ID: 1152737543

View in Genome Browser
Species Human (GRCh38)
Location 17:82004799-82004821
Sequence GGCCTTTGGAAGCCGGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152737531_1152737543 16 Left 1152737531 17:82004760-82004782 CCCAGCAAGAGGGGCAGGGTCGG 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1152737543 17:82004799-82004821 GGCCTTTGGAAGCCGGGCCCAGG 0: 1
1: 0
2: 0
3: 24
4: 192
1152737525_1152737543 28 Left 1152737525 17:82004748-82004770 CCTCTGACTCTGCCCAGCAAGAG 0: 1
1: 0
2: 1
3: 29
4: 264
Right 1152737543 17:82004799-82004821 GGCCTTTGGAAGCCGGGCCCAGG 0: 1
1: 0
2: 0
3: 24
4: 192
1152737533_1152737543 15 Left 1152737533 17:82004761-82004783 CCAGCAAGAGGGGCAGGGTCGGG 0: 1
1: 0
2: 1
3: 21
4: 249
Right 1152737543 17:82004799-82004821 GGCCTTTGGAAGCCGGGCCCAGG 0: 1
1: 0
2: 0
3: 24
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152737543 Original CRISPR GGCCTTTGGAAGCCGGGCCC AGG Intronic
900400935 1:2472624-2472646 GGCCAATGCCAGCCGGGCCCAGG + Intronic
900639365 1:3681433-3681455 GGCCACTGGGAGCTGGGCCCAGG + Intronic
900907078 1:5566905-5566927 GGCTTTGGGCAGCCGGGCCTTGG + Intergenic
901082285 1:6590303-6590325 GGGCTGTGGGAGCCGGGCCCGGG + Intergenic
901879407 1:12185172-12185194 AGCCTTTGGATGCCGGGTCTCGG + Intronic
902782928 1:18716238-18716260 GGCCTTTGGAAGGATGGGCCTGG + Intronic
904040289 1:27580312-27580334 GCCCTCTGGAAGCCAGGCCAGGG + Intronic
904497494 1:30895434-30895456 GGCCTCTGGGAGCTGAGCCCTGG - Intronic
904506129 1:30955786-30955808 AGACTTTTGAAGCTGGGCCCTGG - Intronic
905226532 1:36482662-36482684 GTCCTTTGGAACCCCAGCCCTGG - Intronic
905553162 1:38859783-38859805 GGCCTATGAGAGCCGGGCTCCGG - Exonic
905771706 1:40642215-40642237 GGCCTTTGGAATTCAAGCCCGGG - Intronic
907159492 1:52360140-52360162 GGCCTTAGGAAAGCGGCCCCTGG - Exonic
908889461 1:68827331-68827353 GGCCTTTGGAAGGAGGTCCTAGG - Intergenic
912758373 1:112344065-112344087 GGCCTTTAGAACCTGGGCCTAGG - Intergenic
914679939 1:149931996-149932018 GGCCTTTCGAAGACAAGCCCTGG + Exonic
915629043 1:157138021-157138043 GGGCTGTGGAAGCCAGGACCCGG - Intronic
918791377 1:188834589-188834611 TGCCTTTGGAAGCGGAGCCTGGG + Intergenic
920675084 1:208032987-208033009 ATCCTTTGGAAGCCCTGCCCAGG + Intronic
922608685 1:226908208-226908230 GGCATGTGGAAGGTGGGCCCTGG + Intronic
922905269 1:229169140-229169162 GTCCTTTGGAAGACAGGCCCAGG - Intergenic
1063133147 10:3195508-3195530 GGGCTTTGGAGCCAGGGCCCTGG + Intergenic
1065887962 10:30095384-30095406 GGCCATTGCAAGGCTGGCCCAGG - Intronic
1067108096 10:43378757-43378779 GTCCTTTGGAAACAGGGCTCAGG - Intergenic
1067292643 10:44955560-44955582 GTCTTTTGGAAGCTGTGCCCTGG + Intergenic
