGAAGTGTCTTGACAGG + Intronic
1144515394 17:15914122-15914144 TGTGTTTGAAATGCCTTCCCAGG - Intergenic
1144848865 17:18234050-18234072 TGTCCCTGGAGTGACTCCACGGG - Exonic
1147893888 17:43737715-43737737 TGTATTTGAAGTGGCCCCAGAGG + Intergenic
1148510898 17:48168764-48168786 TGCCTTTTAAATGCCTTCACTGG + Intronic
1148573533 17:48690507-48690529 TGTGATTGAAGTCCCTCCACAGG + Intergenic
1148573642 17:48691574-48691596 TGTGACTGAAGTCCCTCCACAGG + Intergenic
1149639360 17:58193025-58193047 TCTCTTTGAACAGCCTCCCCTGG + Exonic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1150880014 17:69013903-69013925 TCTCTTTGAATTGCCACCTCTGG - Intronic
1152736708 17:82000825-82000847 TGTCTTTGAAGTGCCTCCACTGG + Intronic
1154390196 18:13930144-13930166 TATCATGGAAGTGCCACCACAGG + Intergenic
1155313476 18:24547638-24547660 AGTCTTTGACCTGCCCCCACTGG - Intergenic
1155866243 18:30968673-30968695 TCTCTGTGAAGAGCCTTCACAGG + Intergenic
1156247983 18:35321537-35321559 TGTCTATGCAGTCCCTGCACAGG + Intergenic
1157644445 18:49252749-49252771 TGTCTCTCATGTCCCTCCACTGG - Intronic
1158575200 18:58631354-58631376 TGTAAGTGAAGTCCCTCCACAGG - Intergenic
1160577023 18:79862530-79862552 AGTCCCTGAAGTGCCTCCTCGGG - Intergenic
1162028831 19:7908833-7908855 TGTCTCTGCAGCGCCTCCTCTGG + Intronic
1163920880 19:20287386-20287408 TTTCTTTCAACTGCATCCACAGG + Intergenic
1164680110 19:30128508-30128530 TGTCTTGGAAGTGTCTCCGCAGG - Intergenic
1165176749 19:33936074-33936096 GGTATTTGCAGTGCCTACACAGG - Intergenic
1165348007 19:35261104-35261126 TGTGTCTGAGGGGCCTCCACAGG - Intronic
1166883401 19:45942789-45942811 TGGTTTTGAAATGTCTCCACAGG - Intronic
1168305414 19:55432701-55432723 TGTCTCTGCAGTGACACCACAGG + Exonic
925326073 2:3023069-3023091 TGTCTCTGCAGTGCCAGCACAGG + Intergenic
927128343 2:20034316-20034338 TGCCTTTGAAGCACCTCCTCAGG - Exonic
933348495 2:81122440-81122462 AGTCTTTCATGTGCCTCAACAGG + Intergenic
933517440 2:83323330-83323352 TTTCTGTGATGTGCCTCCATAGG + Intergenic
936972743 2:118190501-118190523 TGGCTTTGAATTTCCCCCACTGG + Intergenic
937953219 2:127404339-127404361 TGTCTCTGAAGTTTCTCCACTGG - Intergenic
938617447 2:133013812-133013834 TGTGTTGGAAGTGTCTTCACAGG + Intronic
940684174 2:156825719-156825741 TTTCTTTGATGTCCCCCCACTGG - Intergenic
945280584 2:208031833-208031855 TGTGACTGAAGTCCCTCCACAGG + Intergenic
945568893 2:211439333-211439355 GGTTTTTAAAGTGCCTCCAAAGG + Intronic
948130482 2:235597028-235597050 TGTTGTTGAAGTGCCTCTGCCGG + Intronic
1170102960 20:12722357-12722379 AGTCTTGGAAGTGCTTCCCCAGG + Intergenic
1171568840 20:26225581-26225603 TGTCTTTAAAGTTAATCCACTGG + Intergenic
