ID: 1152738393

View in Genome Browser
Species Human (GRCh38)
Location 17:82008543-82008565
Sequence TCCCTCCCGCATCCCAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152738385_1152738393 26 Left 1152738385 17:82008494-82008516 CCGGCTTTGTCAATTTCATTGCT 0: 1
1: 0
2: 0
3: 14
4: 281
Right 1152738393 17:82008543-82008565 TCCCTCCCGCATCCCAGGGTGGG 0: 1
1: 0
2: 0
3: 21
4: 214
1152738384_1152738393 27 Left 1152738384 17:82008493-82008515 CCCGGCTTTGTCAATTTCATTGC 0: 1
1: 0
2: 0
3: 20
4: 201
Right 1152738393 17:82008543-82008565 TCCCTCCCGCATCCCAGGGTGGG 0: 1
1: 0
2: 0
3: 21
4: 214
1152738389_1152738393 -4 Left 1152738389 17:82008524-82008546 CCAATTAGGGGTGACGCTGTCCC 0: 1
1: 0
2: 1
3: 3
4: 39
Right 1152738393 17:82008543-82008565 TCCCTCCCGCATCCCAGGGTGGG 0: 1
1: 0
2: 0
3: 21
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152738393 Original CRISPR TCCCTCCCGCATCCCAGGGT GGG Intronic
900719657 1:4167077-4167099 TGGCTCCTGCATCTCAGGGTGGG - Intergenic
901654581 1:10762103-10762125 CCCCTCCTGCCTCCCAAGGTTGG + Intronic
903851165 1:26306851-26306873 TTCCTCCCGCACCTGAGGGTAGG - Intronic
904542235 1:31240615-31240637 TCCCTACTGCAGCCCAGGGTAGG - Intergenic
905309007 1:37036784-37036806 CTCCTCCTGCATCCCAGAGTGGG + Intergenic
906314101 1:44775369-44775391 CCCTTCCCCCAGCCCAGGGTCGG + Intronic
906637241 1:47417429-47417451 TCCGTCCCCCATCCCTGGGGAGG + Exonic
907043997 1:51288540-51288562 TGCCTCCTGCCTTCCAGGGTAGG - Intronic
907708220 1:56851366-56851388 CCCCTCCCCCATCCCAGTGCAGG + Intergenic
907906952 1:58791227-58791249 TCCCTGCCTCACCCCAGGGAGGG + Intergenic
910241476 1:85091402-85091424 TCCTTCCCACATCTCAGGGATGG - Intronic
914899044 1:151702336-151702358 TCCCTCCCCCTTCCCAGTGTGGG + Intergenic
915663556 1:157424182-157424204 TCCCTCCCCCAGCCAAGGGAAGG + Intergenic
919808900 1:201397052-201397074 TGCCCCCCCAATCCCAGGGTTGG + Intronic
920350639 1:205335797-205335819 TCCCTTCCCCCTCCCAGGGCTGG - Intergenic
920433566 1:205934274-205934296 CCCTTCCAGCATCCCAGGGATGG - Intronic
920840724 1:209551627-209551649 TCCCTCCCTCCTGCCAGGGCTGG + Intergenic
922330776 1:224573758-224573780 TCCCTACCTTTTCCCAGGGTAGG + Intronic
1062858971 10:794889-794911 TCCCTCCCCCACCCCCTGGTAGG - Intergenic
1069089418 10:64181222-64181244 TCACACCCCCATCCCAGGGAAGG - Intergenic
1070351134 10:75593142-75593164 TCCCTCCCCCATCCCAACGTTGG + Intronic
1071087085 10:81876259-81876281 CCCCTCCCCCATCCCAGGTTTGG + Intronic
1071326404 10:84523098-84523120 TGCCTCCTGCCTCCCAGGCTGGG + Intergenic
1072105140 10:92266604-92266626 CCCCTCCCGCTTCCCATTGTAGG - Intronic
1074084178 10:110195025-110195047 TCCCTACCTATTCCCAGGGTCGG - Intergenic
1074490344 10:113934309-113934331 TTCCTCCCCCAGCCCTGGGTTGG + Intergenic
1074861606 10:117514321-117514343 TACCTCCCTCCTCCCAGGTTGGG + Intergenic
1074906161 10:117865692-117865714 TCCCCCCAGCTTCCCAGAGTTGG + Intergenic