1068681658 10:59826545-59826567 GGCCTTGAGAAGCCTGGTCCAGG - Intronic
1069551590 10:69368137-69368159 GGGCTGTGGAAGCCGGGGTCTGG + Intronic
1069798865 10:71070132-71070154 GGCCTGTTGGAGCTGGGCCCTGG + Intergenic
1069826127 10:71256338-71256360 GGCCATTGGCAGCTGGGCTCAGG + Intronic
1073289112 10:102404744-102404766 GCCCTTTGGGACCTGGGCCCAGG + Intronic
1075061325 10:119258963-119258985 GGTATTTGGAAGTCTGGCCCAGG + Intronic
1075065308 10:119285363-119285385 AGCCTTGGGGAGCCTGGCCCAGG - Intronic
1076664605 10:132079099-132079121 GGCCACTGTAAGCCGGGCCCAGG - Intergenic
1076855868 10:133115401-133115423 CACCTGTGAAAGCCGGGCCCTGG + Intronic
1077341323 11:2027654-2027676 GGCCCCTGCAAGCCCGGCCCCGG - Intergenic
1077442077 11:2573590-2573612 GGCCTAGGGAAGCAGGGACCCGG + Intronic
1077837873 11:5939955-5939977 GGCCTTGGAAAGCAGGGCCCTGG - Intergenic
1078022075 11:7664676-7664698 GGGCCTTGGGAGCCAGGCCCTGG + Intergenic
1078361793 11:10674972-10674994 GGGCTTTGGACGCCGTGCACTGG + Intronic
1081808184 11:45901189-45901211 GGCTTTTGGCAGCCCGGCTCAGG + Intronic
1081968515 11:47183657-47183679 GGCCTTTGGAGGGCAGGCCCGGG - Intronic
1082813261 11:57491565-57491587 GGGCTATGAAAGCAGGGCCCTGG - Intronic
1083425352 11:62581560-62581582 GGGATTTGGAGGCCGGGCTCTGG + Exonic
1083929629 11:65833637-65833659 GGCCGTTGGAAGGAGGGGCCCGG + Exonic
1084193248 11:67508448-67508470 GGCCTTGGGAACCGGGACCCGGG + Exonic
1084473408 11:69375944-69375966 GGCCCTTTAAAGCCGGGGCCTGG - Intergenic
1084688669 11:70712114-70712136 AGCCTCTGGAAGCCGGGCGGGGG - Intronic
1084963160 11:72727749-72727771 GGCCTCTGGGGGCCTGGCCCTGG + Intronic
1089199391 11:116714730-116714752 GGCCTCTGGCAGCCAGGCCCTGG - Intergenic
1089329677 11:117680702-117680724 GGATTTGGGAAGCCTGGCCCTGG - Intronic
1089617192 11:119701581-119701603 GGGCTTTGGAATCCCAGCCCTGG - Intronic
1089619929 11:119716282-119716304 GGGCTGGGGAAGCCAGGCCCAGG - Intronic
1089738230 11:120564355-120564377 GGGCTCGGGAATCCGGGCCCGGG + Intronic
1089779555 11:120863776-120863798 GGCCTGCGGAAGCCAGGGCCTGG + Intronic
1202824308 11_KI270721v1_random:82843-82865 GGCCCCTGCAAGCCCGGCCCCGG - Intergenic
1094466040 12:30754784-30754806 AGGCTTTGGAAGGCGGGCCCGGG - Intronic
1096674152 12:53217520-53217542 GGCCTTAGGGAGACAGGCCCGGG + Intronic
1102454852 12:113065112-113065134 GCCCTTTAGCAGCCAGGCCCCGG + Intronic
1102573805 12:113843589-113843611 GCCCTTTTGCTGCCGGGCCCAGG + Intronic
1105805002 13:23947473-23947495 GTCCATTGGGAGCCGGCCCCAGG + Intergenic
1114131628 14:19799904-19799926 GGCCTTTGCAATCCTGGCACAGG + Intronic
1114642331 14:24232065-24232087 GGGCTTTGAGAGCGGGGCCCAGG - Intronic
1116436261 14:44897757-44897779 GGCCCTGGGCAGCCGCGCCCGGG - Intronic
