ID: 1152739076

View in Genome Browser
Species Human (GRCh38)
Location 17:82011258-82011280
Sequence AGGGGCCTCCCCCAGGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 306}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152739067_1152739076 2 Left 1152739067 17:82011233-82011255 CCGGGCGGCAGCAGCCCAAGGTC 0: 1
1: 0
2: 1
3: 22
4: 213
Right 1152739076 17:82011258-82011280 AGGGGCCTCCCCCAGGGAAAGGG 0: 1
1: 0
2: 3
3: 25
4: 306
1152739062_1152739076 17 Left 1152739062 17:82011218-82011240 CCTGTACCCAGACGGCCGGGCGG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 1152739076 17:82011258-82011280 AGGGGCCTCCCCCAGGGAAAGGG 0: 1
1: 0
2: 3
3: 25
4: 306
1152739064_1152739076 11 Left 1152739064 17:82011224-82011246 CCCAGACGGCCGGGCGGCAGCAG 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1152739076 17:82011258-82011280 AGGGGCCTCCCCCAGGGAAAGGG 0: 1
1: 0
2: 3
3: 25
4: 306
1152739065_1152739076 10 Left 1152739065 17:82011225-82011247 CCAGACGGCCGGGCGGCAGCAGC 0: 1
1: 0
2: 0
3: 19
4: 235
Right 1152739076 17:82011258-82011280 AGGGGCCTCCCCCAGGGAAAGGG 0: 1
1: 0
2: 3
3: 25
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152739076 Original CRISPR AGGGGCCTCCCCCAGGGAAA GGG Intronic
901686692 1:10947344-10947366 ATGGACCTCCCCGAGGGAAGAGG - Intronic
901800519 1:11705474-11705496 AAGCCCCTCCCCCAGGGGAAGGG + Intronic
902414470 1:16230764-16230786 AGGGGAAGTCCCCAGGGAAAGGG - Intergenic
902734368 1:18390495-18390517 GCAGGCCTCCCCCAGGGAGAGGG + Intergenic
903479932 1:23645614-23645636 AGGGACTTCCCCCAGAGTAATGG + Intergenic
903499856 1:23794953-23794975 GGGGCCCGCCTCCAGGGAAATGG - Exonic
903738629 1:25545236-25545258 TGGGGCAGCCCCCAGGGAAGTGG + Intronic
904044134 1:27600183-27600205 ATGGGCCCCCCCCAGGGAGGGGG - Intronic
904306360 1:29592753-29592775 AGAGACCTCCCCCATGGAAGGGG + Intergenic
904611360 1:31727905-31727927 AAGGGCCTCCCCCACGGCATGGG - Intronic
904713271 1:32447777-32447799 TGGTGCCTCCCCTAGGGGAAGGG - Intergenic
904882890 1:33714172-33714194 TGGGGACTCCCCCTGGGCAAAGG + Intronic
905519148 1:38584656-38584678 ATGGGGCTGCCCAAGGGAAATGG + Intergenic
906075240 1:43047181-43047203 AGGGACCTCCACCTGGGCAAAGG - Intergenic
906307226 1:44727027-44727049 AGGCCCCTCCCCCTGGGAGAAGG - Intergenic
906531431 1:46526187-46526209 AGGGGACTTCCCCAAGGGAAGGG - Intergenic
906943393 1:50275492-50275514 AGGGGCTGCCCCGAGGGAAGGGG + Intergenic
907425746 1:54378458-54378480 AGGGCCCTTTACCAGGGAAAGGG + Intronic
907554577 1:55333443-55333465 AGGGGCTTGGCCCAGTGAAAAGG + Intergenic
908322434 1:62991383-62991405 AGGAGCCTCCCCCAGGTGCAAGG - Intergenic
