ID: 1152737852

View in Genome Browser
Species Human (GRCh38)
Location 17:82006077-82006099
Sequence GCGTGTGCACGTGTGTGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 1, 1: 5, 2: 26, 3: 104, 4: 530}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152737848_1152737852 22 Left 1152737848 17:82006032-82006054 CCATGCTTGGGTGTTGTGTGCAT 0: 1
1: 0
2: 2
3: 19
4: 197
Right 1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG 0: 1
1: 5
2: 26
3: 104
4: 530
1152737849_1152737852 -3 Left 1152737849 17:82006057-82006079 CCTTGCGTGTGCGTGTCCTTGCG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG 0: 1
1: 5
2: 26
3: 104
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152737852 Original CRISPR GCGTGTGCACGTGTGTGCTT GGG Intronic
900137400 1:1123781-1123803 GTGTGTGCAGATGTGTGCTCAGG - Intergenic
900137401 1:1123803-1123825 GTGTGCGCAGGTGTGTGCTCAGG - Intergenic
900137404 1:1123861-1123883 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137409 1:1123918-1123940 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900137411 1:1123940-1123962 GTGTGTGCAGGTGTGTGCGCAGG - Intergenic
900137428 1:1124138-1124160 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137437 1:1124188-1124210 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900179995 1:1307134-1307156 ACGTGTGCACAAGTGTGCATCGG - Intronic
900295253 1:1945861-1945883 GTGTGTGCACGTGTGTGTGTGGG + Intronic
900353221 1:2247255-2247277 GTGTGTGCACAGGTGTGCATGGG + Intronic
900358736 1:2277689-2277711 GTGTGTGCACGTGTGCCCATGGG - Intronic
900358745 1:2277760-2277782 GTGTGTGCACGTGTGCCCATGGG - Intronic
900358752 1:2277844-2277866 GTGTGTGCACGTATGTCCGTCGG - Intronic
900358952 1:2278806-2278828 CTGTGTGCACGTGTGCGCATGGG - Intronic
900392021 1:2437834-2437856 GTGTGTGCACGTGTGTGGTTTGG - Intronic
900489176 1:2937957-2937979 GTGTGTGTACATGTGTGCATGGG - Intergenic
900526030 1:3129114-3129136 GAGTGTGCACGTGCGTGTGTGGG + Intronic
900560280 1:3301766-3301788 GTGTGTGCCCCTGTGTGCCTGGG - Intronic
900563694 1:3321663-3321685 GTGGGTGCACGTGTGTGTGTGGG + Intronic
900563724 1:3322217-3322239 GCATGTGCACGTGTGTGTGTGGG + Intronic
900577694 1:3391830-3391852 CCCTGTGCACGCCTGTGCTTGGG - Intronic
900593691 1:3470984-3471006 GCGTGGGCAGGGGTGTGCGTGGG + Intronic
900796262 1:4710446-4710468 GAGTGTGTACGTGTGTGACTGGG - Intronic
901205493 1:7492892-7492914 GTGTGTGCACGTGTGTATGTAGG - Intronic
901206038 1:7496463-7496485 GCGTGTGCACATGCGTGCCCAGG + Intronic
902291083 1:15435404-15435426 GTGTGTGCATGTGTGCGCGTGGG + Intergenic
902987565 1:20164420-20164442 GCGTGTGCATGTGTGTGTTTAGG + Intronic
903634746 1:24804372-24804394 GTGTGTGCATGTGTGTGGGTGGG + Intronic
905016850 1:34783700-34783722 GCCTGTCCACGTGTGTGTGTGGG - Intronic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
905300486 1:36983320-36983342 GCGTGTGGGAGTGTGTGCATGGG - Intronic
905347270 1:37319536-37319558 GTGTGTGCGCGTGTGTGCCTGGG + Intergenic
905446794 1:38032864-38032886 GCCTCTGCATGTGTGTGCATGGG + Intergenic
905887475 1:41499183-41499205 CCGTGTGTCCGTGTGTGCATAGG + Intergenic
906693699 1:47810162-47810184 GCGCGCGCACGTGTGTGTGTTGG + Intronic
906791937 1:48666513-48666535 GTGTGTGCACGTGCATGCTAAGG - Intronic
908432107 1:64069542-64069564 ACGTGTTCATGTGTGTGATTGGG + Intronic
909302768 1:74034621-74034643 GTGTGTGTCTGTGTGTGCTTTGG - Intronic
909687192 1:78363281-78363303 GGGTGTGCATGTTTGTACTTAGG - Intronic
910437325 1:87218539-87218561 GTGTGTACACGTGTGTGCACGGG - Intergenic
913244374 1:116858938-116858960 GTGTGCGCACGTGTGTGTGTAGG - Intergenic
913509558 1:119549556-119549578 GCTTGAGAAAGTGTGTGCTTGGG - Intergenic
913517040 1:119613685-119613707 GCTTGAGAAAGTGTGTGCTTGGG - Intergenic
914914623 1:151811548-151811570 GCGCGTGCATGTGTGTGCCTTGG + Intronic
916352810 1:163871066-163871088 GTGTGTGAATGTGTGTGCATAGG + Intergenic
916743943 1:167669978-167670000 GCGTGTGCGTGTGTGTCCTGAGG - Intronic
916945491 1:169722145-169722167 GCGTGTGTGCGTGTGTGTGTTGG + Intronic
921069784 1:211649436-211649458 GGGTGTGCATGTGTGTCCTTGGG + Intergenic
921254536 1:213327597-213327619 GCATGTGTATGTGTGTGTTTTGG + Intergenic
922765839 1:228156371-228156393 GTGTATGCATGTGTGTGCATGGG + Intronic
923337395 1:232982350-232982372 GTGTGTGCACATCTGTGCCTCGG + Exonic
924224891 1:241913380-241913402 GTGTGTGCAAGTGTGTGTCTAGG + Intergenic
1062802835 10:392723-392745 GTGTGTGCGCGTGTGTACCTGGG - Intronic
1062934519 10:1375885-1375907 GTATGTGCACGTGTGTGGTGTGG - Intronic
1063794809 10:9501548-9501570 GTGTGTGTGTGTGTGTGCTTTGG + Intergenic
1064120673 10:12615438-12615460 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1064283424 10:13971061-13971083 GTGTGTGCACCTGTGTGTTGGGG - Intronic
1065286145 10:24189474-24189496 GTGTGTGCACATGTGTGTTTGGG - Intronic
1066528955 10:36315317-36315339 GCGTGTGCGTGTGTGTGTGTTGG + Intergenic
1067061295 10:43079170-43079192 GAGTGTGCATGTGTGAGCTGTGG - Intronic
1067414480 10:46093019-46093041 GTGTGTGGGTGTGTGTGCTTCGG - Intergenic
1067434545 10:46267561-46267583 GTGTGTGGGTGTGTGTGCTTCGG - Intergenic
1067824308 10:49558974-49558996 GTGTGTGTATGTGTGTGTTTAGG + Intergenic
1069955876 10:72051230-72051252 GGGTGGGCATGTGTGTCCTTTGG - Intergenic
1070647486 10:78211810-78211832 GTGTGTGTACGTGTGTGATGAGG + Intergenic
1070666685 10:78350016-78350038 GCGTGTTGATGTGTATGCTTTGG - Intergenic
1070676172 10:78413144-78413166 GCGCGTGCACATGTGTGTGTTGG + Intergenic
1071133682 10:82427083-82427105 GGGTGTGCATTTGTGTGTTTTGG + Intronic
1071526874 10:86364294-86364316 CTGTGTGCACGTGTGCGCTGAGG - Intronic
1071649143 10:87378717-87378739 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
1073061307 10:100735442-100735464 GCGTGTGCACGCGTGTGCGCGGG + Intergenic