1175311957 20:58018433-58018455 TGTCTCTCCAGTGCCTCCTCTGG - Intergenic
1175731342 20:61356157-61356179 TTTCTATGAAGTGCCTCATCTGG + Intronic
1180282087 22:10710064-10710086 TGTCTTTAAAGTAAATCCACTGG - Intergenic
1181609961 22:24005640-24005662 TGTCTGTGAGGTGGCACCACGGG - Intergenic
1203239329 22_KI270732v1_random:41220-41242 TGTCTTTAAAGTAAATCCACTGG - Intergenic
949715353 3:6924267-6924289 TCTCTTTGAAGTGCCTTCAGAGG - Intronic
951839504 3:27018943-27018965 TGTGTTTGAACTGCATCCTCTGG + Intergenic
951848067 3:27105955-27105977 TGTCTTTGGAATGCCTCCTAGGG + Intergenic
954772499 3:52984563-52984585 TGTCATTGAAGTGCCTGTATTGG - Intronic
954925537 3:54231120-54231142 TGTCTTTAGGGTGCCTCCCCAGG + Intronic
957110008 3:75942772-75942794 TGTCTTTAAAGTAAATCCACTGG - Intronic
957360502 3:79150459-79150481 TGTCTTTTAAATACCTCCAATGG - Intronic
958059816 3:88465510-88465532 TCACTTTGCAGTACCTCCACTGG + Intergenic
959930380 3:111975206-111975228 TGACTTTGCAGTGTCACCACTGG + Exonic
961449774 3:126997438-126997460 CGTCTTTGCTGTGCCCCCACTGG + Intronic
964103618 3:153016776-153016798 TGTCTTTTGACTGCTTCCACTGG - Intergenic
969030857 4:4212382-4212404 TGCCATTGCAGTGCCTCCTCTGG - Intronic
972476779 4:39458235-39458257 TGTGATTGAAGTCCCTCCGCAGG + Exonic
973863618 4:55090067-55090089 TCTCTTTGCAGTGTATCCACAGG - Exonic
973989325 4:56388202-56388224 TGTCTTCGCAGTCCCTCCCCCGG - Intergenic
974137449 4:57836352-57836374 TGTCCTTCCAGTGCCTCCAATGG + Intergenic
974998696 4:69194695-69194717 TGTCTTTTAATTGTCCCCACAGG + Intronic
975347673 4:73312287-73312309 TGCCTTTGAAGTGCTCCCAAAGG - Intergenic
979475903 4:121157243-121157265 TGTCTTTGAACGACCTCCTCAGG - Exonic
981658353 4:147137664-147137686 TGTCTTCTAACCGCCTCCACTGG + Intergenic
982408730 4:155048294-155048316 TGTCTCTGAAGAGACTTCACAGG + Intergenic
986068077 5:4255502-4255524 TGTCTCTGAATTGGCTCAACAGG - Intergenic
988505920 5:31823016-31823038 TGTGATTGAAGTCCCTCCGCAGG + Intronic
990256678 5:53977790-53977812 TCTCTATGCAGTGCTTCCACTGG + Intronic
998433655 5:142088453-142088475 TGTCCCTGAAGGGCCTCCCCTGG - Intergenic
999889401 5:155960295-155960317 TGTCCTTTGAGTGCCTCCCCTGG - Intronic
1000331739 5:160211273-160211295 TGTCAGTTAAGAGCCTCCACTGG + Intronic
1001057109 5:168458927-168458949 TATCCTTCAAGTGCCACCACTGG + Intronic
1003622464 6:7713075-7713097 TATATTTTATGTGCCTCCACTGG + Intergenic
1005112457 6:22297972-22297994 TGTCTTAGAAGTGGGTCCACAGG - Intergenic
1005704288 6:28436061-28436083 AGTCTTTGAAGAGCCTCCCGGGG + Exonic
1005872891 6:29989029-29989051 TGTTTGTGAAGTGAATCCACAGG + Intergenic
1007834999 6:44667491-44667513 GGCCTGTGAAATGCCTCCACAGG + Intergenic
