ID: 1152737560

View in Genome Browser
Species Human (GRCh38)
Location 17:82004866-82004888
Sequence CTGGTGAAGGCACTGGTGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152737548_1152737560 27 Left 1152737548 17:82004816-82004838 CCCAGGCAGTGAGGCGGAAACCA 0: 1
1: 0
2: 0
3: 5
4: 148
Right 1152737560 17:82004866-82004888 CTGGTGAAGGCACTGGTGTCCGG 0: 1
1: 1
2: 3
3: 25
4: 231
1152737554_1152737560 7 Left 1152737554 17:82004836-82004858 CCAGGCTGGGCTCAGCATGGCGA 0: 1
1: 0
2: 0
3: 24
4: 252
Right 1152737560 17:82004866-82004888 CTGGTGAAGGCACTGGTGTCCGG 0: 1
1: 1
2: 3
3: 25
4: 231
1152737549_1152737560 26 Left 1152737549 17:82004817-82004839 CCAGGCAGTGAGGCGGAAACCAG 0: 1
1: 0
2: 0
3: 15
4: 153
Right 1152737560 17:82004866-82004888 CTGGTGAAGGCACTGGTGTCCGG 0: 1
1: 1
2: 3
3: 25
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152737560 Original CRISPR CTGGTGAAGGCACTGGTGTC CGG Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900327118 1:2113834-2113856 GAGGTCAAGGCACTGGTGTTGGG + Intronic
900497354 1:2982086-2982108 GTGGTGCAGGCTCTGGAGTCAGG - Intergenic
901008562 1:6184097-6184119 CTGTTGAAGTCATTGATGTCAGG - Intronic
901836146 1:11925537-11925559 CTGGTGAAGGCCTTGGGGGCTGG + Exonic
902388622 1:16089945-16089967 GAGGTGCAGGCACTGGGGTCAGG + Intergenic
902393621 1:16120271-16120293 GAGGTGAAGGCAGTGGTGACTGG - Intergenic
903780358 1:25816554-25816576 CTGGAGAAGGCTGTGGTGTTTGG - Exonic
904769541 1:32872998-32873020 CTGGGGAAAGCCCTGGTGCCTGG + Intergenic
905205637 1:36341410-36341432 CTGGGGAAGGCCCTGGAGTGGGG + Exonic
905513414 1:38542624-38542646 CTGCTGAAGGCCCTGCTGGCAGG + Intergenic
907257946 1:53194358-53194380 CTGGGGATGGCCCTGGGGTCTGG - Intergenic
907321211 1:53603576-53603598 CTTGTGAAGTCACTGGGGACAGG - Intronic
907725303 1:57015134-57015156 CTGGTGGAGTCACTCGTGCCTGG + Exonic
910857353 1:91708819-91708841 CTGGTGAAGGCACTTTTGAGTGG - Intronic
912023664 1:105139059-105139081 TTGATGATGGCAGTGGTGTCAGG - Intergenic
912696160 1:111843631-111843653 CTGATGCAGGCATTGGTGCCAGG + Intronic
912881664 1:113422661-113422683 CTGCTGCGGGCACTAGTGTCTGG + Intronic
913979173 1:143493067-143493089 TTGGTGAAGGCACTTGGGCCTGG + Intergenic
914073577 1:144318717-144318739 TTGGTGAAGGCACTTGGGCCTGG + Intergenic
914105578 1:144647643-144647665 TTGGTGAAGGCACTTGGGCCTGG - Intergenic
914392638 1:147236178-147236200 CTGGAGAATGCAGTGGTGCCTGG + Intronic
915657190 1:157370923-157370945 CTGGTGGAGGCACGTGTGTTGGG - Intergenic
918147941 1:181774430-181774452 CTGGTTAAGCCACTGTTATCTGG - Intronic
918380985 1:183955003-183955025 CTGGTCAGGGCACTGGTTTCAGG + Intronic
919655578 1:200194181-200194203 CTGATGAAGGTAATAGTGTCTGG - Intergenic
923612284 1:235505317-235505339 GCGGTGAAGGCACTGGGGTGAGG + Intergenic