1073070284 10:100788895-100788917 GGGTGTGCATGTGTGTGTGTCGG - Intronic
1074019677 10:109569619-109569641 GTGTGTGCATGTGTATACTTGGG + Intergenic
1074095738 10:110310734-110310756 AGGTGTGTACGTGTGTGTTTGGG + Intergenic
1074267587 10:111920225-111920247 GTGTGTGCATGTGTGTGGATGGG - Intergenic
1074508538 10:114092913-114092935 GGGTGTGGGCGTGTGGGCTTCGG - Intergenic
1074869095 10:117563102-117563124 GGGTGTGCATGTGTGTCCGTGGG + Intergenic
1074869137 10:117563422-117563444 GGGTGTGCATGTGTGTTCGTGGG + Intergenic
1075082714 10:119394599-119394621 GTGTGGGCACGTGTATGTTTGGG + Intronic
1075082738 10:119394775-119394797 GTGTGGGCACGTGTATGTTTGGG + Intronic
1075098657 10:119490377-119490399 TCGTGTGCATGTGTGTGCGGGGG + Intergenic
1075654889 10:124154709-124154731 GAGTGTGCATGTGTGTGAGTGGG - Intergenic
1075654946 10:124155138-124155160 GAGTGTGCATGTGTGAGCATGGG - Intergenic
1076042450 10:127262278-127262300 GTGTGTGTACCTGTGTGCTGAGG + Intronic
1076759752 10:132597097-132597119 GTGTTTGCATGTGTGTGCATGGG + Intronic
1076874497 10:133209198-133209220 GCGTGTACACGTGTGTGGTTGGG + Intronic
1077135706 11:997268-997290 GCGTGTCCCCGGGTGTGCTGGGG + Intronic
1077144588 11:1039249-1039271 GTGTGTGCATGTGTGTGTATAGG + Intergenic
1077227240 11:1443692-1443714 GCGTGTGCCTGTGTGTGCACAGG + Intronic
1077305580 11:1867350-1867372 GTGTGTGCATGTGTGTGTGTGGG - Intronic
1077425059 11:2471594-2471616 GCGTGTGCACCTGTGTATATGGG + Intronic
1077721854 11:4637809-4637831 GTATGTGCACGTGTGTGTTGTGG + Intergenic
1078589635 11:12628202-12628224 GCGCGCGCACGTGTGAGCATGGG - Intergenic
1079296574 11:19240658-19240680 GCCTGTGCACGTGTGTGTAAGGG - Intronic
1080318966 11:30984233-30984255 GCGAGCGCAGGTGTGTGTTTGGG + Intronic
1080641446 11:34160771-34160793 GCGTGTGAGTGTGTGTGCGTTGG + Intronic
1080813801 11:35733801-35733823 GGATGTGCACATGTGTGTTTTGG - Intronic
1081644442 11:44779830-44779852 ATGTGTGCATGTGTGTGCATAGG - Intronic
1081677262 11:44977665-44977687 GTGTGTGCATGTGTGTGATCTGG - Intergenic
1081707259 11:45190118-45190140 GTGTGTGCACGTGTGTGTGTAGG - Intronic
1081837305 11:46166471-46166493 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1081994729 11:47355888-47355910 GTGTGAGCACGTGTGTGAGTGGG - Intronic
1081994783 11:47356423-47356445 GTGTGTGCATGTGTGTGAGTGGG - Intronic
1081995608 11:47361685-47361707 GCGTGTGTACGTGTGTACAAAGG + Intronic
1082223693 11:49674942-49674964 GTGTGTGCATGAGTGTGTTTGGG - Intergenic
1082969793 11:59007794-59007816 GTGTGTGCACGTGTGTCCCCAGG + Intronic
1084009944 11:66342029-66342051 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1084523479 11:69680849-69680871 GTGTGTGCATGTGTGTGTGTTGG - Intergenic
1084523480 11:69680903-69680925 GTGTGTGCATGTGTGTGGGTCGG - Intergenic
1084764040 11:71295891-71295913 ACCTGTGAACGGGTGTGCTTGGG + Intergenic
1085972540 11:81611120-81611142 GTGTGTGCATGTGTGTGTGTAGG + Intergenic
1085985228 11:81779028-81779050 GTGTGTGCACATGTGAGTTTTGG + Intergenic
1086625361 11:88944320-88944342 GTGTGTGCATGAGTGTGTTTGGG + Intronic
1089281940 11:117380877-117380899 GTGTGTGCACGTGTGTGTACTGG + Intronic
1089626223 11:119752783-119752805 GTGTGTGCATGTGTATGCCTGGG - Intergenic
1090081168 11:123613721-123613743 GAGTGTGCATGTGTGTGCCTTGG - Intronic
1090401338 11:126450317-126450339 ACGTGTGCATGTGTGAGCGTGGG + Intronic
1091625547 12:2118252-2118274 GTGTGTGCACGGGTCTGGTTTGG + Intronic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1091770970 12:3151176-3151198 GTGTGTGCATGTGTGTGAGTGGG + Intronic
1091782635 12:3223551-3223573 ACGTGTGCGTGTCTGTGCTTTGG + Intronic
1092312563 12:7374394-7374416 GTGTGTGCACGTGTGTGTAGAGG + Intronic
1092908992 12:13128506-13128528 GCGTGTGCATGTGCGTGCTCAGG + Intronic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1093159694 12:15731851-15731873 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1094218808 12:27971788-27971810 GTGTGTGCGTGTGTGTGTTTTGG - Intronic
1094479153 12:30866845-30866867 GTGTGTGCACATGTGTGATTTGG - Intergenic
1095293201 12:40499805-40499827 GCATGTGTATGTGTGTGCATGGG + Intronic
1095481552 12:42641398-42641420 GGCTGTGCATGTGTGTGCTGGGG - Intergenic
1096341033 12:50799381-50799403 GCATGTGCATGTGTGTATTTGGG - Intronic
1096476283 12:51911122-51911144 GCATGTGCAGGTGTGTGTCTGGG - Intronic
1096542947 12:52318393-52318415 GTGTGTGAATGTGTGTGGTTGGG + Intronic
1096878144 12:54646260-54646282 GAGGGTGCAGGTGTGTGCTGTGG + Intronic
1097190573 12:57217495-57217517 CCGTGTGTGCGTGTGTGCTCGGG - Intronic
1097823388 12:64150138-64150160 GCATGTGCACGTGTGTGGGTGGG + Exonic
1098195820 12:68001072-68001094 GTGTGTGTATGTGTGTGCTCTGG - Intergenic
1099043463 12:77685458-77685480 GTGTGTGCATGTGTATGCGTTGG - Intergenic
1101726387 12:107391845-107391867 GCGTGTGTATGTGTGTGATGGGG + Intronic
1101759966 12:107650415-107650437 GTGTGTCCATGTGTGTGTTTGGG - Intronic
1101845998 12:108363499-108363521 GCATGTGCATGTGTGTGGTATGG + Intergenic
1102695847 12:114798799-114798821 GTGTGTGCACGTGTGTGTAAGGG + Intergenic
1102902031 12:116646422-116646444 GTGTGTGCACGTGTATGTGTGGG - Intergenic
1103197907 12:119061317-119061339 GCGTGTGCACTTGGGTGTGTTGG + Intronic
1103539956 12:121659120-121659142 GTGTGCGCGCGTGTGTGTTTAGG - Intronic
1103553543 12:121752229-121752251 GGGTGTGGCCGTGTGTGCCTGGG + Intronic
1103730596 12:123025229-123025251 GCATGTGCATCTGTGTGCCTAGG - Intronic
1103971725 12:124676776-124676798 GTGTGTGTATGTGTGTGCCTGGG + Intergenic
1104112955 12:125721228-125721250 CTGTGTGTACGTGTGTGCATAGG + Intergenic
1104124096 12:125828794-125828816 GTGTGTGTATGTGTGTGCATGGG + Intergenic