912458771 1:109817577-109817599 AGTGGCCTCCCCCAGGGCCCTGG + Intergenic
913571447 1:120124243-120124265 AAGGGTCTCTCCCAGGGAAAAGG - Intergenic
914292259 1:146285220-146285242 AAGGGTCTCTCCCAGGGAAAAGG - Intergenic
914553303 1:148736003-148736025 AAGGGTCTCTCCCAGGGAAAAGG - Intergenic
915323575 1:155069392-155069414 AAGGTGCTGCCCCAGGGAAAAGG - Exonic
915734947 1:158078668-158078690 GGGGGCCTCCTCCAGGAACAGGG + Intronic
917843184 1:178999358-178999380 AGGGGCCTCACCCAGGAACTTGG - Intergenic
920348704 1:205323353-205323375 AGGGGTTTCCCTCAGGGAAGAGG - Intergenic
922722447 1:227905824-227905846 AGGGCCCTTCCCCAGGGAAGCGG - Intergenic
924012756 1:239684238-239684260 AGGGGACTCACCCAGGGACTGGG - Intronic
924384641 1:243489838-243489860 CGGGGCCACCAGCAGGGAAAAGG + Intronic
1063611938 10:7570135-7570157 AGGGATGTCCCCCTGGGAAATGG - Intronic
1063701943 10:8393628-8393650 AGGGGCCTCCCCCAGTAGAGCGG + Intergenic
1064461044 10:15535159-15535181 AGCTGCCTCCCCCAGGGGCAGGG + Intronic
1065501935 10:26391748-26391770 AGGCGCCTCCCCCAGGGTCTAGG + Intergenic
1066207849 10:33207457-33207479 AGGGGCCTCCCAAGGGAAAAGGG + Intronic
1067944324 10:50680824-50680846 AGGGGACTTCCCTAGGGGAATGG - Intergenic
1069629356 10:69888502-69888524 AGTGGCCTTCCCCAGGGCACAGG + Intronic
1069872685 10:71542818-71542840 CTGTGCCTCCCCCAGGGGAAGGG - Intronic
1069887210 10:71631387-71631409 AGGAGCCACCCCCAAGGGAAGGG + Intronic
1070153292 10:73818415-73818437 AGGGGCTGCCACCAGGGTAAGGG + Intronic
1070688538 10:78507894-78507916 AGGGTCCTGCCCCAGGGCTAGGG - Intergenic
1070865824 10:79707695-79707717 AGGGGACTTCCCTAGGGGAACGG - Intronic
1070879617 10:79845826-79845848 AGGGGACTTCCCTAGGGGAACGG - Intronic
1071499220 10:86191657-86191679 AGGGGCCACCCTGAGGGAACTGG - Intronic
1071632723 10:87229916-87229938 AGGGGACTTCCCTAGGGGAACGG - Intronic
1071646172 10:87362134-87362156 AGGGGACTTCCCTAGGGGAACGG - Intronic
1074474144 10:113754384-113754406 AAGGGACTCCCTCAGGGGAAGGG - Intronic
1075228856 10:120654468-120654490 CGTGGTCTCCCCCAGGGAAATGG + Intergenic
1076843901 10:133059787-133059809 AGGGCCCTCCCTGAGGGACACGG + Intergenic
1076904251 10:133354468-133354490 AGGGGCTTCCCCCAGGGCCTGGG - Intergenic
1077095133 11:795950-795972 AGGGGCCTCCCATAGGGTCATGG + Intronic
1077161078 11:1113169-1113191 CGGGGCCTCCTCTAGGGAAGGGG - Intergenic
1077161098 11:1113215-1113237 CGGGGCCTCCTCTAGGGAAGGGG - Intergenic
1077161118 11:1113261-1113283 CGGGGCCTCCTCTAGGGAAGGGG - Intergenic
1077161138 11:1113307-1113329 TGGGGCCTCCTCTAGGGAAGGGG - Intergenic