924404741 1:243730809-243730831 CTGGTGCAGGTGCTGGTGTCTGG - Intronic
1066188969 10:33037768-33037790 CTGCTGCAGGCACCAGTGTCTGG - Intergenic
1069102292 10:64336932-64336954 TTGGTGAAGTTACTGTTGTCAGG + Intergenic
1072709605 10:97707468-97707490 CTGGTGAAGGCATTTGACTCTGG - Intergenic
1074116527 10:110460751-110460773 CGGATGAAGGCAGTGCTGTCAGG - Intergenic
1074720889 10:116264227-116264249 CAGGTCATGGCACTGGTGTAGGG - Intronic
1075125375 10:119694951-119694973 CTGCTGCAGGCACCCGTGTCTGG + Intergenic
1075888385 10:125923041-125923063 TTGGTGAAGGCACTTGGGCCTGG + Intronic
1076271116 10:129152942-129152964 CAGGTGAAGGCACAGGTGTCTGG - Intergenic
1076292992 10:129361853-129361875 TTAGTGAAGGCACTCGTGTGTGG - Intergenic
1076802898 10:132840076-132840098 CTGGTGAAGCCAGTGGGGTCTGG + Intronic
1077076206 11:703330-703352 CTGCTGGAGGCCCTGGTGTTGGG + Exonic
1077229289 11:1451396-1451418 CTGGGGACGACTCTGGTGTCAGG - Exonic
1078666907 11:13333413-13333435 CTGGTGGTGGCAGTGGTGACAGG - Intronic
1079237711 11:18701650-18701672 CTGGTGATGGCAGCGCTGTCGGG + Exonic
1080596691 11:33779427-33779449 CTGGGGAAGCCACTGGTATATGG + Intergenic
1081377192 11:42373952-42373974 ATGATGATGGCTCTGGTGTCTGG + Intergenic
1082160163 11:48881772-48881794 GTTGTGAAGGCACTGGTCTGGGG + Intergenic
1082162203 11:48898634-48898656 GTTGTGAAGGCACTGGTCTGGGG - Intergenic
1084176366 11:67424434-67424456 CTGGAGGAGGCCCTGGTGCCTGG + Exonic
1086970974 11:93080451-93080473 CTTGTGCAGGCACTGGTGCCTGG - Intergenic
1088591644 11:111408500-111408522 CAGGTGAGGACACTGATGTCAGG - Intronic
1088700038 11:112403503-112403525 CTGGTGAAGGCAATGGGGTCAGG - Intergenic
1089245756 11:117118463-117118485 TTGGTGAAGGCCCTGGTGGTAGG - Intergenic
1090419053 11:126561537-126561559 CTTGTCAAGGCAGTGGTGTTGGG + Intronic
1093077816 12:14775098-14775120 CTGGAGCAGGCACTGGTGGGTGG + Intronic
1093903785 12:24665411-24665433 CTGGTGTGGGCTATGGTGTCTGG - Intergenic
1094391271 12:29953089-29953111 CTGATTAAGGAACTGGAGTCAGG - Intergenic
1095494333 12:42769035-42769057 ATGGTGAAGTCAGTGGTGCCAGG + Intergenic
1096294958 12:50376094-50376116 CTGCTGCAGGCACCAGTGTCTGG + Intronic
1096578891 12:52571821-52571843 CTGGTGAGGGGGCTGGTGCCTGG - Intronic
1097450623 12:59733511-59733533 CTGGGGAATGCAGTGGTGCCTGG + Intronic
1097603096 12:61719433-61719455 CAGGTGGAGCCATTGGTGTCAGG - Intronic
1097766947 12:63536762-63536784 CTGCTCAAGGCACTGGTATTAGG + Intergenic
1098605886 12:72389368-72389390 ATGGTGAAGGATCTGTTGTCTGG + Intronic
1101580795 12:106039573-106039595 CTGCTGCAGGCACCAGTGTCTGG + Intergenic
1101794146 12:107957326-107957348 GTGGAGGAGGCAGTGGTGTCAGG + Intergenic
1102122398 12:110451792-110451814 GTGGGGAAGGCACTGGAATCGGG + Intergenic