1104944942 12:132411378-132411400 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1104944969 12:132411589-132411611 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1105014763 12:132779726-132779748 GTGTGCGCACGTGTGTGCCTGGG - Intronic
1105014807 12:132779996-132780018 GTGTGCGCACGTGTGTGCCTGGG - Intronic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1106138741 13:26993379-26993401 GCAGGTGCAGGTGTGTGATTGGG + Intergenic
1106333601 13:28763052-28763074 GCATGTGCACGTGTGTGTAGGGG + Intergenic
1106902602 13:34369698-34369720 GCATGAGCACGTGCGTGCATGGG + Intergenic
1107235460 13:38163578-38163600 GTGTGTGTGCGTGTGTGTTTTGG + Intergenic
1107279455 13:38716825-38716847 GCCTGTGCACATGTGTGTTTTGG - Intronic
1107625572 13:42279242-42279264 GGGTGTGCACGTGCGTGCACTGG - Intronic
1107842032 13:44467987-44468009 GTGTGTGCGCGTGTGTGTATAGG - Intronic
1107846077 13:44514497-44514519 GTGTGTGTATGTGTGTGTTTTGG - Intronic
1108555320 13:51585157-51585179 GGCTTTGCAGGTGTGTGCTTGGG + Intronic
1109192665 13:59344290-59344312 GTGTGTGCATGTGTATGCTTTGG - Intergenic
1110408615 13:75179109-75179131 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1111219990 13:85192063-85192085 GGTTGTGCATGTCTGTGCTTGGG + Intergenic
1112439329 13:99414440-99414462 GTGTGTGCACGTGTGTGAGTGGG - Intergenic
1112491765 13:99872172-99872194 GAGTGTGCCCATGTGTGCATGGG - Intronic
1112877785 13:104066692-104066714 GCATGTGCACGGGTGCGCTTAGG - Intergenic
1113097867 13:106685174-106685196 GTGTGTACACATGTGTGTTTAGG - Intergenic
1113327138 13:109293268-109293290 GCGTGTGTAGGTGTGTGTATAGG - Intergenic
1113465594 13:110510573-110510595 ACTTATGCACGTGTGTGCATAGG + Intronic
1113613810 13:111666543-111666565 GTATGTGCATGTGTGTGCATTGG + Intronic
1113867651 13:113538117-113538139 GTGCATGCATGTGTGTGCTTTGG + Intronic
1113893854 13:113751273-113751295 GTGTGTGCGTGTGTGTGCATGGG + Intergenic
1113893857 13:113751314-113751336 GTGAGTGCATGTGTGTGCATGGG + Intergenic
1115749706 14:36477156-36477178 GTTTGTGCACGTGTGTCCTCAGG + Intronic
1117055839 14:51911251-51911273 GTGTATGTATGTGTGTGCTTGGG + Intronic
1118366993 14:65104198-65104220 GCGTGAGCACGTGAGCACTTTGG - Intergenic
1118384907 14:65247917-65247939 GCGTGTGCGTGTGTGTGCAAGGG - Intergenic
1118570877 14:67194437-67194459 GCGTGTGTGTGTGTGTGCTGTGG + Intronic
1119282378 14:73420463-73420485 GTGTGTGCATGTGTGTGTATAGG + Intronic
1121270806 14:92636927-92636949 GTGTGTGTGCGTGTGTGCTTGGG + Intronic
1121523593 14:94602969-94602991 AGGTGGGCACGTTTGTGCTTGGG + Intronic
1121941736 14:98077117-98077139 GTGCATGCATGTGTGTGCTTTGG - Intergenic
1122088177 14:99321127-99321149 GCATGGGCACATGTGTGATTTGG - Intergenic
1122544375 14:102514127-102514149 GTGTGTGCATGCGTGTGCGTGGG + Intergenic
1123054746 14:105563989-105564011 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123079186 14:105683548-105683570 GTGTGTGCACGTGTGGGGTGTGG + Intergenic
1123984325 15:25631606-25631628 GCATGTGCAGGTATGTGCGTGGG + Intergenic
1124130192 15:26976864-26976886 GGGTTTTCACGTGTGTGGTTGGG + Intronic
1124200184 15:27672731-27672753 GCATGTGCATGTGTGTGTATGGG - Intergenic
1124200186 15:27672757-27672779 GCATGTGCATGTGTGTGTGTGGG - Intergenic
1124631686 15:31341350-31341372 GTGTGTGTACGTGTGTGTGTCGG + Intronic
1124678753 15:31711008-31711030 GCATGTGCAGGTGTGTATTTCGG + Intronic
1125486269 15:40113021-40113043 GTGTGTGCACGCGTGTGCGTGGG + Intergenic
1125556087 15:40586249-40586271 GGGTGTGCTGGTGTGTGCTGCGG - Intergenic
1126315759 15:47367659-47367681 GCGTGTGAGCGTGCGTGTTTAGG - Intronic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1129113157 15:73350015-73350037 ACGTGGTCAAGTGTGTGCTTTGG - Intronic
1130995955 15:88904338-88904360 ACGTGTGCATGTGTGTGGGTGGG - Intronic
1131190250 15:90309445-90309467 GCATGTGCACGTGTGTGCGTTGG - Intronic
1132261971 15:100433708-100433730 GTGTGTGCACATGTGTGCATGGG - Intronic
1132632483 16:926496-926518 GTGTTTGCACGTCTGTGTTTGGG + Intronic
1133216788 16:4297411-4297433 GTGTTTGCATGTGTGTGCGTGGG - Intergenic
1133925910 16:10192340-10192362 GGGTGTGCTCGTGTGTGTCTGGG + Intergenic
1134004240 16:10807223-10807245 GTGTGTGCATGTCTGTGCGTGGG + Intronic
1134203658 16:12219915-12219937 GTGTGTACACGTGTGTGCGCTGG - Intronic
1134782367 16:16909830-16909852 GTGTGTGCGCGTGTGTGGCTGGG + Intergenic
1134853263 16:17499219-17499241 GCATGTGCACATGTGTGTATCGG - Intergenic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1135549803 16:23389338-23389360 GAGTGTGTATGTGTGTGGTTGGG - Intronic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1137400190 16:48146966-48146988 GTGTGTGCATGTGTGTGCGTGGG - Intronic
1137499707 16:49000981-49001003 GCGGGTGAAAGTGTGGGCTTTGG + Intergenic
1137592326 16:49701248-49701270 GCATGCGCACGTGTGTGTGTAGG + Intronic
1137788570 16:51155519-51155541 GTGTGTGCATGTGTGTGTGTTGG + Intergenic
1137793570 16:51195914-51195936 GTGTGTGCATGTGTGTGTGTTGG - Intergenic
1138522376 16:57578224-57578246 GTGTGTGCATGTGTGTGTATGGG + Intronic
1138708858 16:58946180-58946202 GTGTGTGCGTGTGTGTGCATGGG + Intergenic
1138778978 16:59759550-59759572 GCTTGTGGAAGTGTGTTCTTTGG + Intergenic
1139429422 16:66903262-66903284 GTGTGTGCACGTGAGCACTTGGG - Intergenic
1139533024 16:67552710-67552732 TTGTGATCACGTGTGTGCTTTGG + Intergenic
1139719731 16:68842909-68842931 GCGTGTGTACGTCTGTACTTAGG + Intergenic
1139831203 16:69799720-69799742 ATGTGTGCACGTGTGTGTCTGGG + Intronic
1140245861 16:73248665-73248687 GCACGTGCACGTGTGTGTTGTGG + Intergenic
1140513581 16:75526223-75526245 GAGTGTGCATGTGTGTGTGTGGG + Intergenic
1140529883 16:75655976-75655998 GTGTGTGCACGTGTGTGTGAGGG - Intronic
1140888722 16:79267418-79267440 GTGTGTGTACGTGTGTGGTATGG + Intergenic
1141481541 16:84309835-84309857 GCGTGTGTACATGTGTGTGTGGG + Intronic