1077161158 11:1113353-1113375 CGGGGCCTCCTCTAGGGAAGGGG - Intergenic
1077161178 11:1113399-1113421 CGGGGCCTCCTCTAGGGAAGGGG - Intergenic
1077218028 11:1403184-1403206 AGGGCACTGCCCCAGGGGAAGGG - Intronic
1077465207 11:2730693-2730715 ATCCGCCTCCCCCAGGGTAATGG - Intronic
1078322865 11:10352451-10352473 AGGGACCTGCGCCAGAGAAAGGG - Intronic
1080013778 11:27483903-27483925 TGGGGCCTCCCTCCGGAAAATGG + Intergenic
1080614886 11:33937275-33937297 ACAGGCTTTCCCCAGGGAAAGGG - Intergenic
1080857885 11:36128262-36128284 AGGGGTCTGGCCCAGGGACAGGG + Intronic
1081695370 11:45105743-45105765 AGAGGCTGCCCCCAGGGAGAGGG - Intronic
1082122702 11:48396455-48396477 AGGTGCCTCTACCAGGTAAATGG + Intergenic
1083270151 11:61568062-61568084 AAAGGCCTCCCCCAGGGCAGAGG + Intronic
1083724650 11:64621886-64621908 AGGGGCCTGCACCTGGGGAATGG - Intronic
1083871216 11:65489624-65489646 ATGTGCCTCCCCCAGAGTAAGGG + Intergenic
1084032798 11:66491189-66491211 AGAGGCCTCACTCAGAGAAAAGG - Intronic
1084320975 11:68373272-68373294 AGGTGCCTTCCCCAAGGAAGGGG + Intronic
1084389742 11:68867281-68867303 CAGGGCCTACCCCAGGGAATTGG + Intergenic
1085470219 11:76752907-76752929 AGGGACTTCCCCCAGGGGCAGGG + Intergenic
1088401035 11:109422850-109422872 AGGGGTATCCCCCTGGGAATGGG + Intronic
1088642768 11:111889402-111889424 TGGGGCCTCCCTCTGGAAAATGG - Intergenic
1089662513 11:119994563-119994585 AGGGGCCTCCACTGGGGAGAAGG - Intergenic
1090363196 11:126187214-126187236 AGGGGCTCTCCCCAGTGAAAAGG + Intergenic
1090400182 11:126443886-126443908 AGGGGCCTCCCAAAGGGCAGTGG + Intronic
1091303355 11:134521844-134521866 AGGGGCCCCACCCAGGGAGTAGG + Intergenic
1093985575 12:25528708-25528730 AGGGGCCTCTTCCATGGAAATGG - Intronic
1094364447 12:29665206-29665228 AAGGGCCTCCTCCAGGTGAAGGG - Intronic
1094473177 12:30822437-30822459 TGGCGCCGCCCACAGGGAAAGGG - Intergenic
1096529477 12:52233985-52234007 ACGGTCCTCTCTCAGGGAAAGGG - Intronic
1096631124 12:52927367-52927389 TTGGGCCTCCCCTGGGGAAAGGG + Intronic
1096809681 12:54161435-54161457 AGGGGCCTTCCCCAGGCACCAGG + Intergenic
1102303395 12:111787444-111787466 AGGGTCCTCCCTCAGGAATATGG - Intronic
1103827796 12:123753948-123753970 AGGGGCCCCTGACAGGGAAAGGG - Intronic
1104736782 12:131139939-131139961 AGGGGACCCCCCCAAGGACAGGG - Exonic
1105288895 13:19033310-19033332 TGTGGCCCTCCCCAGGGAAAAGG + Intergenic
1105403979 13:20118843-20118865 GGGGGCATCCCGCAGGGAAGGGG - Intergenic
1107135309 13:36938124-36938146 AAGGGCCTACCCCAAAGAAAAGG + Intergenic
1113393278 13:109918438-109918460 ATGGGCCGCCACCAGGGAACAGG - Intergenic
1113803324 13:113097461-113097483 GGGGGGCTCTCCCATGGAAACGG + Intronic