1075748318 10:124743501-124743523 TCGCTCCCGCACCCCGGGGGTGG + Intronic
1076728972 10:132428994-132429016 TCCCTCCTGCATCTCATGCTGGG - Intergenic
1076836000 10:133021217-133021239 GCCCTCCCTCAACCCAGGGCTGG - Intergenic
1077112183 11:866725-866747 TCCCTCCCTCCTCCCAGCATGGG - Exonic
1078325869 11:10380369-10380391 TCCTTCCCCCATCCCAGGCATGG - Intronic
1080726636 11:34904700-34904722 TCCCTCCCTAAGCCCAGGCTGGG + Intronic
1084165924 11:67374686-67374708 TCCTTCCCGCAGGCCTGGGTTGG + Intronic
1086279754 11:85171875-85171897 TCCCTCCCTCCTCACTGGGTGGG + Intronic
1088815751 11:113419678-113419700 CCCCTCCCGCAACCCGGAGTAGG + Intronic
1089730151 11:120514097-120514119 TCTCTCCCCCAACCCAGGGCCGG - Intronic
1090365697 11:126203542-126203564 TCCTTCCCGGACCCCAGGGCAGG + Exonic
1094427292 12:30328395-30328417 CCCCTCCCTCATGCCAGGGAGGG + Intergenic
1097277281 12:57822096-57822118 TCCCTCCCTCCTCCTGGGGTGGG - Exonic
1099890181 12:88580535-88580557 TCCCTTCCGGAGCCCGGGGTAGG + Intronic
1100478915 12:94959404-94959426 TCCCTCCAGCCTCCCCAGGTGGG + Intronic
1101379583 12:104202897-104202919 TGCCTCCCTCATGCCAGGGATGG - Intergenic
1101969760 12:109304764-109304786 GCCCTCCCACATCCCAGAGAAGG - Intronic
1102151078 12:110689327-110689349 TGCCTCCCGCCCCGCAGGGTGGG + Intronic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1103361801 12:120358971-120358993 CCCCTCCCCCTTCCCAGGCTGGG - Intronic
1103561272 12:121794304-121794326 TCCACCCTGCAGCCCAGGGTCGG - Intronic
1104758773 12:131284690-131284712 TCCCTCCCCCACCCGAGGTTCGG + Intergenic
1104821828 12:131681835-131681857 TCCCTCCCCCACCCGAGGTTCGG - Intergenic
1104962116 12:132493298-132493320 ATCCTCCAGCATCCCAGAGTAGG - Intronic
1105038904 12:132946669-132946691 TGCCTCCAGCATCCCAGGGCTGG + Intronic
1110568223 13:76977432-76977454 CCCCTACAGGATCCCAGGGTTGG - Intergenic
1112051015 13:95644079-95644101 TCCCTCCCCCATCCCGGGCAGGG + Intronic
1113945094 13:114039552-114039574 ACCCTCCCACGTCCCAGGGTTGG + Intronic
1114257886 14:21018168-21018190 TCCCTTCCCCATCCCATGGACGG + Intronic
1114803911 14:25811796-25811818 TCCCTCCAGCATGCAGGGGTGGG + Intergenic
1117588343 14:57237772-57237794 TCCCTCCCCATTCCCATGGTTGG + Intronic
1118607737 14:67515567-67515589 TGCCTCCCGCAGCCCGGGGTCGG + Intronic
1118827699 14:69398856-69398878 TCCTTTCCTCATCCCAGGCTCGG + Exonic
1119560741 14:75587549-75587571 TCCCTCCCTCATCCCAGCTCTGG - Intronic
1121033962 14:90683654-90683676 TCCCTCACGCAGCCCAGTGCAGG + Intronic
1121199574 14:92106307-92106329 TCCCTCCCGGCTCCCAGGGCGGG + Intronic
1121342020 14:93111056-93111078 TCCTTCCAGCAGCCCAGGGATGG - Intronic
1121562451 14:94885414-94885436 TTCCTGCCGCACCCCATGGTAGG - Intergenic
1122571303 14:102704303-102704325 TTCCTCCCTGATCCCAGGGTAGG + Intronic
1122751564 14:103937614-103937636 CCCCTCCCCCATCCCAAGGGGGG + Intronic
1122761677 14:104033378-104033400 TCCCTGCTGTAACCCAGGGTGGG + Intronic
1122828171 14:104382421-104382443 TACCTCCGGCATCACAGGGCCGG + Intergenic