1141928971 16:87188132-87188154 GTGTGTGTACATGTGTGCGTGGG + Intronic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1142003798 16:87679669-87679691 GTGTGTGCACGTGTGGGTCTGGG + Intronic
1142239846 16:88940223-88940245 GCGTCCGCCCGTGTGTGCTGGGG - Exonic
1142504055 17:351621-351643 GCGTGTGGAGGCCTGTGCTTTGG - Intronic
1142561604 17:812573-812595 GTGTGTGCACGTGTGTGTGATGG + Intronic
1142562020 17:815855-815877 GTGTGTGCACGTGTGTGCACAGG - Intronic
1142627600 17:1202490-1202512 GAGTGGGCACGTGTGTGTTTGGG - Intronic
1142736997 17:1907518-1907540 GCATGTGCACGTGTGTGCCCTGG + Intergenic
1142744074 17:1946434-1946456 GCATGTGTACGTGTGTGCACAGG + Intronic
1143167404 17:4903789-4903811 ATGTGTGCACGTGTGTGTTTAGG - Intergenic
1143390896 17:6558629-6558651 GTGTGTGCTTGTGTGTGCTTAGG + Intergenic
1143476015 17:7204404-7204426 GCGTGTGCGTGTGTGTGATGTGG - Intronic
1143483021 17:7238199-7238221 GCGTGTGCCTGTGTGTGTCTGGG - Intronic
1144495599 17:15743016-15743038 CCGTGTGCCCGAGGGTGCTTGGG + Intronic
1144754085 17:17668999-17669021 GCGTGTGCGTGTGTGTGCGCAGG - Intergenic
1144831199 17:18132119-18132141 GTGTGTGCACATGTGGGCTATGG + Intronic
1146354889 17:32125621-32125643 GTTTGTGCACGTGTGTCCTCAGG - Intergenic
1146795120 17:35775132-35775154 GTATGTGCATGTGTGTGTTTGGG + Intronic
1146913322 17:36662017-36662039 GCATGTGCATGTGTGTGTCTGGG - Intergenic
1146928383 17:36760852-36760874 GTGTGTGCATGTGTGTGGATGGG + Intergenic
1147382032 17:40061970-40061992 GTGTGTGTATGTGTGTGCTGGGG + Intronic
1148210154 17:45803790-45803812 GTGTGTGCATGTGTGTGTGTTGG + Intronic
1148330173 17:46809469-46809491 GTGTGTGTACGTGTGTGTTGGGG - Intronic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1150215655 17:63467521-63467543 GCATGTGCACGTCGGGGCTTGGG - Intergenic
1151134790 17:71935887-71935909 GTGTGTGTGCGTGTTTGCTTTGG - Intergenic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1151512394 17:74569254-74569276 GTGTGTGCATGTGTGGGCGTGGG + Intergenic
1151881903 17:76900977-76900999 GTGTGTGCATGTGTGTACATGGG + Intronic
1151930089 17:77226896-77226918 GTGTGTGTATGTGTGTGTTTGGG + Intergenic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152191881 17:78893081-78893103 GCGTGTGCAGGGGTGTGTGTGGG + Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152286955 17:79418313-79418335 GTGTGTGCACGCGTGTGCATGGG - Intronic
1152330668 17:79670771-79670793 GCGTGCGCACGTGTGTCTTCTGG - Intergenic
1152521593 17:80859710-80859732 CTGTGTGCACGTGTGTGCGGGGG + Intronic
1152575437 17:81138366-81138388 ACGTGTGCCCGTGTGTCCATGGG - Intronic
1152582009 17:81169978-81170000 GTGTGTGCATGTGTGTGTGTTGG + Intergenic
1152733475 17:81985057-81985079 GTGTGTACAGGTGTGTGCGTGGG - Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152737859 17:82006117-82006139 GCGGGTACACATGCGTGCTTGGG + Intronic
1152737865 17:82006158-82006180 GTGGGTGCACGTGTGTGCACGGG + Intronic
1152737872 17:82006236-82006258 GCGGGTGCATGTGCATGCTTGGG + Intronic
1152737880 17:82006277-82006299 GCGGGTGCACGTGCGTGTTTGGG + Intronic
1152859900 17:82690313-82690335 GAGTGTGCATGTGTGTTCCTGGG + Intronic
1152859910 17:82690392-82690414 GAGTGTGCACATGTGTTCTCAGG + Intronic
1152859934 17:82690582-82690604 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1152859953 17:82690711-82690733 GAGTGTGCATGTGTGTTCCTGGG + Intronic
1152859958 17:82690741-82690763 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859969 17:82690820-82690842 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152912601 17:83013672-83013694 TCGTGGGCACGTGTGCGGTTGGG - Intronic
1152941811 17:83176773-83176795 TGGTGTGCATGTCTGTGCTTTGG + Intergenic
1153325525 18:3815400-3815422 GTGTGTGCACGGGTGTGCAGAGG - Intronic
1153667745 18:7381583-7381605 GCCTGTGCATGTGTGTGCGCCGG - Intergenic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1154227451 18:12519329-12519351 GTGTGTGCACATGTGTGTATAGG - Intronic
1155360896 18:25000986-25001008 GTGTGTGCACGTGTGTATTTAGG + Intergenic
1155446146 18:25914902-25914924 GTATGTGTATGTGTGTGCTTTGG - Intergenic
1155618736 18:27751310-27751332 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1155743624 18:29322438-29322460 ATGTGTGCATGTGTGTGTTTAGG + Intergenic
1157113759 18:44844326-44844348 GTGTGTGCACGTGTGTGTGTGGG - Intronic
1158109124 18:53920420-53920442 GTGTGTGCACGTGTGTGTATGGG + Intergenic
1158120006 18:54038436-54038458 GCGTGTGCATGTGTGTGTGTGGG - Intergenic
1158491636 18:57915590-57915612 GCATATGAACTTGTGTGCTTGGG + Intergenic
1158694639 18:59692951-59692973 GTGTGTGTGTGTGTGTGCTTTGG - Intronic
1159251624 18:65885674-65885696 GCGTTTTCATGTGTGTGATTGGG + Exonic
1161901055 19:7119839-7119861 GTGTGTGCGTGTGTGTGTTTGGG - Intronic
1161967683 19:7557325-7557347 GCGTGTGCGTGTGTGTGGTGCGG - Intronic
1162015320 19:7843328-7843350 GAGTGTGCATGTGTGTGTATAGG + Intronic
1162015345 19:7843646-7843668 GTGTGTGCATGTGTGTGTATAGG + Intronic
1162057333 19:8072376-8072398 GGGTGTGCATGTGTGTCCCTTGG + Intronic
1163666474 19:18606216-18606238 GCGGGCGCACGCGTCTGCTTCGG - Intronic
1164519482 19:28967634-28967656 GAGTGTGCATGTGTGTGGGTGGG + Intergenic
1166569196 19:43783009-43783031 GCGTGTCCATGTGTATGGTTTGG - Intergenic
1167372079 19:49088855-49088877 GGGTGTGCAGTTGTGGGCTTTGG + Intronic
1168311447 19:55463035-55463057 CTGTGTGCATGTGTGTGTTTTGG - Intergenic
924991855 2:319291-319313 GTGTGGGCACGTGTGTGCCTGGG + Intergenic
925109437 2:1321446-1321468 GCGTGGGCACCTGAGTGTTTAGG + Intronic
925126629 2:1461699-1461721 CTGTGTGCACGTGTGTGTATGGG - Intronic
925126633 2:1461756-1461778 GTGTGTGCAGGTGTGTGTGTGGG - Intronic
925461881 2:4070312-4070334 GAGTGTGCACATTTGTGCTTGGG + Intergenic
925542930 2:4985569-4985591 GCGTGCTCACGTGTGTGTTTTGG - Intergenic
925572160 2:5324284-5324306 GCATCTGCATGTGTGTGGTTGGG - Intergenic