1118484226 14:66198602-66198624 GGGTGCTACCCCCAGGGAAAGGG - Intergenic
1118488230 14:66234136-66234158 AGGGGCCAGGCCCAGGGAGAAGG + Intergenic
1119258450 14:73220602-73220624 AGGGGCCTCCAGCAGCGAAGGGG + Exonic
1119618828 14:76116586-76116608 AGGGGCCTCCCACAAGGCAATGG - Intergenic
1119690106 14:76664957-76664979 AGGTGTCTTCCCAAGGGAAAAGG + Intergenic
1121519460 14:94576246-94576268 AGGAGACTCCCCCAGGGAGCAGG - Intronic
1121570041 14:94940575-94940597 AGGGGCCCTGCCCAGGGAATGGG + Intergenic
1123189918 14:106559258-106559280 AGGACTCTACCCCAGGGAAAGGG + Intergenic
1123827810 15:24101270-24101292 AGGAGCCTCCCCAGGGGACAGGG - Intergenic
1123842266 15:24260681-24260703 AGGAGCCTCCCCAGGGGACAGGG - Intergenic
1123857293 15:24426743-24426765 AGGAGCCTCCCCAGGGGACAGGG - Intergenic
1123861921 15:24477271-24477293 AGGAGCCTCCCCGGGGGACAGGG - Intergenic
1127766041 15:62186699-62186721 AGCTGCCTCCCCCAGGGGCAAGG - Intergenic
1129321561 15:74777833-74777855 TTGGGCCTGCCCCAGGGGAATGG - Intergenic
1129464528 15:75716485-75716507 AGGGCCCGCCCTCAGGGAATTGG + Intergenic
1129720719 15:77876527-77876549 AGGGCCCGCCCTCAGGGAATTGG - Intergenic
1130596811 15:85254758-85254780 AGGGGCCACCCCCAAGGCAGTGG + Intergenic
1131066242 15:89436540-89436562 AGGGGCCACCCCCAGGGGATCGG - Intergenic
1132304598 15:100802252-100802274 AAAAGCCTCCCCCAGGGAAGCGG + Intergenic
1132307352 15:100825961-100825983 AGGTGGCTCCCCCAGGGATTTGG + Intergenic
1132932700 16:2467124-2467146 AGGGGGCGCCTCCAGGGACAGGG + Intergenic
1133015539 16:2937879-2937901 AGGTGCATCCCCCAGGGCAGGGG - Intronic
1133017275 16:2949895-2949917 AGGGGTCTCCCCCTGGGCACTGG - Exonic
1134888222 16:17814096-17814118 AGCGAGCTCCTCCAGGGAAAAGG + Intergenic
1136254560 16:29029476-29029498 GGAGGCCTCCCCCAGGGAGGTGG + Intergenic
1136566854 16:31075694-31075716 AGAGGCCTCCTTCAGGGAAAGGG - Intronic
1136912245 16:34154049-34154071 AGGGGCCTCCAGAAGGGAGAGGG - Intergenic
1138459348 16:57138840-57138862 AGCCTCCTCCCCCAGGGAAAGGG + Intronic
1138625657 16:58249563-58249585 AGGGGCCTCCCAGTGGGACAGGG + Intronic
1141509626 16:84504300-84504322 AGGTGCTTCCCCCAGGGCCAAGG - Intronic
1141605586 16:85151736-85151758 AGGGGCCTCTCCCAGGAGGAGGG - Intergenic
1141805332 16:86337958-86337980 AGGGGCATCACCCAGGTGAATGG - Intergenic
1141866778 16:86755719-86755741 AGGGTCCTCCCCCAGGTGGATGG + Intergenic
1142186244 16:88696020-88696042 AGGGGCCACCACCAGGGCCATGG - Intergenic
1142361869 16:89631169-89631191 ATGGGCCTCCCCCCGGGAGAAGG - Intronic
1142428571 16:90013671-90013693 AGGGGCCCCGCCCAGTGAGAGGG - Intronic