1125725710 15:41867156-41867178 GCCCTGCCCCAGCCCAGGGTGGG - Intronic
1125881116 15:43196972-43196994 TCCCTCCCCCACCCCAGAGCTGG + Exonic
1126124532 15:45283451-45283473 TCCCTCCTGTAGCCCAGGCTGGG - Intergenic
1126781635 15:52144023-52144045 CACCTCCCACATGCCAGGGTGGG + Intronic
1126956244 15:53936292-53936314 TCCATCCCTCATCACTGGGTAGG + Intergenic
1129772073 15:78208742-78208764 TCCCCCTCGCCTCCCAGGCTCGG + Intronic
1132300314 15:100771275-100771297 TCCCTCCCTCTTCCCAGGTGTGG + Intergenic
1132887664 16:2189659-2189681 GCCCTCCCACCCCCCAGGGTTGG - Intronic
1132887716 16:2189814-2189836 TTCCCCCCACCTCCCAGGGTTGG - Intronic
1132939466 16:2499698-2499720 TCCCACCCCCACCCCAGGGCAGG - Intronic
1133203168 16:4217055-4217077 TCCCTCCAGCTTCCCTGGATTGG - Intronic
1138431238 16:56970539-56970561 ACTCTCCTGCTTCCCAGGGTGGG + Intronic
1138493774 16:57394434-57394456 TGCCTCCCTGATCCCTGGGTGGG + Intergenic
1138572400 16:57884290-57884312 TCCCTCCGGCCTCCCAAGGGAGG + Exonic
1140065286 16:71606235-71606257 TTCCTCCCACATTCCAGGGCTGG + Intergenic
1141886480 16:86895781-86895803 TCTCTCCCTCTTCCCAGGGAAGG - Intergenic
1144061418 17:11585994-11586016 GCCCACCCGTATCCTAGGGTGGG + Intergenic
1144626639 17:16847304-16847326 TCCCTGCCTCAGCCCAGGGCGGG - Intergenic
1144879793 17:18425407-18425429 TCCCTGCCTCAGCCCAGGGTGGG + Intergenic
1145062847 17:19743562-19743584 TCACTCACCCAGCCCAGGGTGGG + Intronic
1145152441 17:20518977-20518999 TCCCTGCCTCAGCCCAGGGTGGG - Intergenic
1145202021 17:20954002-20954024 TCCCTCCAGCATTTCAGAGTTGG - Intergenic
1146093484 17:29905697-29905719 TCCCTCCCTCAGGCCAGGGAGGG + Intronic
1146163784 17:30573182-30573204 TCCCTGCCTCAGCCCAGGGCAGG - Intergenic
1146739584 17:35270777-35270799 TCCCTCCCCTACCCCAGGGTTGG + Exonic
1147155655 17:38543436-38543458 CCCCTTCTGCACCCCAGGGTAGG + Intronic
1147580780 17:41625994-41626016 TCCCTGCCTCAGCCCAGGGCGGG - Intergenic
1148127436 17:45244083-45244105 TCCCTGCCGCAGCCCAGGCTGGG - Intronic
1151711310 17:75808592-75808614 TCCTTCCTGCATCCCAGCCTGGG + Intronic
1152738393 17:82008543-82008565 TCCCTCCCGCATCCCAGGGTGGG + Intronic
1152782102 17:82231172-82231194 TCCCTCCCCCTCCCCCGGGTGGG + Intronic
1153280753 18:3411930-3411952 TCCCGCCCGCATCTCGGGGTGGG + Intronic
1155047530 18:22115834-22115856 TCACTCCCCCATCCCAGCCTAGG - Intergenic
1157751523 18:50182912-50182934 TCCCTCACAGTTCCCAGGGTGGG - Intronic
1160854813 19:1211992-1212014 TCCCTCCCGCTGCCCAGAGAGGG - Intronic
1161337373 19:3721808-3721830 CCCCTCCCCCAGCCCGGGGTGGG + Exonic
1161343237 19:3753981-3754003 CCCCACCCGCATCCCTGGGGCGG + Intronic
1162016569 19:7849580-7849602 TCTCTGCCACATCTCAGGGTTGG + Intronic
1162067414 19:8134511-8134533 TGCCTCCCACACCCCAGGGAGGG - Intronic
1163364050 19:16866304-16866326 TCCCTGAAGCATCCCAGGGCTGG - Intronic
1163686518 19:18714910-18714932 TCCTTCCCGAAGCCCAGGCTGGG - Intronic