1103139831 12:118538863-118538885 GAGGTGAAGGCACTTGTTTCAGG - Intergenic
1104280442 12:127371906-127371928 CTGGTGGTGGCACTGGTGTGGGG - Intergenic
1104646915 12:130504216-130504238 CTGGTGAAGAGCCTGGTGACCGG - Intronic
1104948846 12:132429631-132429653 CTGGGGGAGCCACTGGTGTCAGG + Intergenic
1105220157 13:18318333-18318355 TTGGTGAAGGCACTTGGGCCTGG - Intergenic
1108583344 13:51846007-51846029 CTGGGGGAGGGACTGGTGTGAGG + Intergenic
1109279160 13:60336283-60336305 CTGGTGAAGGCACTAATATAGGG + Intergenic
1110201241 13:72852283-72852305 CCGGGGAATGCAGTGGTGTCCGG - Intronic
1118521926 14:66595664-66595686 CTGGGGTAGGCAGTGGTGCCTGG + Intronic
1119360853 14:74048394-74048416 GTGGTGATGCCACTGATGTCAGG - Intronic
1119587315 14:75848539-75848561 TTGTTGAATGAACTGGTGTCAGG + Intronic
1121779224 14:96611264-96611286 ATGGTGAAAGCACAGGTGGCAGG - Intergenic
1121985331 14:98500005-98500027 CTGGTGAAAGAACAGGAGTCGGG + Intergenic
1122152727 14:99733442-99733464 CTGGTGAAGGAACTGAGGTCAGG - Intergenic
1123162626 14:106293943-106293965 CTGAGGAAGGCACAGGTGTGGGG + Intergenic
1125714989 15:41814584-41814606 AAGGTCAAGGCAATGGTGTCTGG - Exonic
1125726520 15:41871095-41871117 CAGGGGAAGGCCCTGATGTCTGG + Intronic
1129386581 15:75199647-75199669 CAGGAGAAGTAACTGGTGTCTGG + Intronic
1132142763 15:99408684-99408706 CTGGTGAAGGGCCTGGAGCCTGG - Intergenic
1132515926 16:366086-366108 CACATGAAGGCACTGGTGTGGGG + Intergenic
1133404241 16:5510223-5510245 CTGCTGAAGCCACTGAGGTCTGG - Intergenic
1134078331 16:11307995-11308017 CTGGGGAATGCATTGGTGCCTGG + Intronic
1134103720 16:11470751-11470773 CTGGCGAAGTCATTGGTGTAGGG + Intronic
1134531780 16:14989460-14989482 CTGGTGAAGGCCTTGGGGGCTGG + Intronic
1135134686 16:19878923-19878945 CTGGTGGAAGCACTGGTGGCTGG - Intronic
1135588892 16:23691361-23691383 CTGGTGAGGGCACTGGAGGCGGG - Exonic
1136514932 16:30762358-30762380 CTGGTGAGGGCTCTGGCGCCGGG + Exonic
1136933699 16:34439559-34439581 CTGGTGGAAACACTGGGGTCCGG - Intergenic
1136970873 16:34972255-34972277 CTGGTGGAAACACTGGGGTCCGG + Intergenic
1137588744 16:49680585-49680607 CTGGGGAATGCAGTGGTGTCCGG - Intronic
1137618483 16:49860064-49860086 CTGGTGAATGCACGAGGGTCTGG + Intergenic
1137664834 16:50244126-50244148 CTGGTGAAGGCACACATGGCTGG - Intergenic
1138627833 16:58266595-58266617 TTGGTGCAGGGACTGGTGCCTGG + Intronic
1141628207 16:85272601-85272623 CTGGAGAAGCCACGGGTGTGCGG + Intergenic
1141931557 16:87208018-87208040 CTGGTGATGGCAGAGGTGCCTGG - Intronic
1142249196 16:88983360-88983382 CTGGGGAAGGCCCTCCTGTCCGG - Intergenic
1142740796 17:1930822-1930844 CTGCTGAAGGCAGGGGAGTCTGG - Intergenic
1143103319 17:4515673-4515695 TTGGGGAAGGCACAGGTGCCTGG - Intronic
1144872520 17:18379998-18380020 CTGGTGAAGGCACAGCAGTCTGG - Intronic