1142591357 17:1007447-1007469 GGGGACCTCCCCCGGGGGAAGGG + Intronic
1142757071 17:2022903-2022925 AGGAGCCTCCCCCCGGGGAGCGG + Intronic
1143317074 17:6040924-6040946 GGGGGCCACCCCCTTGGAAAAGG - Intronic
1143491218 17:7286290-7286312 AGCTGCCTCCTCCAGGGACAAGG - Intronic
1144755134 17:17675471-17675493 AGAAGCCTCTGCCAGGGAAAGGG - Intergenic
1145259104 17:21344109-21344131 AGGGGCCTCCCGCAGGGCCCTGG - Intergenic
1145317514 17:21743894-21743916 AGGGGCCTCCCGCAGGGCCCTGG + Intergenic
1146579147 17:34021464-34021486 AGAGCCCTGCCCTAGGGAAAAGG - Intronic
1147140985 17:38460629-38460651 TGGGAGCTCCCCCAGGGAAGGGG + Intronic
1147332157 17:39705509-39705531 GGAGGCCTCCCTCAGGGACATGG + Intronic
1148689650 17:49519960-49519982 AGCAGCCTCCCCCAGGCATATGG - Intergenic
1148837040 17:50470735-50470757 AGGTGGCTGCTCCAGGGAAACGG + Intronic
1152070267 17:78130814-78130836 AGGGGACTCCTCCAGGGACTTGG + Exonic
1152287099 17:79419242-79419264 AGAGGCCTCTCACGGGGAAAAGG - Intronic
1152314570 17:79572608-79572630 TGGGGCCACCTCCGGGGAAAGGG - Intergenic
1152641601 17:81451725-81451747 AGCGGCCTCCACCAGGGACCAGG - Exonic
1152645094 17:81465152-81465174 AGGGGCCTTCCCCAAGGGCAGGG - Exonic
1152739076 17:82011258-82011280 AGGGGCCTCCCCCAGGGAAAGGG + Intronic
1153775921 18:8453819-8453841 AGTGGCTTCCCACAGGGAAAAGG + Intergenic
1153992266 18:10411036-10411058 AGGGGCCTCTCCCTGGCAGAGGG - Intergenic
1154162956 18:11993652-11993674 AGGGGCCTCAGCCAGGGCAGTGG + Intronic
1154470826 18:14699318-14699340 TGTGGCCCTCCCCAGGGAAAAGG - Intergenic
1155248493 18:23933965-23933987 AGGGGAATCCTCCAGGGAAGAGG - Intronic
1155873553 18:31056434-31056456 AGGGACCAACCCCAGGAAAAGGG - Intergenic
1156365723 18:36425033-36425055 AAGTGCGTCCCCTAGGGAAAAGG + Intronic
1157573863 18:48730858-48730880 AGGGGCCTCCCGCAGTGTGAGGG + Intronic
1159490670 18:69129571-69129593 TGTGGCCACCACCAGGGAAAAGG + Intergenic
1160984817 19:1833664-1833686 CGGAGCCTCCCCCAGTGAAGTGG - Intronic
1161009786 19:1954648-1954670 CGGGGCCCTCCCCAGGGAACTGG + Intronic
1161226754 19:3150466-3150488 AGGGAGTTCCCCCAGGAAAAGGG - Intronic
1161399122 19:4059781-4059803 GGAGGCCTCCCCTAAGGAAAGGG + Intronic
1161538915 19:4837730-4837752 AGGGACTTCTCCCAGGGACATGG - Intergenic
1161854098 19:6753809-6753831 AGGGGCGTAGCCTAGGGAAAGGG + Intronic
1161932230 19:7348817-7348839 GGGGGCCTCACCCAGGCACATGG - Intergenic
1162340603 19:10089580-10089602 GGGGGCCTCCCCCAGCAAACGGG + Intronic
1162711109 19:12595626-12595648 ATGGGCCTCACCCATGGAACTGG + Intronic
1162964367 19:14149055-14149077 AGGGGCCACCTCTGGGGAAACGG + Exonic