1120906574 14:89625835-89625857 GACCTTTGGAAGGTGGGTCCTGG + Intergenic
1120940414 14:89942915-89942937 GCCCTTGGGAAGCAGGGCCTGGG + Intronic
1121232023 14:92365136-92365158 GGCCTGAGGAAGCCGGGCAGTGG - Intronic
1122327168 14:100889766-100889788 GGGCCTTGGAAGCAGGGCCAGGG + Intergenic
1122672687 14:103384700-103384722 GGCATTTGGAAGCTGGTCCCTGG + Intergenic
1125685266 15:41559770-41559792 GGCCTTTGGGTGCCCAGCCCCGG - Intronic
1127492440 15:59478035-59478057 GGTCCCTGGAAGCCGAGCCCTGG + Intronic
1129379090 15:75154326-75154348 GGGCTTTGGAAGAGGGGACCCGG + Intergenic
1130532873 15:84760911-84760933 GGTTTTTGAAAGCCTGGCCCAGG + Intronic
1131175064 15:90204162-90204184 GACCATGGGACGCCGGGCCCAGG + Intronic
1132189526 15:99839608-99839630 GCCCTTTGTAAGCAAGGCCCAGG + Intergenic
1202983558 15_KI270727v1_random:389861-389883 GGCCTTTGCAATCCTGGCACAGG + Intergenic
1132938040 16:2491923-2491945 GACCTTTGGACGCCAAGCCCAGG - Intronic
1134002451 16:10793378-10793400 TGCCTCTGGATGCTGGGCCCAGG + Intronic
1136094739 16:27947058-27947080 GGGCTTTGAGAGCCGGGCTCTGG - Intronic
1137619419 16:49866729-49866751 GCCCCTGGGAAGCCAGGCCCTGG - Intergenic
1137897403 16:52228867-52228889 GGGCTTTGGAAGCCCTGACCAGG - Intergenic
1138345877 16:56319823-56319845 GGCCTGTGGAGACAGGGCCCAGG - Intronic
1139469259 16:67169677-67169699 GGCCTTGGGAGGCCCAGCCCTGG + Exonic
1139696392 16:68678315-68678337 GGCCTTTGGATGGGGGTCCCTGG - Intronic
1139954378 16:70686207-70686229 GGGCTTTGAAATCCGAGCCCGGG + Intergenic
1140256953 16:73345863-73345885 GCCCTAGGGAAGCAGGGCCCTGG - Intergenic
1140478540 16:75250833-75250855 CGCCGGTGGAAGCCGGGTCCTGG - Intronic
1143295590 17:5869288-5869310 GCCCTGTGGAAGCCAAGCCCTGG - Intronic
1143714283 17:8755958-8755980 GTCCTTTGGAATCCAGGCCCTGG - Intronic
1143736818 17:8916786-8916808 TGCCTTGGGAAGCTGGACCCAGG - Intronic
1146398987 17:32488881-32488903 GGCCTCTGGCTGCCTGGCCCAGG + Exonic
1146685850 17:34841161-34841183 GGGCTTTGGAAGCTGGGCTTAGG - Intergenic
1146923721 17:36730162-36730184 GGCATTTCCAAGCCTGGCCCAGG - Intergenic
1147156241 17:38545732-38545754 AGCCTCTGGGAGCCGGGCTCAGG + Intronic
1147165307 17:38589966-38589988 AGTCTTTGGAAGCCAGGGCCTGG + Intronic
1150138477 17:62709188-62709210 GGCATTTGTCAGCCGGGCACGGG + Intronic
1150622492 17:66818640-66818662 GGCCTTTGCAAGCCCAGCCCTGG + Intergenic
1152309433 17:79540599-79540621 TGCTTTTGGAAGCAGGGCCCGGG - Intergenic
1152399063 17:80053307-80053329 GGCCTCTTGAGGCCGGGCCTGGG + Intronic
1152579192 17:81158593-81158615 GGCCTGTGGGAGCCAGGCTCGGG - Intronic
1152637528 17:81436210-81436232 GGCCTTTGGTCTTCGGGCCCTGG + Intronic
1152737543 17:82004799-82004821 GGCCTTTGGAAGCCGGGCCCAGG + Intronic