1146567895 17:33929040-33929062 CTGGTTAAGGCAGTGCTATCTGG - Intronic
1146802965 17:35842010-35842032 CTGGGGAAGGAGATGGTGTCAGG - Intronic
1147603863 17:41762969-41762991 CTGGTCAAGGTACTGCTGTTAGG - Exonic
1147614913 17:41822060-41822082 CTGGGAAAGGCACTGGTGCTGGG - Intronic
1148167086 17:45490943-45490965 GAGGCGAAGGCACCGGTGTCAGG + Intergenic
1150446903 17:65233129-65233151 CTGGTACTGGCACAGGTGTCAGG + Intergenic
1151748732 17:76025024-76025046 CTGGTGAAGGCACAGCAGTCTGG + Intronic
1152737560 17:82004866-82004888 CTGGTGAAGGCACTGGTGTCCGG + Intronic
1152802853 17:82339944-82339966 CTGGGGGAGGCACTGGTGAGAGG - Intergenic
1153427884 18:4986988-4987010 CTGGGGAATGCAGTGGTGCCTGG + Intergenic
1153776385 18:8458045-8458067 CTGGTGAAAGGCCTGGTGACTGG + Intergenic
1159466778 18:68794099-68794121 CTGGTGAAGCCACTGTCATCAGG - Intronic
1159976235 18:74715457-74715479 GTGGTGGAGGCGCTGGTGACTGG + Intronic
1160381189 18:78457370-78457392 CTGGTAGAGACATTGGTGTCAGG - Intergenic
1160770912 19:830685-830707 CTGGGGAAGGAAATGGAGTCAGG - Intronic
1160901424 19:1430497-1430519 CAGGTGAAGGGCCTGGTGGCAGG - Intronic
1162057855 19:8075445-8075467 CTGGTTAAGGAACTCGTGTCAGG + Intronic
1163161258 19:15465459-15465481 CTTTTGGAGGCACTGGTGGCTGG + Intergenic
1164210472 19:23093607-23093629 ATGGCTGAGGCACTGGTGTCTGG + Intronic
1164640772 19:29824000-29824022 CGGGAGCACGCACTGGTGTCTGG - Exonic
1165781240 19:38435288-38435310 CTGGTGAAGGCAATGGGGCTGGG - Intronic
1166041756 19:40207319-40207341 CTGCTTAAGGCACTGCTTTCTGG - Intronic
1166283802 19:41811343-41811365 CCTGAGAAGACACTGGTGTCTGG + Exonic
1166690809 19:44820525-44820547 CTGGTAATGGCACTGGGGTTAGG - Intronic
1167494192 19:49808477-49808499 CTGGTGAAGGCTCTGCTGGGAGG + Exonic
925574880 2:5350041-5350063 CTGGTGAGGGCTGTGATGTCTGG + Intergenic
926777080 2:16433319-16433341 CTGGTGAAGGCCCAGGTGCCAGG + Intergenic
927713387 2:25339413-25339435 CTATGGAAGGCACTGGTGCCTGG + Intronic
928823396 2:35391056-35391078 CTGCTGCAGGCACCCGTGTCTGG + Intergenic
930234829 2:48878496-48878518 CTAGCGAAGGCACTGCTGTTTGG + Intergenic
932317148 2:70792382-70792404 CTGGTCAAGGTGGTGGTGTCAGG + Intergenic
932774506 2:74519569-74519591 CTTCAGAAAGCACTGGTGTCAGG - Exonic
933869747 2:86554138-86554160 CTGGTGAGGGCACTGCTTTTTGG - Intronic
934183889 2:89654149-89654171 TTGGTGAAGGCACTTGGGCCTGG + Intergenic
934294179 2:91728319-91728341 TTGGTGAAGGCACTTGGGCCTGG + Intergenic
935130652 2:100258576-100258598 CTGGGGACGGCATTGGTGTAGGG + Intergenic
935782695 2:106521876-106521898 CCTGTGAAAACACTGGTGTCTGG + Intergenic
935855942 2:107274044-107274066 CTGGTAATGTCACTGGTGCCCGG - Intergenic
936593839 2:113829044-113829066 ATGGTGTAGGCATTGGTTTCTGG + Intergenic
937179758 2:119983146-119983168 CTGTTGAAAGGATTGGTGTCAGG + Exonic