1163157850 19:15449203-15449225 AGGCGCCCTCCCCAGGGAGATGG + Intronic
1163847159 19:19644084-19644106 AGGGGCGTCCCCCAGGCCAGGGG - Intergenic
1167264560 19:48477325-48477347 GGGGGCCTCCTCCAGGGCAGAGG + Intronic
1167300709 19:48675906-48675928 AGGGTCCTGCCCCACGGAGAAGG - Intergenic
1167521625 19:49959114-49959136 AGGGGCTTCCCTCTGGGTAAAGG + Intronic
1167638835 19:50669100-50669122 AGGGCCCTCCCCGAGGGGAGGGG + Exonic
1167700540 19:51041682-51041704 AGGGGCCTTCCCCATGGCAATGG - Intergenic
1167756307 19:51415652-51415674 AGGGGCTTCCCTCTGGGTAAAGG + Intronic
1168093807 19:54103021-54103043 AGGGGGCTCCTCCAGGGCAGGGG + Intronic
928609309 2:32976621-32976643 AGGGGCCTCCTCCAAGGCACCGG - Intronic
930741121 2:54833662-54833684 AGGGCCATCCCTCAGTGAAAGGG + Intronic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
932758806 2:74426385-74426407 CGGGGTCTCCCCCAGGGCAGGGG + Exonic
933333261 2:80921644-80921666 AGGGGCCTCCTCCATTAAAATGG + Intergenic
933650164 2:84843995-84844017 AGGTGCCTCTGCCAGAGAAAAGG - Intronic
934475888 2:94593222-94593244 AGGAGGCTCTCCCAGAGAAAGGG + Intronic
934613154 2:95755362-95755384 GGCGTCCACCCCCAGGGAAAAGG + Intergenic
934647741 2:96069061-96069083 GGCGTCCACCCCCAGGGAAAAGG - Intergenic
934677519 2:96260157-96260179 AGGGGCCTGCCCCATGTAACAGG + Intronic
934841115 2:97624882-97624904 GGCGTCCACCCCCAGGGAAAAGG - Intergenic
940756773 2:157692321-157692343 TGGGGCCTCCCTAAGGGAAAAGG - Intergenic
943795182 2:191983609-191983631 AGGGGTCTACCCCAGGGCATAGG + Intronic
944488023 2:200227215-200227237 AGGGGCAGCCCACTGGGAAAAGG - Intergenic
946003117 2:216499320-216499342 TGGGGCCTCCCTCCGGAAAATGG + Exonic
947247073 2:228060793-228060815 AGAGGCATTCCCCAGAGAAAGGG + Intronic
947741034 2:232485104-232485126 AGGGGGCTCACCCAGGGACAGGG + Intronic
949063999 2:241978592-241978614 AATGGTCTCCCCCAGGGAAATGG - Intergenic
1172523138 20:35582225-35582247 AGGGGCCTGCACCAGACAAATGG + Intergenic
1173335673 20:42110574-42110596 AGGAACCTCCCGCAGGGACAGGG + Intronic
1173625112 20:44466767-44466789 TGGGGCCTCCCTCTGGAAAATGG - Intergenic
1174121734 20:48271029-48271051 AGGGCCATCTCCCAGGGAACTGG - Intergenic
1174195023 20:48766850-48766872 AGGAACCTGCCCCAGAGAAAGGG - Intronic
1174486704 20:50865840-50865862 AGGGGCTGCCCACAGAGAAATGG + Intronic
1175326609 20:58133595-58133617 AGTGATCTCCCCCAGGGAAGGGG + Intergenic
1176089462 20:63312500-63312522 AGGAGCCACCCCCAGGGTAGAGG - Exonic
1176173852 20:63708449-63708471 CGGTGTCTCCCCGAGGGAAAGGG + Intronic
1176803658 21:13458619-13458641 TGTGGCCCTCCCCAGGGAAAAGG + Intergenic