1164591643 19:29510900-29510922 GCCCTCCCGCATTCCTGGGGTGG - Intergenic
1165461972 19:35949304-35949326 TCCCTCCCCCATCTAAGGGGTGG - Intergenic
1167123284 19:47531850-47531872 TCTCTCCTGCATCTCAGGGAGGG + Intronic
1167377172 19:49118476-49118498 TCTGTCCTGCATCCCTGGGTTGG + Exonic
925810451 2:7695066-7695088 TCTCTCCTGCATCCTAGGCTAGG - Intergenic
926012921 2:9423040-9423062 CGCCTCCCGCCTCTCAGGGTCGG - Exonic
928316831 2:30252884-30252906 TCTCACCCTCAGCCCAGGGTAGG - Intronic
929436507 2:41932578-41932600 TCCCTCACGCAGCCAAGGATGGG - Intergenic
929827342 2:45319507-45319529 TGCCTCCCGCTTCCAAGCGTGGG + Intergenic
931763561 2:65436091-65436113 GCCCTCCCCCCTCCCAGGGGCGG + Intergenic
932750401 2:74367936-74367958 TGACTCCCTCACCCCAGGGTGGG - Intronic
936460727 2:112712251-112712273 TCCTTCTGGCATCCCTGGGTGGG + Intergenic
936713811 2:115162091-115162113 CGCCTCCCGCTTCCCAGGCTGGG + Intronic
937042571 2:118833785-118833807 TCCCTCCCGCTACCCCGGGTGGG - Intergenic
937361478 2:121232872-121232894 TGCCACCGGCAACCCAGGGTGGG + Intronic
938107591 2:128543903-128543925 TTCCTCCCGTCTCCCAGCGTTGG - Intergenic
942045550 2:172097318-172097340 GCCCTCCCGACTCCCAGGCTTGG + Intergenic
945025566 2:205616617-205616639 TCCCTCCCACATTCCAGGCATGG + Intronic
946603780 2:221379585-221379607 TTCCCCCAGCAACCCAGGGTGGG - Intergenic
947340514 2:229133923-229133945 TCCCTCCCACCTCCCTGAGTTGG + Intronic
947787722 2:232838812-232838834 CCCCTCCCCCACCCCAGGGCAGG + Intronic
948079325 2:235192618-235192640 TCCCTCCCCCACCCCACGATAGG + Intergenic
948541024 2:238691524-238691546 TCCCTCCTCCATCCCAGGCATGG + Intergenic
948854930 2:240725615-240725637 TCCCTCAGGCAGCCCAGGGGTGG - Intronic
948874924 2:240821062-240821084 TCCCTCCACCGTCCCAGGGCTGG + Intergenic
1172094482 20:32453963-32453985 TCCCTGCGGCAGCCCAGGGAGGG - Intronic
1172165284 20:32895047-32895069 TCCCTCCTCCATCCCTGGGAGGG + Intronic
1173847174 20:46195572-46195594 GCACTCCCGCCTCCCAGTGTTGG + Intronic
1175946698 20:62562272-62562294 TGCCTCCCGCCTCCCAGGCATGG - Intronic
1176390567 21:6161041-6161063 TCCCTCCAGCAGCCCCAGGTAGG - Intergenic
1179732900 21:43377198-43377220 TCCCTCCAGCAGCCCCAGGTAGG + Intergenic
1179999399 21:44988220-44988242 TCCTTCCCGCAACCCAAGGAAGG + Intergenic
1180959277 22:19755359-19755381 ACCCGCCCGCCTCCCAGGCTCGG + Intergenic
1182288028 22:29259467-29259489 GCCCTCCCGCATCTCAGGTTGGG + Exonic
1182494099 22:30694478-30694500 CCCCTCCCCCAACCCAGGCTGGG - Intronic
1182572272 22:31248319-31248341 TCCCTCCCTCATTCAGGGGTGGG + Intronic
1183354407 22:37350668-37350690 TCCCATCAGCACCCCAGGGTGGG + Intergenic
1183364291 22:37399090-37399112 TCCCTCCCCACTCCCAGGGATGG + Intronic
1184033122 22:41906266-41906288 TCCCACCAGCCTCCCAGGGCTGG - Exonic
1184528792 22:45041354-45041376 TCCCTCCCCCAGCCTAGGGCTGG + Intergenic
1185282878 22:49983218-49983240 TCCCTCCAGACTCCCGGGGTAGG + Intergenic
952931413 3:38364016-38364038 TCTCTCCCGAATCCCAGGCCTGG + Intronic