937246489 2:120497306-120497328 CTGGTGAAGCCGCTGGGCTCTGG + Intergenic
937941809 2:127292037-127292059 CTGGTGAAGGCTCTTGTCTATGG + Intronic
939863136 2:147442789-147442811 CTTGTCAATGCACTGGAGTCTGG + Intergenic
940103511 2:150070332-150070354 ATGATGATGGCACTGGTGTCTGG - Intergenic
944367769 2:198944430-198944452 CTTGTGATTGCAGTGGTGTCTGG - Intergenic
945837305 2:214848359-214848381 CTGGTGAAGGAACTAATGTGAGG + Intergenic
947734493 2:232447663-232447685 CTGGAGAAGGCAGTGGGGCCCGG - Intergenic
948282979 2:236762668-236762690 TTGGTGAAGGCACTGGTGTCTGG + Intergenic
1170737337 20:19023234-19023256 CTTGTTAAGGCACAGGTGGCTGG - Intergenic
1171181682 20:23095448-23095470 CCGATGAAGAGACTGGTGTCTGG - Intergenic
1171470963 20:25370970-25370992 ATGGTGAAGGGCCTGGTGTGTGG - Intronic
1172007430 20:31826987-31827009 CTGGTGACAGCACTGATCTCAGG - Intronic
1172195599 20:33089584-33089606 CTGGGGAAGGCACTGAGGACCGG + Intronic
1173541377 20:43854184-43854206 CTGGTGAAGGCACTAGTCAGTGG - Intergenic
1174295160 20:49540442-49540464 CTGGTGCAGGCACTGGAGCCGGG + Intronic
1174535126 20:51245475-51245497 CTGGTGAAGGACCTGCTTTCTGG - Intergenic
1175596504 20:60238979-60239001 CTGGTGAGGGCCCTGGCTTCTGG - Intergenic
1176411664 21:6452455-6452477 CTGGGGTGGGCACTGGTGCCAGG + Intergenic
1178244507 21:30937663-30937685 CTAGTGATGGCACTGATGGCTGG + Intergenic
1179687158 21:43060777-43060799 CTGGGGTGGGCACTGGTGCCAGG + Intronic
1181175472 22:21032452-21032474 CAGGCGAAGGCGCAGGTGTCCGG - Intronic
1182155702 22:28071020-28071042 CTTGAGGAGGCCCTGGTGTCAGG + Intronic
1184235966 22:43183192-43183214 GTGGTGAAGGCATTGGGGTGGGG - Intronic
1184253333 22:43273296-43273318 CTGGTCAAGGCCCTGGGGTGGGG - Intronic
1184493349 22:44823284-44823306 CTGGGGAGGGGACTGGTGTGTGG + Intronic
1185139971 22:49094795-49094817 CTGGTGAAGTCTCTGCTCTCTGG + Intergenic
950767476 3:15283957-15283979 CTGGTGAAGGCACTGGTCCAAGG + Intronic
950950345 3:16992282-16992304 AGGGTGAAGGCACTGATGGCTGG - Intronic
952953939 3:38545086-38545108 CTGCAGAGGGCACTGCTGTCAGG + Intergenic
953188486 3:40661159-40661181 CTGCTGAAGGCAGTGGGGTGGGG - Intergenic
953206809 3:40838420-40838442 CTGGTGAAGCCATGGGGGTCAGG - Intergenic
954965228 3:54604610-54604632 CTCTTGAAGGCACAGGTGACAGG - Intronic
954965452 3:54606481-54606503 CTCTTGAAGGCACAGGTGACAGG + Intronic
955516047 3:59727389-59727411 TTGGTGATGGTACTGGGGTCTGG + Intergenic
956173087 3:66448287-66448309 CTTGGGAGGGCTCTGGTGTCTGG + Intronic
957646809 3:82940160-82940182 CTGCTGAGGGCACCAGTGTCTGG - Intergenic
959619687 3:108386506-108386528 ATAGTGAAGTCACTAGTGTCTGG + Intronic
959897195 3:111617971-111617993 CTGCTGCAGGCACTGGTGTCTGG - Intronic
960732481 3:120742470-120742492 CGGGTGAAGGTACTGGTGTTGGG - Exonic