1154324775 18:13381987-13382009 GGCCTGTGGATGCCGATCCCTGG - Intronic
1155517635 18:26639357-26639379 GGGCTCCCGAAGCCGGGCCCAGG + Intronic
1156530829 18:37813563-37813585 GGCCTTTGGACTCCGGGACTTGG + Intergenic
1157794213 18:50559960-50559982 GGCGCTGGGGAGCCGGGCCCTGG - Intergenic
1160662316 19:306822-306844 AGCCTATGGCAGCCGGGCCCGGG + Intronic
1160778141 19:866127-866149 GACCTTGGGAAGCCGGGGGCGGG + Intergenic
1161810308 19:6467648-6467670 GGCTTTGGGAGGCCGGGCTCTGG + Exonic
1162952759 19:14081721-14081743 GCCCTTTGGAAGGCGAGGCCGGG + Exonic
1163503252 19:17688310-17688332 GGCCGGTGGCGGCCGGGCCCCGG - Intronic
1163712101 19:18852919-18852941 GGCATGTGGAGGCCAGGCCCGGG + Intronic
1164211030 19:23097496-23097518 TGCCTTTTGAAGGCGGGGCCAGG - Intronic
1165152978 19:33771783-33771805 GGCCTTTGGGTGCCGGGCCAGGG + Intronic
1167079657 19:47270562-47270584 GGGCTTCGGGGGCCGGGCCCAGG - Exonic
1167698259 19:51027308-51027330 GGCCTGTGGAAGCCGAGTCCAGG + Intronic
927246063 2:20958048-20958070 GGCCTCGGGAAGAAGGGCCCCGG + Intergenic
930106970 2:47647977-47647999 GGGCTTTGGAAGCCAGGCAGTGG + Intergenic
932453773 2:71833028-71833050 GCCCTTGGGAAGCAGGGCCTTGG + Intergenic
932568579 2:72924748-72924770 GAGCTTTGGGAGCCGGGCTCGGG - Intronic
934098125 2:88626762-88626784 GGCCCTCGGGAGCCGAGCCCAGG + Intronic
934531089 2:95089546-95089568 GGTGATTGGGAGCCGGGCCCAGG + Intronic
935172367 2:100620458-100620480 AGCCATTGAAAGCCGTGCCCTGG - Intergenic
935627577 2:105184112-105184134 AGGCTGTGGAGGCCGGGCCCAGG - Intergenic
937289415 2:120773265-120773287 GGCCTGTAGCATCCGGGCCCGGG + Intronic
948453164 2:238091243-238091265 GGCCTTGGGAAGGTGAGCCCTGG + Exonic
948716221 2:239865325-239865347 GTTCTGTGGGAGCCGGGCCCGGG - Intergenic
949047753 2:241879870-241879892 GGCCATAGGATGCCTGGCCCTGG - Intergenic
1172274190 20:33670858-33670880 GGCCTTTGGGACCCTGGACCTGG - Intronic
1174087021 20:48016622-48016644 GGCCTTTGGAGGACTTGCCCTGG - Intergenic
1175846301 20:62060734-62060756 GGCCTTTGGAGGCCTGGACCTGG - Intronic
1175914812 20:62420895-62420917 GGCCTTTGCAGGCTGGGCCTGGG + Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1180145361 21:45915697-45915719 GCCCTTTGAGAGCTGGGCCCTGG + Intronic
1180971168 22:19816489-19816511 GGCATTTAGAAGCCAGGACCTGG + Intronic
1181049268 22:20231040-20231062 GGCCTGGGGAAGCTGGGCCCAGG - Intergenic
1181414012 22:22746436-22746458 GGCATTTGGGACCCTGGCCCTGG + Intronic
1182549096 22:31091427-31091449 GGCCTGTGGAGGCCTGGCCACGG - Exonic
1182585861 22:31344076-31344098 GGCCTGAGGAATCCGGCCCCAGG + Intronic
1183525362 22:38319381-38319403 GGCTTTGGGAAGCAGGGCCCAGG - Intronic
1183654709 22:39177809-39177831 GGTCCTTGGGAGCAGGGCCCTGG - Intergenic