926906129 2:17807377-17807399 GTGTGTGCTCGTGTGTGTTGGGG - Intergenic
927477424 2:23424278-23424300 ACGTGTGCATGTGTGTGCGTGGG + Intronic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
927780595 2:25936355-25936377 GCGTGTGTGTGTGTCTGCTTAGG + Intronic
928171307 2:29005288-29005310 GTGTGTGCATGTGTGTGTGTGGG + Intronic
928592058 2:32827386-32827408 GAGTGTGCACATGTGTACTTGGG - Intergenic
929315855 2:40477753-40477775 GTGTGTGCACGTGTGTGTAGGGG + Intronic
929360185 2:41078797-41078819 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
929783956 2:44975843-44975865 GTGTGTGCGTGTGTGTGCGTAGG - Intergenic
929825939 2:45309823-45309845 GCATGTACACATGTGTGCATGGG + Intergenic
930474279 2:51860185-51860207 CCATGTGCCCGTGTTTGCTTTGG + Intergenic
930741606 2:54837445-54837467 GTGAGTGCCCGTGAGTGCTTAGG - Intronic
931960474 2:67476941-67476963 GTGTGTGCGCCTGTGTGCCTGGG + Intergenic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
932300673 2:70664729-70664751 GAGTGTGCAAGTGTGTGTGTGGG + Intronic
932627636 2:73311096-73311118 GTGTGTGTACGTGTGTGTATGGG + Intergenic
932825987 2:74940639-74940661 GCATGCGCACGTGTGTGTATGGG - Intergenic
933949445 2:87315488-87315510 GTGTGTGCATGTGTGTGCACGGG + Intergenic
935332526 2:101987597-101987619 GTAGGTGCACGTGTGTGTTTAGG - Intergenic
936073712 2:109388078-109388100 GTGTGTGCATGTGTGTGCACAGG - Intronic
936330747 2:111546109-111546131 GTGTGTGCATGTGTGTGCACGGG - Intergenic
936443622 2:112577976-112577998 GTGTGTGAAAGTGTGTGGTTGGG - Intergenic
937087776 2:119182608-119182630 GCGTGTGTAAGTGTGTGTTGGGG - Intergenic
937512225 2:122608954-122608976 GTGTGTGCATGTGTGTGTGTAGG - Intergenic
937711128 2:124981313-124981335 GTGTGCACACGTGTGTGTTTAGG + Intergenic
938400330 2:130986177-130986199 GCACGTGCATGTGTGTGCATAGG + Intronic
939148924 2:138449885-138449907 ACGTATGCACATGTGTGTTTGGG + Intergenic
940567299 2:155383257-155383279 ATGTGTGCACTTGTGTGCGTAGG - Intergenic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
942865439 2:180668011-180668033 GTGTGTGCATGTGTGTGTTATGG + Intergenic
942885546 2:180919352-180919374 GTGTGTGTATGTGTGTGTTTTGG - Intergenic
944436554 2:199696144-199696166 GCATGTGCATGTGTGTGCCCTGG - Intergenic
946400481 2:219465879-219465901 GCGTGTGCATGTGTGCGTATGGG + Intronic
946449459 2:219767355-219767377 GTGTGTGCATGTGTGTGGGTGGG + Intergenic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
947000693 2:225452780-225452802 ACGTGTGCATGTGTGTGGTGGGG - Intronic
947386623 2:229596974-229596996 GCGTGTGCATGTGTGTGCGCAGG - Intronic
947693133 2:232158329-232158351 GTGTGTGCATGTGTGTGTTCGGG + Intronic
947746964 2:232512831-232512853 GCATGCGCACGTGTGTGCAGGGG + Intergenic
947917575 2:233843864-233843886 GTGTGTGCACGTGTGTGGCAGGG + Intronic
948183680 2:236002417-236002439 GCATGTGCACATGTGTGAGTAGG + Intronic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
948569104 2:238906237-238906259 GTGTGTGCATCTGTGTGCGTGGG - Intronic
1168803928 20:662062-662084 GCGCGTGGAGGTGTGTGCTTCGG + Exonic
1169000130 20:2162584-2162606 GCGCGTGCACGTGTGTCAGTTGG + Intronic
1169258108 20:4114273-4114295 GTGTTTGCACGTGTGAGCCTGGG + Intergenic
1170045629 20:12082423-12082445 GTGTGTGCACGTGTGTGTCTGGG - Intergenic
1170508176 20:17050371-17050393 GTGTGTGCACGTTAGTGGTTTGG - Intergenic
1171109985 20:22471910-22471932 ATGTGTGCACGGGTGTGCTGTGG - Intergenic
1171295594 20:24014211-24014233 GTGTGTGCAGGTGTCTGCGTTGG + Intergenic
1172650758 20:36499989-36500011 GTGTGTGTGCGTGTGGGCTTGGG + Intronic
1173227282 20:41169249-41169271 GTGCATGCACGTGCGTGCTTGGG - Intronic
1173585918 20:44183010-44183032 GCGTGTGTATGTGTGTGTTTTGG - Intronic
1173658163 20:44715293-44715315 GCGTGTGCCTGTGTGTGCCTGGG + Intronic
1173742037 20:45407906-45407928 GCGTGTGTACGTGTTTGTGTGGG + Intronic
1174412283 20:50343851-50343873 GTGTGTGCATGTGTGTGGCTGGG + Intergenic
1174887018 20:54347078-54347100 GTGTGTGCATGTGCGTGCTTTGG + Intergenic
1175219967 20:57411316-57411338 GTGTGTGCACATGTGTGTCTGGG - Intergenic
1175314938 20:58040545-58040567 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1175643389 20:60650035-60650057 GTGAGTACACGTGTGTGTTTAGG + Intergenic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175793856 20:61758915-61758937 GTGTGTGCACCTGTGTGCATGGG + Intronic
1175793859 20:61758953-61758975 GAGTGTGCACATGTGCGCATGGG + Intronic
1175850413 20:62087789-62087811 GCGTGTGCAGGTGAGTGTATAGG - Intergenic
1176020018 20:62957857-62957879 GCGTGTGCAAGTGTGTGTATGGG + Intronic
1176110661 20:63409313-63409335 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1176302790 21:5106685-5106707 GCGTGTGCAGGTGTGCACATAGG - Intergenic
1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG + Intergenic
1178359578 21:31937082-31937104 GTGTATGCATGTGTGTGTTTCGG + Intronic
1178573132 21:33759679-33759701 ACATGAGCACGTGTGTGTTTTGG - Intronic
1178589261 21:33895457-33895479 ACGTGTGCGTGTGTGTGCATGGG + Exonic
1178710045 21:34908953-34908975 GTGTGTGTATGTGTGTGCTAGGG + Intronic
1178844728 21:36165424-36165446 GTGTGTGCATGTGTGTGTATGGG + Intronic
1179144883 21:38759250-38759272 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
1179153926 21:38833076-38833098 GTGTGTGCATGTGTGTTCTTGGG - Intergenic
1179736987 21:43397563-43397585 GCGTGTGCCCGTGTGTGCTTGGG - Intergenic
1179854234 21:44155238-44155260 GCGTGTGCAGGTGTGCACATAGG + Intergenic
1180195871 21:46193966-46193988 GCATGCGTACGTGTGTGCATAGG + Intronic
1181557139 22:23677646-23677668 GTGTGTGAACAGGTGTGCTTGGG - Intergenic
1182966899 22:34530562-34530584 GTGTGTGCATGTGTGTGTTTGGG + Intergenic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1183387181 22:37521501-37521523 GAGTGTGCAAGCGTGTGATTAGG + Intergenic