965917332 3:173866091-173866113 CTGATGAAAGAACAGGTGTCAGG - Intronic
965943250 3:174210463-174210485 CTGGTGTTGGCAATGGTGGCAGG + Intronic
966291931 3:178369613-178369635 AAGATCAAGGCACTGGTGTCTGG + Intergenic
966307936 3:178557923-178557945 GAGCTGAAGGCACTGGTGTGGGG - Intronic
966926111 3:184645652-184645674 CTGGTGTAGGCCCTGGGGTGGGG - Intronic
966938069 3:184727065-184727087 CTGGTCAAGGCACTGGGGTGAGG - Intergenic
967038118 3:185663299-185663321 GTGGTGAAGGCACTCCTGCCAGG + Intronic
967351349 3:188517233-188517255 CTGGTGAAAGCTTTGGAGTCAGG - Intronic
967990374 3:195125892-195125914 CTGTTGAGGGCAGTGTTGTCTGG - Intronic
969132666 4:5003215-5003237 CACCTGAAGGCACAGGTGTCTGG - Intergenic
969490510 4:7496829-7496851 CTGGGGAAGGCACAGGGCTCCGG + Intronic
973634321 4:52847931-52847953 CTGGCCCAGGCCCTGGTGTCTGG + Intergenic
974615348 4:64272509-64272531 CTGCTGCAGGCGCTGGGGTCTGG - Intergenic
977451937 4:97209993-97210015 ATGGTGATGGCAATGGTGTGTGG + Intronic
981455851 4:144952454-144952476 GTGGTAGTGGCACTGGTGTCTGG - Intergenic
983237912 4:165200588-165200610 CTTGTGAAGACTCTGTTGTCTGG + Intronic
984638484 4:182140202-182140224 CCTGTGAAGGCACTTGTGTAAGG + Intergenic
985572600 5:657523-657545 CTGGTGAAGTCACTTGTGCCTGG + Intronic
985577153 5:678732-678754 GTGGTGGGGGCACCGGTGTCAGG + Intronic
985948288 5:3203504-3203526 CTGGTGGAGGCACTGGCATTAGG - Intergenic
986743864 5:10727363-10727385 CTGATGAAGGCAGGGCTGTCAGG + Intronic
987441879 5:17966956-17966978 CTGCTGCAGGCACTAGTGTCTGG + Intergenic
989705323 5:44322914-44322936 CCGGTGAAGGAGATGGTGTCAGG - Intronic
991956275 5:71998550-71998572 CTGGTGAAGCCCATGGTGGCAGG + Intergenic
994246837 5:97488443-97488465 CTGCTGCAGGCACCTGTGTCTGG + Intergenic
997485943 5:134230821-134230843 CTGGTGATGCCCCTGATGTCTGG + Intergenic
997815239 5:137010599-137010621 CTGGTGAGGGAACTGGAGGCTGG - Intronic
998199039 5:140103995-140104017 CTTCAGAAGGCACTGGTGTCTGG + Intergenic
998233370 5:140376280-140376302 CTGGTGAAGCCACTGGGGCCTGG + Intergenic
1002817493 6:693740-693762 CAGGAGGAGGCACTGGGGTCCGG + Intergenic
1003439097 6:6122832-6122854 CTGCTGCAGGCACCAGTGTCTGG - Intergenic
1005681911 6:28216651-28216673 CTGCAGAAGGAACTGGTTTCCGG - Intergenic
1009477778 6:64115371-64115393 GTGGTGATGGCAGTGGTGTTTGG - Intronic
1009870767 6:69450197-69450219 CTGGGGAAGGTAGTGGTGCCTGG + Intergenic
1010582588 6:77617784-77617806 GTGGTGATGGCACTAGTGCCTGG + Intergenic
1014002456 6:116380045-116380067 TTGGTGAAGCCACTGATGTTTGG + Intronic
1017075858 6:150617721-150617743 CTGGTGAAGGCTCTCTTGCCTGG - Intronic
1018647643 6:165962843-165962865 CTGGTGAGGGCACAGAGGTCTGG - Intronic
1019157318 6:170048020-170048042 AAGGTGGCGGCACTGGTGTCTGG - Intergenic