1177530808 21:22355541-22355563 AGGGGCATTCCACAGGAAAAGGG + Intergenic
1178836859 21:36105515-36105537 CGGTCCCTCCCCTAGGGAAAGGG + Intergenic
1179176727 21:39013341-39013363 AGGGGCCTACCCCAGTGCACAGG + Intergenic
1180203643 21:46243558-46243580 AGGGGCCTGCCCCATGGACTGGG + Exonic
1180725972 22:17946858-17946880 AGGGGTGTTCCCCAGGGAAGAGG - Intronic
1180968693 22:19803671-19803693 AAGGGCCTCCCCCTGGTAAGTGG + Intronic
1181391776 22:22588257-22588279 AGGTGACACCTCCAGGGAAATGG + Intergenic
1181420227 22:22792577-22792599 AGGTGACACCTCCAGGGAAAGGG + Intronic
1183984527 22:41562193-41562215 AGGGGCCTCTCCCTGGGAAAGGG + Intronic
1184620215 22:45671544-45671566 AGGGGTCTCCCCCAGGGGAGGGG - Intergenic
1184743603 22:46443365-46443387 AGGGGCTGCCCCCAGGGAAATGG + Intronic
1185053691 22:48566980-48567002 AGTGCCCTTCCGCAGGGAAAGGG - Intronic
949791185 3:7793760-7793782 AGGGAACTCACACAGGGAAAAGG + Intergenic
950043047 3:9932723-9932745 CTGGTCCTCCCCCAGGGGAATGG - Intronic
950563192 3:13747943-13747965 AGGCGCTTCCCCCAGGGTCACGG - Intergenic
950894310 3:16434110-16434132 AGGATCCTCCCCGAGGGCAAGGG - Intronic
953109593 3:39921062-39921084 AGAGGCTTCCCACAGGTAAAGGG - Intronic
953851831 3:46470551-46470573 AGCAGCCTCACCCAGAGAAATGG - Intronic
954114875 3:48461064-48461086 AGGGCCCTGCCCCAGGACAAGGG + Intronic
954324893 3:49858179-49858201 AGGAGCCTCCCTCAGGAAACTGG + Exonic
954363325 3:50133816-50133838 TGGGACCTCCCACAGGGAAGAGG + Intergenic
955611550 3:60762790-60762812 AGTAGCATCCCCCAGGGAAGAGG + Intronic
956228110 3:66982473-66982495 AGGAGCCTCCTGCAGGGAAGGGG + Intergenic
956231094 3:67017537-67017559 AGGGGCCTGCCCCAGTGAGTGGG + Intergenic
956653913 3:71530950-71530972 ATGGGCCCCCACCATGGAAATGG + Intronic
957954635 3:87169767-87169789 TTGGGCATCCTCCAGGGAAATGG + Intergenic
959462156 3:106640547-106640569 AGGGGCCTGACTCAGGGAAGTGG - Intergenic
960110777 3:113842628-113842650 AGAGGCTTCCCCCATGGCAATGG + Intronic
960586103 3:119322821-119322843 AGGGGGCTCCGCCAGGGGGAGGG + Intronic
962382002 3:134905536-134905558 AGGGACCACCCGCTGGGAAAAGG + Intronic
962917510 3:139917866-139917888 AGGGGCATCACCCATGGAAGGGG - Intergenic
963397145 3:144749735-144749757 AGGGGCCTCCCACAGTGCAGCGG - Intergenic
964328511 3:155574404-155574426 AGGGGCTTCCCCTGGGCAAATGG + Intronic
965604326 3:170484226-170484248 AGGGTCCACCCCCAGAGAAGAGG + Intronic
966224699 3:177585494-177585516 AGGTGCTTCCTCCAGGGGAAAGG - Intergenic
969058320 4:4415647-4415669 AGGTGCCCCGCCCAGGGAGAAGG - Intronic
969425262 4:7120590-7120612 AAGGCCCACCCCCAGTGAAAGGG - Intergenic
969695222 4:8730400-8730422 AGAGGCCGACCCCAGGGAAGGGG - Intergenic