1183614847 22:38937641-38937663 GTGGGTGCACGTGTGTGCATGGG + Intergenic
1183694029 22:39409464-39409486 ATGTGTGCACGTATGTGCCTGGG - Intronic
1184073697 22:42162830-42162852 GCATGTGCATGTACGTGCTTGGG - Intronic
1184250135 22:43255419-43255441 GTGTGTGCACATGTGTGTCTCGG - Intronic
1184397177 22:44249216-44249238 GTGTGTGCGTGTGTGTGATTTGG - Exonic
1184890453 22:47375921-47375943 GCGCGCGCACATGTGTGTTTGGG - Intergenic
1184924686 22:47629105-47629127 GCATGTGCATGTGTGTGATGTGG + Intergenic
1185023687 22:48395507-48395529 GTGTGTGCATGTGTGTGCACAGG - Intergenic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
1185100402 22:48837638-48837660 GTGTGCGCACGTGTGTGCATGGG - Intronic
1185188549 22:49418059-49418081 GCGGGTGCACGTGTGGGGTGTGG - Intronic
1185285604 22:49998446-49998468 GGCTGTGCACGTGTGTGCATGGG + Intronic
951649753 3:24938029-24938051 GTGTGTGCGCATGTGTGCATAGG - Intergenic
952384433 3:32829654-32829676 GTGTGTGCGTGTGTGTGCATTGG + Intronic
953004836 3:38968579-38968601 GTGTGTGCACATGTGTGTTGGGG - Intergenic
953173792 3:40530873-40530895 GTGTATGCATGTGTGTGCGTAGG - Intronic
953541680 3:43824700-43824722 GTGTGTGCACAGGTGTGCTTAGG + Intergenic
953743181 3:45554348-45554370 ACGTGTGCATGTGTGTGGTGTGG - Intergenic
953881621 3:46693952-46693974 GAGTGTGCGCGTGGGTGCGTAGG - Intergenic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
956456512 3:69426336-69426358 GTGTGTGCATGTGTGTGTGTTGG + Intronic
957363875 3:79196353-79196375 GCGTGTGCATGTGTGTGTGATGG - Intronic
957605819 3:82397920-82397942 GTATGCGCACGTGTGTGTTTTGG - Intergenic
958109335 3:89119761-89119783 GTATGTGCACATGTGTGTTTGGG + Intronic
958544034 3:95517505-95517527 GCGTGTGTGTGTGTGTGTTTAGG + Intergenic
959440821 3:106373349-106373371 GTATGTGCACGTGTGCACTTTGG + Intergenic
959515236 3:107258690-107258712 GTGTGTGCTTGTGCGTGCTTTGG - Intergenic
959959195 3:112277006-112277028 GTGTGTGCAAATGTGTGCATGGG + Intronic
960354975 3:116640438-116640460 ATGTGTGCATGTGTGTGTTTGGG - Intronic
962385328 3:134928147-134928169 GAGAATGCACGTGTGTGCGTGGG - Intronic
965892878 3:173536765-173536787 GCGTGTGTGTGTGTGTGCGTAGG + Intronic
966129386 3:176620040-176620062 GTGTGTGCGTGTGTGTGTTTGGG + Intergenic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
968490415 4:887980-888002 GCGTCTGCACATGTGAGCGTGGG - Intronic
968493210 4:901458-901480 GCGTCTGCTCGTGGGTGCCTAGG - Intronic
968522725 4:1041331-1041353 GTGTGTGCATGTGTGTGTGTCGG + Intergenic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
969301417 4:6299482-6299504 GGGTGTGCACGTGTGTGTAGGGG + Intronic
969301497 4:6299965-6299987 GTGTGTGCACGTGTGTGTACGGG + Intronic
969584031 4:8081599-8081621 GCATGTGCATCTGTGTGCATAGG + Intronic
969609310 4:8218130-8218152 GTGTGTGCACGTGTGTGTGTTGG + Intronic
969665714 4:8556330-8556352 GAGTGTGCACGGGAGGGCTTGGG - Intergenic
970050875 4:11913543-11913565 GTGTGTGCATGTGTGTGTGTGGG - Intergenic
972268598 4:37486776-37486798 GTGTGTGCATGTGTATGTTTTGG - Intronic
972406762 4:38753469-38753491 GTGTGTGTACGTGTATGTTTGGG - Intergenic
972469679 4:39391821-39391843 GCTTATGCACGTCTGTGATTTGG - Intergenic
973947837 4:55978022-55978044 GCATGTGCATGTGTGTGTTTAGG + Intronic
974413740 4:61577194-61577216 GTGTGTGCATGTGTGTGTTAGGG + Intronic
974714116 4:65644221-65644243 GAGTGTGTATGTGTGTGCATGGG - Intronic
974867120 4:67594942-67594964 GTGTGTGCATGTGTGTGATTGGG + Intronic
974889196 4:67858669-67858691 GGGTGTGCAGGTGTGTACATGGG - Intronic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
976134726 4:81923367-81923389 CTGTGTGCATGTGTGTGTTTTGG - Intronic
976349945 4:84049829-84049851 GCGTGTGTATGTGTGTGTGTGGG + Intergenic
977713055 4:100149359-100149381 GAGTGTGCATGTTTGTGCATAGG + Intergenic
978575413 4:110184985-110185007 GCCTGTGCATGTGTGTACTGGGG + Intronic
978967383 4:114757301-114757323 ACGTGTGCATGTCTGTGCCTTGG + Intergenic
980113595 4:128658317-128658339 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
980249254 4:130292884-130292906 GTGTGTGCGCGTGTGTGTGTGGG + Intergenic
980491860 4:133538504-133538526 GTGTGTGTATGTGTGTGTTTAGG + Intergenic
980585689 4:134812070-134812092 GCGAGTTCACGTGAGTGCTGTGG + Intergenic
983818300 4:172160172-172160194 GCGTGTGCGTGTGTGGCCTTTGG + Intronic
983937518 4:173512475-173512497 GCGTGTGCACTTGAGTGCCAGGG - Intergenic
985074700 4:186202607-186202629 GTGTGTGCATGTGTGTGCATGGG - Intronic
985515998 5:344900-344922 GCGTGTGCAGGTGTGTGTGGAGG + Intronic
985581367 5:697004-697026 GCGTGTGCCTGTGTGTGCATGGG + Intergenic
985595996 5:788330-788352 GCATGTGCCTGTGTGTGCATGGG + Intergenic
985795753 5:1961196-1961218 GTGTGTGCATGTGTGTGATCAGG - Intergenic
985836004 5:2272327-2272349 GGGTCTGAACGTGTGTTCTTGGG + Intergenic
986251299 5:6060846-6060868 GTGTGTGCACATGTGTGCGGGGG - Intergenic
987576983 5:19742379-19742401 GCGTGTGCATTTGTGTGTTTTGG - Intronic
987872283 5:23636443-23636465 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
988054340 5:26074056-26074078 GTGTGTGCATGTGTGGGTTTGGG + Intergenic
988458740 5:31413040-31413062 GTGTGTGCTCATGTGTGCGTTGG - Intronic
988520876 5:31944733-31944755 GCGTGTGCACGTGTGTCCCCAGG + Intronic
988935767 5:36081582-36081604 GTGTGTGCATGTGTGTGGGTGGG - Intergenic
989158946 5:38371595-38371617 GTGTGCGCATGTGTGTGTTTTGG - Intronic
989631509 5:43487318-43487340 GAGTGTGTATGTGTGTGTTTGGG + Intronic
989740504 5:44765679-44765701 GTGTGTGCACATGTGTGTATCGG - Intergenic
991069305 5:62458681-62458703 GCCTGTGCATGTGTGTGTCTAGG + Intronic
993612078 5:90066753-90066775 GTGTGTGTATGTGTGTGCATGGG - Intergenic
995495842 5:112742084-112742106 GGGTGTGCAAGTGTCTGCTTGGG + Intronic
996163660 5:120197994-120198016 ACGTGTGCATGTGTGTGTTTTGG - Intergenic