1184130840 22:42515578-42515600 GGTTTTTGGAAGCCAGGCCTGGG + Intronic
1184141016 22:42577408-42577430 GGTTTTTGGAAGCCAGGCCTGGG + Intergenic
1184603054 22:45554767-45554789 TGCCTGAGGAAGCAGGGCCCAGG - Intronic
1185317784 22:50186263-50186285 GGTCGTTGGGGGCCGGGCCCGGG + Intronic
950017846 3:9766927-9766949 GGGTTTTGGAAGCCAGGCCAGGG - Intronic
950076692 3:10192415-10192437 GGCCTTTGGCTGACGGGGCCTGG - Intronic
950156770 3:10726900-10726922 GGCCTCTGGAGGCTGGGCTCTGG + Intergenic
953907259 3:46874561-46874583 GGCCTCTGGAACGCGTGCCCGGG + Intronic
953982662 3:47420419-47420441 GGCCCCTGGAAGCCTGGCTCTGG - Intronic
954318172 3:49812574-49812596 GGCCTGTGGAAGGCAGGTCCAGG - Intronic
954356450 3:50085996-50086018 GGCCTTTGGCAGCAGAGCTCTGG + Intronic
954397381 3:50299841-50299863 GCCCTTTGGATACCGGGGCCTGG + Intergenic
954422292 3:50425074-50425096 GCCCTGTGGAAGCATGGCCCTGG - Intronic
954783983 3:53079976-53079998 GGCCTTGGAAAGCCGAGACCAGG + Intronic
962707486 3:138059401-138059423 TGACTTTGGCAGCCTGGCCCTGG - Intergenic
967259190 3:187625322-187625344 GGCATTTGGAGGCAGGGCCTTGG + Intergenic
968132138 3:196198104-196198126 GGGCGTTGGAAGCAGGGCCCAGG - Intronic
968607018 4:1540332-1540354 GGCCTGGGGAAGCCAGGCCCCGG + Intergenic
968977384 4:3829087-3829109 AGCTTGTGGAAGCAGGGCCCTGG - Intergenic
969434831 4:7182854-7182876 GGCCTTTGGAAGTGGTGACCAGG - Intergenic
969957890 4:10910669-10910691 GGAATTTGGAGGCCTGGCCCTGG - Intergenic
973969190 4:56194216-56194238 GGCATTTGTAAGCCAGGCCCAGG + Intronic
978953984 4:114593790-114593812 GGCATTTGTAAGGCAGGCCCAGG - Intergenic
981566625 4:146108376-146108398 AGTCCTTGGAAGCCTGGCCCAGG + Intergenic
986712756 5:10499696-10499718 GTGCTTAGGAAGCTGGGCCCAGG + Intergenic
997848338 5:137308520-137308542 GTCCTTTGGAACCGGGGCCCTGG - Intronic
1001655086 5:173343199-173343221 GCCCTTTGGATGCCAGGCCTCGG + Intergenic
1001701015 5:173706432-173706454 GGCCTGGGGAAGCTGGGCCCTGG - Intergenic
1002133459 5:177094890-177094912 GCCAGTTGGAAGCCAGGCCCTGG + Intronic
1002348294 5:178563298-178563320 GGCCTTTGGAAGCTGGGGGCTGG - Intronic
1003212508 6:4079597-4079619 GGCCTCTGGGACCCGGGGCCCGG + Exonic
1003515117 6:6811438-6811460 GTGATTTGGAAGCCGGGCCAAGG + Intergenic
1003768720 6:9272161-9272183 GGGCTTTGGAATCAGGACCCGGG + Intergenic
1004547119 6:16608587-16608609 GGCATTTGGCAGCTGGGGCCTGG - Intronic
1007631426 6:43275419-43275441 GGCCTTTGGGTCCCTGGCCCCGG + Intronic
1008964274 6:57298523-57298545 GGCCCTGGGAAGCAGGGCTCGGG + Intergenic
1009513842 6:64588523-64588545 GGCCTTTGGAAGTAGGACACAGG - Intronic
1013349231 6:109290680-109290702 GGCCTCTTGGAGCCTGGCCCCGG + Intergenic
1018119080 6:160617711-160617733 GGCCTTTGGCTTCCGGGCCATGG + Intronic