953406863 3:42664063-42664085 TGCTTCCTGCCTCCCAGGGTTGG + Intronic
953480011 3:43243268-43243290 CCCCTCCCCCATTACAGGGTGGG + Intergenic
954800351 3:53183594-53183616 CCCCTCCTGCAGCCCAGGGGCGG - Intronic
955594557 3:60574571-60574593 TCCCTCAAGAATCCCAGGCTGGG + Intronic
957738886 3:84236862-84236884 ACCCTCCCGTCTCCCATGGTGGG - Intergenic
962035574 3:131648007-131648029 TTTCTCCCCCATCCCAGGATAGG + Intronic
964316949 3:155455214-155455236 TGGCTTCTGCATCCCAGGGTCGG - Intronic
968834686 4:2954930-2954952 TCCCTCCCACCTCCCTGGGCAGG + Intronic
968843623 4:3026709-3026731 GCTCTCCCGCCTCCCAGGGTGGG + Intronic
972533012 4:39977411-39977433 TCCCTCCAGCAGCCTAGGGCGGG + Intronic
975466475 4:74714878-74714900 TCCCTCCCACATACCAGAATAGG + Intergenic
975791072 4:77951738-77951760 TTCCTCCCGCATCCCAAAGGTGG + Intronic
977526770 4:98155717-98155739 GCCCTCCTGCACTCCAGGGTGGG + Intergenic
982670379 4:158313790-158313812 TCCCTCCGGAACCTCAGGGTTGG + Intergenic
984698956 4:182806465-182806487 CCCCTCCTGCATCCCCGGGCGGG + Intergenic
985542645 5:493966-493988 TCCCTCCCTCATTCCAGGCCAGG - Intronic
986337373 5:6765785-6765807 TCCCTCCCGCATGCCAGGCCTGG + Intergenic
988145739 5:27304446-27304468 TTCCTACCGCATCCCAAGATGGG + Intergenic
988524120 5:31971471-31971493 TCCCTCCAAAATCCCAGTGTTGG - Intronic
988900067 5:35722286-35722308 TCCCTGCCCCATGCCAGGGCTGG - Intronic
997457161 5:134025988-134026010 TCCCTCCCCCAGGCCAGGCTCGG - Intergenic
998415587 5:141944138-141944160 TCCCTCCCCCATCCCCTGGAAGG + Exonic
1000019561 5:157307271-157307293 TCCTTGCTGTATCCCAGGGTGGG - Intronic
1000363534 5:160469759-160469781 TCCTCCCCGCATCCCAGGCCTGG - Intergenic
1000365238 5:160484592-160484614 TCCCTCCCTCTTCTCAGGCTTGG - Intergenic
1001300082 5:170527092-170527114 TCCCTCCCTCATCACAAGGCTGG + Intronic
1001422183 5:171596408-171596430 TGCCTCCCCCATCCCTGGATGGG - Intergenic
1001983315 5:176051949-176051971 CCCCTCCCGCTTCCCAGGCGAGG - Intronic
1002065151 5:176648038-176648060 CGCATCCCACATCCCAGGGTAGG - Intronic
1002137166 5:177114894-177114916 TCCCTCCCCCATCCCAGCCAAGG + Intergenic
1002234150 5:177792103-177792125 CCCCTCCCGCTTCCCAGGCGAGG + Intronic
1002418656 5:179134397-179134419 ACCCTAACTCATCCCAGGGTTGG + Intronic
1005050938 6:21683390-21683412 TCCTTCCCACATCCCAGGATTGG + Intergenic
1005650329 6:27879570-27879592 TCCCTCCCTCCTCCTGGGGTGGG - Intergenic
1006582258 6:35083853-35083875 CCCCTCCCACCTTCCAGGGTGGG - Intronic
1007243184 6:40441875-40441897 TCCCTCCAGGTTCCTAGGGTTGG - Intronic
1007924979 6:45643200-45643222 TCCCTCCCACATCACAGACTGGG + Intronic
1011887352 6:92113109-92113131 TCCCTCCACCATTCCAGAGTAGG - Intergenic
1019485101 7:1285700-1285722 TCCTTCCCACACCCCAGGGCAGG - Intergenic
1019625968 7:2015763-2015785 GCCCTCCCGCACACCTGGGTGGG - Intronic
1019748305 7:2712851-2712873 TCTCTTCCCCATCCCAGGGACGG - Exonic
1019992776 7:4703501-4703523 TCCCTCCCGCGCAGCAGGGTCGG - Intronic