1009435748 6:63616283-63616305 TGTGATTGAAGTCCCTCCGCAGG + Intergenic
1009820207 6:68790352-68790374 TGTCTGTGAACTGCCCCCAGAGG - Intronic
1010656276 6:78515109-78515131 TTTTTTTGGAGTGCCACCACAGG - Intergenic
1012134943 6:95544037-95544059 TGTGTGTGAAGTGCCTCTAGTGG + Intergenic
1013597522 6:111673339-111673361 AGTCTCTGAAGTGCCGGCACTGG - Intronic
1013769751 6:113614445-113614467 TGTTTCTTAAGTGCCTTCACAGG - Intergenic
1020677056 7:11195631-11195653 TGTCTTTGCAGTCCCTGTACAGG + Intergenic
1024096717 7:45987933-45987955 TGTTTTTGAAATGCCTCCGAGGG - Intergenic
1024962568 7:54993138-54993160 TGTATTTCCAGGGCCTCCACAGG + Intergenic
1030023012 7:105293977-105293999 TATCTGTGAACTGCCTGCACCGG + Intronic
1031640595 7:124159188-124159210 TGTCTTTGAAGACCTTCCAGTGG - Intergenic
1037273026 8:17150768-17150790 TGTGATTGAAGTCCATCCACAGG + Intergenic
1038379469 8:27079141-27079163 GATCTTTGAAGTGCCCCCAGTGG + Intergenic
1039286068 8:36042238-36042260 TGTCTTCCATGTGCCTCCCCAGG + Intergenic
1039356034 8:36816780-36816802 TGTCTTCAATGTCCCTCCACTGG + Intronic
1042061097 8:64818866-64818888 TGTTTTTGAGGTGACTACACTGG + Intergenic
1045468104 8:102487886-102487908 TGTCTGTGACATGCCTCCCCCGG + Intergenic
1046507472 8:115154676-115154698 CCTCTTCGTAGTGCCTCCACAGG + Intergenic
1046737707 8:117794750-117794772 TGTTTTTGTAGTGTCACCACAGG - Exonic
1048865375 8:138757114-138757136 TGTCCTGGAAGTGCCTGCAGGGG - Intronic
1051766510 9:20530414-20530436 TGGCTTTGAAGTTTTTCCACTGG - Intronic
1052046211 9:23797276-23797298 TGTTTTTGTAGTGCCTTTACTGG - Intronic
1058533054 9:105925971-105925993 TGTTTTTGGAGTGCCGACACTGG + Intergenic
1061644125 9:131985830-131985852 TGCCTTTGAAGACCTTCCACTGG + Intronic
1061898635 9:133661779-133661801 TGTTTTGAAAGTGCCTACACTGG - Intergenic
1187879914 X:23837200-23837222 TGTGATTGAAGTCCCTCCGCAGG + Intronic
1188191007 X:27171802-27171824 TGGCTTTGAAGTACCTCAACAGG + Intergenic
1189965830 X:46371827-46371849 TGCCTTTGAAGACCTTCCACTGG - Intergenic
1192557517 X:72102150-72102172 TGTCTTTGTTGTACCTCCTCAGG + Intergenic
1192840289 X:74848490-74848512 TGCCTTTGCAGAGCCTCCAGAGG - Intronic
1195865478 X:109428242-109428264 TGTCTGCCAAGTTCCTCCACTGG - Intronic
1197589814 X:128394483-128394505 TGTGTTTGAAGTTCCTCATCAGG + Intergenic
1198916948 X:141683158-141683180 TGTTTTTGCAGTGGCTCTACTGG - Intronic
1199514666 X:148662710-148662732 AGTCTTTGAACTGGCTGCACTGG - Exonic
1199835340 X:151584650-151584672 TGTCTTGTAAATGCTTCCACAGG + Intronic
1200130964 X:153845543-153845565 TGTCTTTGCAATGCCTCCAGTGG + Intergenic
1201148364 Y:11079597-11079619 TGTCTTTGCAGTCTGTCCACAGG + Intergenic