1018119683 6:160623257-160623279 GGCCTTTGGCTTCCGGGCCATGG + Intronic
1018120284 6:160628801-160628823 GGCCTTTGGCTTCCGGGCCATGG + Intronic
1018121482 6:160639894-160639916 GGCCTTTGGCTTCCGGGCCATGG + Intronic
1018122084 6:160645441-160645463 GGCCTTTGGCTTCCGGGCCATGG + Intronic
1018700356 6:166421524-166421546 GGCCTATGGAGGCTGGTCCCAGG - Intronic
1018742550 6:166741690-166741712 GGCCCTTGAAGGCGGGGCCCTGG - Intronic
1018900954 6:168051490-168051512 TGCCTTTGTAAGGGGGGCCCTGG + Intergenic
1019157795 6:170050732-170050754 GGGCTGAGGAAGCCAGGCCCTGG + Intergenic
1019381664 7:727324-727346 GGCGTGTGGGAGCGGGGCCCGGG - Intronic
1020157817 7:5741187-5741209 GGCCTTGGAAAAGCGGGCCCTGG + Exonic
1020251769 7:6474881-6474903 CGCTTTGGGAAGCTGGGCCCAGG - Intronic
1032261028 7:130337503-130337525 GGCCTTTGGAAGCTCTGCACAGG + Intergenic
1034155668 7:148954572-148954594 AGCCCCTGGAAGCCAGGCCCAGG + Intergenic
1034263581 7:149771636-149771658 GGCCTTGGGCAGCCCGGCACGGG - Intronic
1034317253 7:150143933-150143955 GGCCCTAAGAAGCCTGGCCCAGG - Intergenic
1034386818 7:150747325-150747347 GGACTTAGGGAGCCAGGCCCTGG - Intronic
1034424447 7:151007243-151007265 GGCCTTCCGAGGCTGGGCCCAGG + Exonic
1035204941 7:157289222-157289244 GACATTTGGAAGCAAGGCCCAGG + Intergenic
1039921154 8:41895644-41895666 TTCCTTTGGAAGCCAGGCACGGG - Intronic
1041449091 8:57988651-57988673 GACCTTTGGAAGTCGTTCCCTGG + Intergenic
1041872618 8:62652139-62652161 GGCATTTGGAAGTGGGGCCTTGG - Intronic
1042611745 8:70608010-70608032 GGCATCTGGAGCCCGGGCCCGGG + Intronic
1043441271 8:80279016-80279038 GGACCTTGGAAGCCCGTCCCTGG + Intergenic
1048331545 8:133474054-133474076 GGTCTTTGGAAGCATAGCCCAGG + Intronic
1049696238 8:143985569-143985591 GGCCTGGGGAACCCGGGCCAGGG + Exonic
1049762323 8:144337028-144337050 GGGCTCTGGAGGCCGGGCCCAGG - Intergenic
1049847545 8:144810406-144810428 AGCCATGGGAAGCCTGGCCCTGG + Intronic
1051800180 9:20923820-20923842 GGCTTTAGGTAGCCTGGCCCTGG + Intronic
1053523384 9:38804750-38804772 AGCCTTTGGCTGCCTGGCCCTGG + Intergenic
1054195613 9:62029169-62029191 AGCCTTTGGCTGCCTGGCCCTGG + Intergenic
1054642794 9:67559520-67559542 AGCCTTTGGCTGCCTGGCCCTGG - Intergenic
1059111565 9:111562748-111562770 GGCCTGTGGAAGCCGGGGTGAGG - Intronic
1061231761 9:129319672-129319694 GGCCCGTGGAGGCCGGGGCCGGG + Intergenic
1062367766 9:136219551-136219573 GGCATCTGGAAGTCGGGGCCTGG + Intronic
1062468629 9:136692400-136692422 GGCCTGTGGCACCCAGGCCCCGG - Intergenic
1189325367 X:40108208-40108230 ACCCTCAGGAAGCCGGGCCCGGG - Intronic
1198534706 X:137574521-137574543 GGCCTTTTCAAGCCGCGGCCGGG + Intronic
1199566151 X:149217488-149217510 GGCCTTGGGTAGCTTGGCCCCGG - Intergenic