996541083 5:124630497-124630519 GCATGTGTGCGTGTGTGCTAGGG + Intergenic
998176900 5:139907003-139907025 GCATGTGCACATGTGTGTATGGG + Intronic
998392641 5:141797234-141797256 GTGTGTCCAAGTGTGTGCCTAGG - Intergenic
998559971 5:143162270-143162292 GTGTGTGTATGTGTGTGTTTGGG - Intronic
999270984 5:150296281-150296303 GTGTGTGCATGTGTGTCCTGGGG - Intergenic
999330750 5:150672013-150672035 GCGCGTGCGCGTGTGTGTTGGGG - Intronic
1000538407 5:162508228-162508250 ATGTGTGTACATGTGTGCTTAGG - Intergenic
1000760145 5:165213496-165213518 GTATGTGCACATGTGTGCTGGGG - Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001245729 5:170104852-170104874 GTGTGTGCGCGTGCGTGCGTGGG + Intergenic
1001487948 5:172133198-172133220 GCGTGTGTGCGTGTGTGTCTGGG + Intronic
1001833973 5:174814920-174814942 GTGTGTGTACGTGTGTGTGTGGG - Intergenic
1001899951 5:175418515-175418537 GTGTGTGTGTGTGTGTGCTTTGG - Intergenic
1001936310 5:175708276-175708298 GCGTGCACATGTGTGTGCATGGG + Intergenic
1002167522 5:177357769-177357791 GTGTGTGCGCGTGTGTGTGTAGG + Intergenic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1002971467 6:2026294-2026316 GAGAGTGAAGGTGTGTGCTTGGG - Intronic
1003558734 6:7163740-7163762 GTGTGAGCACGTGTGTGCCTGGG + Intronic
1004084291 6:12429515-12429537 GTGTGTGCACATGTGTGTGTTGG + Intergenic
1005179002 6:23082232-23082254 GCGTGTGTGTGTGTGTGATTGGG + Intergenic
1006173139 6:32106980-32107002 GTGTGTGCACGTGTGTGCATGGG - Intronic
1006923088 6:37638943-37638965 GTGTGTGCATGTGTGTGTTTGGG - Intronic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1007384260 6:41510047-41510069 GTGTGTGTACGTGTGTGTTGGGG - Intergenic
1007784415 6:44271507-44271529 GCGTGTGCACAAGTGTGCATGGG - Intronic
1007836483 6:44677886-44677908 ACATGTGCATGTGTGTGCATAGG - Intergenic
1010120579 6:72371169-72371191 GTGTGTGCACATGTGTGGTCTGG + Intronic
1010982677 6:82386988-82387010 GTGTGTGCGCGTGTGAGCATGGG + Intergenic
1011172763 6:84524307-84524329 GCATGTGCACGTGTGTGATGGGG + Intergenic
1012700858 6:102455182-102455204 GTGTGTGTATGTGTGTGTTTAGG + Intergenic
1013575726 6:111482666-111482688 GCGTGTGCGCGTGTGCGCGGCGG + Intronic
1014313662 6:119836754-119836776 TTGTGTGTACGTGTGTGTTTAGG + Intergenic
1015395358 6:132727914-132727936 TTGTGTGCATGTGTGTGCTCTGG + Intronic
1015576514 6:134677422-134677444 GTGTGTGCATGTGTGTGCATAGG - Intergenic
1016875152 6:148857260-148857282 TGGTGTGTATGTGTGTGCTTAGG - Intronic
1018244104 6:161805437-161805459 GTGTGTGCATGTGTGTACTCAGG - Intronic
1019183281 6:170206160-170206182 GTGTGAGCACGTGTGTGCATGGG + Intergenic
1019264736 7:108163-108185 GTGTGTGCACATGTGTACATGGG - Intergenic
1019329502 7:455630-455652 GTCTGTGCACGTGTGAGCGTGGG - Intergenic
1019356637 7:583368-583390 GAGTGTGCACATGTGTGAGTGGG - Intronic
1019356644 7:583413-583435 GGGTGTGTGCGTGTGTGCGTGGG - Intronic
1019356648 7:583452-583474 GTGAGTGCACGTGTGTGAGTGGG - Intronic
1019408617 7:897136-897158 ACGTGTCCACGTGTGTGCTGAGG - Intergenic
1019560046 7:1651389-1651411 GTGTGTGCCCGTGTGTGCCTGGG - Intergenic
1019898150 7:3999121-3999143 GCGTGTGTGTGTGTGTGTTTGGG - Intronic
1020017127 7:4837626-4837648 GTGTGTGCATGTGTGTTTTTGGG - Intronic
1021281681 7:18727592-18727614 GAGAGCGCACGTGTGTGCGTGGG - Exonic
1022260536 7:28700213-28700235 GCTTGTGCGCGTGTGTGAGTTGG - Intronic
1022263703 7:28732491-28732513 GCGTGTGTCCCTGTCTGCTTTGG + Intronic
1022701221 7:32762117-32762139 GAGAGTGCACGTGTGGGCTTGGG - Intergenic
1023737807 7:43250114-43250136 GCGTGTGTGTGTGTGTGTTTTGG - Intronic
1024148786 7:46545380-46545402 GAGTGTGCACGTGTGTGCATTGG - Intergenic
1026148964 7:67772007-67772029 GAGTGTGCGTGTGTGTGCGTGGG + Intergenic
1026975685 7:74496572-74496594 GGGTGTGCATGTGTGTGGGTGGG + Intronic
1032688486 7:134259174-134259196 GCATGTTCACATGTGTGTTTGGG - Intronic
1034318629 7:150158863-150158885 CTGTGTGCACGTGTGTGTGTGGG - Intergenic
1034526848 7:151669791-151669813 GTGTGTGCAAGTGTGTGCACAGG - Intronic
1034774123 7:153808337-153808359 GTGTTTGCACGTGTGTGTGTGGG + Intergenic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1035458971 7:159027746-159027768 GCGTGTGTGGGTGTGTGCGTGGG - Intergenic
1035705596 8:1672055-1672077 TTGTGTGCATGTGTGTGTTTGGG + Intronic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036212126 8:6850833-6850855 GCATGTGCAGGTGTGTGTATGGG - Intergenic
1036426225 8:8646860-8646882 GTGTGTGCTAGTGTGTGTTTGGG - Intergenic
1037745903 8:21643830-21643852 GCGCGTGCATGTGTGTGTTTTGG - Intergenic
1037768557 8:21786193-21786215 GGGTGTGTATGTGTGTGCATGGG - Intronic
1039829682 8:41202838-41202860 GTGTGTGTATGTGTGTGTTTTGG - Intergenic
1041456896 8:58070598-58070620 AAGAGTGCATGTGTGTGCTTGGG + Intronic
1041864197 8:62550405-62550427 GCGTGTGCGCGTGTGTGTGGTGG + Intronic
1041999032 8:64100105-64100127 GTGCGTGTAAGTGTGTGCTTAGG + Intergenic
1042007887 8:64202790-64202812 GTGTGTGTACGTGTATGTTTTGG - Intergenic
1043054125 8:75415759-75415781 GTGTGTGCACGTGTGTGTGTTGG + Intronic
1043401601 8:79890664-79890686 GCGTGTATGCGTGTGTGTTTGGG - Intergenic
1044037122 8:87320600-87320622 GTATGTGCACGTGTGTGTGTGGG + Intronic
1046010223 8:108537487-108537509 GTGTGTGCATGTGTGTGTGTGGG + Intergenic
1046019868 8:108651661-108651683 GTGTGTGTATGTGTGTGGTTGGG + Intronic
1046315410 8:112494915-112494937 GTGTGTGTATATGTGTGCTTGGG - Intronic
1046530768 8:115442585-115442607 GTGTGTGCATGTGTGTGTTTGGG + Intronic
1048254127 8:132892655-132892677 GTGTGTGTATGTGTGTGCTGTGG + Intronic
1048293014 8:133194645-133194667 GCGTGTGTGCGTGTGTGGTGGGG + Intronic
1048720942 8:137323802-137323824 GTGTGTGCGTGTGTGTGTTTGGG + Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048985144 8:139731075-139731097 CAGTGTGCACGTGTGTGCCCTGG - Exonic