1023638095 7:42233232-42233254 CTGCTAAAGGCAATGCTGTCTGG - Intronic
1024042336 7:45565184-45565206 CTGGTGAGGACACTGATATCAGG - Intergenic
1026627726 7:72011248-72011270 CTTGTGGAGGTACTGCTGTCTGG - Intronic
1029659781 7:101952456-101952478 CTGGTGAAGGCACAGGCGGCTGG - Intronic
1032192477 7:129772778-129772800 CGAGTGCAGGCACTGGTGTGGGG - Intergenic
1034487431 7:151374715-151374737 CAGGTAAAGTCACTGCTGTCTGG - Intronic
1035016826 7:155774045-155774067 ATGGTGAGGGCAGTGGTGCCTGG - Intronic
1037296115 8:17402402-17402424 CTGGGGAAGGTAGTGGGGTCTGG - Intronic
1037419852 8:18690610-18690632 CTGGTGCAGGCTCAGATGTCAGG - Intronic
1037607663 8:20450902-20450924 TTGTTGAAGTCACTGGTCTCTGG + Intergenic
1037868558 8:22468732-22468754 CTGTTGGAGGCATTGGTGACGGG + Intronic
1039260629 8:35767302-35767324 CTGGGGAAGGAACTGGTACCAGG + Intronic
1039437106 8:37567229-37567251 TTGGTGAAGCCACTGGTCTCAGG - Intergenic
1039785899 8:40833981-40834003 CAGGAGAAGGCAGTGGTGTGGGG - Intronic
1041440870 8:57895759-57895781 CTGGTGAAGTAACTGGAGACAGG - Intergenic
1042264187 8:66891913-66891935 CTACTGAGGGCCCTGGTGTCTGG + Intronic
1046830773 8:118743443-118743465 CTTGTGAAGCCACTTGTGTGTGG - Intergenic
1047492545 8:125386755-125386777 CAGGTGAAGGCACTGAGGTGCGG - Intergenic
1048871796 8:138804992-138805014 ATGGTGTAGGCAATGGTGTGTGG + Intronic
1049227588 8:141464861-141464883 CTGTTGAAGGTTCAGGTGTCTGG - Intergenic
1049428044 8:142545982-142546004 CTGGTGAGGACTCTGGGGTCAGG - Intergenic
1050335320 9:4584678-4584700 CTGGGGAAGAGACTGGTGGCAGG - Intronic
1050501421 9:6301888-6301910 CTAGTGAAGGCAGCAGTGTCAGG - Intergenic
1051148942 9:14060012-14060034 CTGGTGAGGGCCCTGGATTCTGG + Intergenic
1051544436 9:18258606-18258628 CTGGAGAAGGCACTGGCGGTGGG - Intergenic
1056209013 9:84347689-84347711 CCTGAGAAGGCACAGGTGTCGGG + Intergenic
1057001390 9:91513102-91513124 CTGAGGAAGGCACAGGTATCGGG - Intergenic
1057352894 9:94315506-94315528 GTGGTGAAGGGAGTGGTTTCTGG + Intergenic
1057654853 9:96942085-96942107 GTGGTGAAGGGAGTGGTTTCTGG - Intronic
1057810966 9:98256196-98256218 CTGGGGAGGCCACTGCTGTCAGG - Intergenic
1061226502 9:129283772-129283794 CTCGTGAAAGCACAGGTGGCTGG + Intergenic
1061686943 9:132288784-132288806 GTGGTGTAGTCCCTGGTGTCTGG - Intronic
1061826564 9:133261644-133261666 CTGACCAAGGCACTGGTGGCGGG - Intronic
1203734689 Un_GL000216v2:125509-125531 TTGGTGAAGGCACTTGGGCCTGG + Intergenic
1187987050 X:24825370-24825392 CTGGTAAAGACAGTGGTGTGTGG + Intronic
1190115398 X:47623264-47623286 ATGCTAAAAGCACTGGTGTCTGG + Intergenic
1200002929 X:153071558-153071580 CTGGTGAGGGCACAGGGGGCAGG + Intergenic
1200004794 X:153078451-153078473 CTGGTGAGGGCACAGGGGGCAGG - Intergenic
1200043180 X:153384576-153384598 CTGATGAAGGAACTGGTGGGTGG + Intergenic