1020461996 7:8436703-8436725 GCACTCCCGCAGCCCAGGATGGG - Intronic
1020707031 7:11558116-11558138 TGCCTCCCACATCTCAAGGTTGG - Intronic
1021085865 7:16420907-16420929 TCCCTCCCGCATTTCAGAGATGG - Intronic
1026324357 7:69295996-69296018 TCCCTCCTGCACCCCACAGTGGG + Intergenic
1032194315 7:129780600-129780622 CCCCTCCCCCCTCCCAGGGTCGG - Intergenic
1033339223 7:140479089-140479111 TCCCTCCCGCGCCGCAGGCTTGG + Intronic
1034020032 7:147632347-147632369 TCCCTCCCGCAACACTGGGTTGG - Intronic
1034698399 7:153075303-153075325 TCCCTCCTGCCTCTCTGGGTGGG + Intergenic
1035327652 7:158075380-158075402 TCTCTCCGGCAGCCCAGGGGAGG + Intronic
1038644630 8:29351506-29351528 TCCCGCCCGAAGCCCAGGATCGG + Intergenic
1040847478 8:51859054-51859076 TACCTCCCCCATCCCAAGTTTGG + Intronic
1041084075 8:54241289-54241311 TCTCTCCTGTATCCCAGGCTGGG + Intergenic
1042064528 8:64859204-64859226 TCCCTCCTGCCTCACAGGCTGGG + Intergenic
1049265288 8:141664592-141664614 TCCCTCTGGCATCTCAGGGCTGG - Intergenic
1049412009 8:142477728-142477750 TCCCACCCATATCCCAGGCTGGG + Intronic
1049547313 8:143239154-143239176 TCCCTCCTGCATGACGGGGTAGG - Intergenic
1051458789 9:17290822-17290844 TCCCTCGCGCTTCCCAGGTGAGG + Intronic
1055920529 9:81455427-81455449 GCCCTCTCCCATCCCAGGGCAGG - Intergenic
1059429805 9:114243281-114243303 AGCCTCCCCCATCCCTGGGTTGG - Intronic
1060213921 9:121726956-121726978 GCCCACCAGCATTCCAGGGTGGG - Intronic
1060585007 9:124780339-124780361 TCCCTCCAGCATCAAGGGGTGGG + Intronic
1061527549 9:131179353-131179375 TCCCTCCCGCTGCCCTGGGCAGG + Intronic
1062000523 9:134213669-134213691 TCCTTCCAGAATCCCAGGGGAGG + Intergenic
1062490310 9:136802035-136802057 TGCCTCCGGCCTCCCAGTGTTGG + Intronic
1185617432 X:1432020-1432042 TCCCCACCGCAGCCCAGCGTTGG + Intronic
1187248801 X:17578370-17578392 TGCCTCCTGCATCCCAGCATTGG + Intronic
1189197772 X:39166456-39166478 TCCCTCCACTACCCCAGGGTGGG + Intergenic
1189307552 X:39998168-39998190 TCCATCTCTCATTCCAGGGTCGG - Intergenic
1189332710 X:40153267-40153289 TTCCTCGCGCACCCCAAGGTTGG - Intronic
1190076957 X:47323840-47323862 TCCCTCTCCCATCCCCCGGTTGG - Intergenic
1190258504 X:48783074-48783096 TCCCTCCCCCATCCCCGTGGAGG - Intergenic
1192082432 X:68061279-68061301 TGCCGCCAGCAGCCCAGGGTAGG + Intronic
1193112416 X:77743169-77743191 TCCCTAAATCATCCCAGGGTCGG - Intronic
1194040712 X:88938703-88938725 TCCCTCACTCTTCACAGGGTAGG - Intergenic
1194247585 X:91534936-91534958 CCCCTCCCCCACCCCAGGCTTGG - Intergenic
1197746129 X:129932867-129932889 TTCCTCCCGCAGCCCAGGCCGGG + Intergenic
1197891839 X:131276884-131276906 TCCACCCACCATCCCAGGGTTGG + Intronic
1198060636 X:133042427-133042449 TCCCTCCCTCAGCCAAGGGAAGG - Intronic
1199846073 X:151694069-151694091 TCCCACCCCTATCCCAGGGCGGG - Intergenic
1200566607 Y:4776469-4776491 CCCCTCCCCCACCCCAGGCTTGG - Intergenic
1200755392 Y:6985702-6985724 GCCTTCCTGCATCCCAGGGGTGG + Intronic