1048995671 8:139792406-139792428 GCGTGTGCGCGTGTGTGCGTGGG + Intronic
1049355996 8:142188360-142188382 CCATGTGCAGGTGTGTGCTACGG - Intergenic
1049387751 8:142352900-142352922 GCATGTGCACACGTGTGCGTGGG - Intronic
1049398602 8:142413558-142413580 GTGTGTGCACGTGTGTGTGTGGG - Intergenic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050367116 9:4882842-4882864 GTGTGTGCATGTGTGTGCATAGG - Intronic
1051167268 9:14277316-14277338 GTGCGTGCACGTGTGTGCGCGGG - Intronic
1052132857 9:24870851-24870873 GTGTGTGTACGTGTGTGTGTTGG - Intergenic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1053284774 9:36843136-36843158 GTGTGTGCATGTGTGTGTGTAGG + Intronic
1053593127 9:39533681-39533703 CCGTGTGTACGTGTGTGTGTCGG - Intergenic
1053850864 9:42288389-42288411 CCGTGTGCACGTGTGTGTGTCGG - Intergenic
1054573180 9:66831596-66831618 CCGTGTGCACGTGTGTGTGTCGG + Intergenic
1056178668 9:84060826-84060848 GCGTGTGAATGTGTGAGCTCAGG + Intergenic
1056705408 9:88948405-88948427 ATGTGTGCATGTGTGTGCCTGGG + Intergenic
1058299975 9:103359493-103359515 GTGTCTTCACCTGTGTGCTTAGG + Intergenic
1058873281 9:109220745-109220767 GTGTGTGCACGTGCGTGTGTTGG + Intronic
1059332075 9:113542011-113542033 GTGTGTGCACGTGTGTGTGTTGG - Intronic
1059439004 9:114292222-114292244 GCGTGGGCATGTGTATTCTTTGG - Intronic
1059502638 9:114768091-114768113 GAGTGTGCGTGTGTGTGCGTGGG + Intergenic
1060749088 9:126157084-126157106 GGGTGCACACGTGTGTGCATGGG - Intergenic
1060887978 9:127168919-127168941 GCGTGTGCTTGTGTGTGCTGGGG - Intronic
1061235186 9:129337923-129337945 GCCTGTGTCCGTGTGTGCTTGGG + Intergenic
1061526124 9:131164221-131164243 ACGTGTGCATGTGTGAGCTAGGG + Intronic
1062187520 9:135226496-135226518 GAGTGTGCATGTGTGAGCATGGG - Intergenic
1062197974 9:135285094-135285116 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062197990 9:135285216-135285238 GCATGTGCACGTGTGTGCCTGGG - Intergenic
1062198003 9:135285279-135285301 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198016 9:135285342-135285364 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198027 9:135285405-135285427 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198039 9:135285465-135285487 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198051 9:135285528-135285550 GCATGTGCACCTGTGTGCCTGGG - Intergenic
1062198064 9:135285591-135285613 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198075 9:135285654-135285676 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198095 9:135285779-135285801 GCGTGTGCACCTATGTGCCTAGG - Intergenic
1062198104 9:135285839-135285861 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198117 9:135285902-135285924 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198126 9:135285965-135285987 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198141 9:135286028-135286050 GCGTGTGCACCTGTATGCCTGGG - Intergenic
1062198154 9:135286091-135286113 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198167 9:135286154-135286176 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198177 9:135286217-135286239 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198185 9:135286280-135286302 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198194 9:135286340-135286362 GCGTGTGTACGTGTGTGCCTGGG - Intergenic
1062198202 9:135286400-135286422 GTGTGTGCACCTGTGTGCCTGGG - Intergenic
1062198211 9:135286464-135286486 GTGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198221 9:135286524-135286546 GCATGTGCACCTGTGTGCCTGGG - Intergenic
1062198234 9:135286587-135286609 GCGTGTGCACCTGTGTGCCTGGG - Intergenic
1062221705 9:135419541-135419563 GCGTGTGCACGTGTGCTCACTGG - Intergenic
1062253893 9:135611993-135612015 GAGTGTGCACGTGTGTGTGCAGG - Intergenic
1062267023 9:135691305-135691327 TCGTGTGTACGTGTGTGCACTGG - Intergenic
1062328445 9:136023958-136023980 GCATGTGCACGTGTGTGTGGGGG - Intronic
1185480175 X:440136-440158 GTGTGTGCACCTGTGTGTGTGGG - Intergenic
1185567992 X:1110848-1110870 GCGTGTGCATGTGTGTATGTAGG + Intergenic
1185764344 X:2712864-2712886 TTGTGTGCACGTGTGTGTATGGG - Intronic
1185776543 X:2807858-2807880 GTGTGTGCATGTGTGTCCATGGG + Intronic
1187678621 X:21743402-21743424 GTGTGTGCACGTGTGTGTGGTGG - Intronic
1188536114 X:31198885-31198907 GTGTGTGCATGTATGTGTTTTGG + Intronic
1188923243 X:36005671-36005693 GTGTGTGCACATGTGTGCAATGG + Intergenic
1189737732 X:44088570-44088592 GCGTGTGTGCATGTGTGTTTCGG - Intergenic
1191108446 X:56787295-56787317 GTGTGTGCGTGTGTCTGCTTGGG - Intergenic
1192599840 X:72450377-72450399 GTGTGTGCCTGTGTGTGCATAGG - Intronic
1194657514 X:96590720-96590742 GTGTGTGCAAGTGTGTGTATGGG + Intergenic
1194923728 X:99797681-99797703 GAGTGTGTATGTGTGTGCATAGG - Intergenic
1195398121 X:104433047-104433069 GTGTGTGCTTGTGTGTTCTTGGG + Intergenic
1195693746 X:107651009-107651031 GTGTGTGTACCTGTGTGATTTGG + Exonic
1195716591 X:107824974-107824996 GCGTGTGTGTGTGTGTGCTGGGG + Intergenic
1196029946 X:111086091-111086113 GCATGTGCACATGTGTGCACTGG + Intronic
1196047238 X:111269267-111269289 TTATGTGCACGTGTGTGCCTGGG - Intronic
1197288318 X:124623342-124623364 GTGTGTGCATGAGTGTGTTTGGG + Intronic
1198081164 X:133240849-133240871 GTGTGTGCACCTTTGTGCGTAGG - Intergenic
1198441506 X:136667841-136667863 GTGCGTGCACGTGCGCGCTTGGG - Exonic
1198783628 X:140263442-140263464 GGGTGTGTATGTGTGTGTTTTGG + Intergenic
1200058471 X:153473581-153473603 GTGTGTGCGTGTGTGTGTTTTGG + Intronic
1200121484 X:153793147-153793169 GTGTGTGCCTGTGTGTGCGTTGG - Intronic
1200709530 Y:6471109-6471131 GTGTGTGCCATTGTGTGCTTAGG - Intergenic
1201024582 Y:9693599-9693621 GTGTGTGCCATTGTGTGCTTAGG + Intergenic
1201293463 Y:12444263-12444285 ATGTGTGCATGTTTGTGCTTGGG - Intergenic