970094963 4:12453028-12453050 AGAGGCCTCCTCCAGGTAAAAGG - Intergenic
970450943 4:16166044-16166066 AGTGGCCCATCCCAGGGAAAAGG - Intronic
971994997 4:33954595-33954617 AGGGGACTCCACCAAGGACAGGG - Intergenic
972784744 4:42315788-42315810 CGGTCCCTCCCCTAGGGAAAGGG + Intergenic
972938064 4:44164013-44164035 AGGGGCTGCCTACAGGGAAAGGG + Intergenic
979507495 4:121514729-121514751 AGGCTCCTCCCCCATGCAAATGG - Intergenic
980467379 4:133203401-133203423 AGGGGCCTTTTCCAAGGAAATGG + Intronic
980798373 4:137714767-137714789 AGGGTCATTCCACAGGGAAAGGG + Intergenic
980889591 4:138800275-138800297 AATGGACTCACCCAGGGAAAAGG + Intergenic
980992997 4:139755025-139755047 AGGTGACAACCCCAGGGAAATGG - Intronic
985510493 5:310609-310631 AAAGGCCTCCCACAGGGAGAGGG - Intronic
989348200 5:40453635-40453657 GGAGGCCTCACCCAGTGAAAAGG + Intergenic
994852678 5:105075790-105075812 AGGCTCCTTCCCCAGGCAAAGGG + Intergenic
996362726 5:122668526-122668548 CTGGCCCTCCCCCAGTGAAATGG - Intergenic
997618988 5:135272625-135272647 AGGGCCACTCCCCAGGGAAAGGG + Intronic
998128841 5:139640999-139641021 AGGGGGCTCACCCAGGCAGATGG + Intergenic
998186032 5:139980832-139980854 AGGGAGATTCCCCAGGGAAAGGG - Intronic
999260012 5:150232547-150232569 AGGGGCCTGCCTCTGGGAGACGG - Intronic
1000328403 5:160188857-160188879 AGGGGCCACCCCAAGGGGATGGG - Intronic
1001440221 5:171737124-171737146 AGGGGGCACCTGCAGGGAAAAGG - Intergenic
1001761150 5:174209532-174209554 AAAGGCCTCCCCAAGGGACATGG + Intronic
1002301978 5:178262514-178262536 AGGGTCCCCCCCCAGTCAAATGG - Intronic
1002568694 5:180128229-180128251 AAGGGCCCACCCCAGGGAGAGGG - Intronic
1006147479 6:31968200-31968222 AGGGGGCTCCCCCAGCCTAAGGG + Intronic
1006327505 6:33365304-33365326 GGGGCCCGCCTCCAGGGAAATGG + Intergenic
1007086067 6:39146499-39146521 AGGGGCCACCCCGAGGCTAATGG + Intergenic
1009652100 6:66489588-66489610 AGGTGTCTGTCCCAGGGAAATGG - Intergenic
1014341547 6:120213987-120214009 AGCAGACTCCTCCAGGGAAAGGG - Intergenic
1015966399 6:138698785-138698807 ATGAGGCTGCCCCAGGGAAAGGG - Intergenic
1016859042 6:148698758-148698780 AGCTGCCTCCCCCAGGGGCAGGG - Intergenic
1017759623 6:157557797-157557819 ATGGGCCTCCCACAGGGGAGTGG - Intronic
1018755967 6:166850000-166850022 CGGGGCCTCCGCCAGGGACGTGG + Intronic
1018903828 6:168063966-168063988 CGGGTCCTCCCCAAGGGGAATGG + Intronic
1019470115 7:1215011-1215033 TGGGGCTTCCCCCAGGAAAAGGG - Intergenic
1019556307 7:1633286-1633308 AGGGGTGTCCCCCAGGGGAGAGG + Intergenic
1022017731 7:26366541-26366563 AGAGGCCTCCTCTAGGGGAAAGG - Intronic
1022881474 7:34592290-34592312 AGGAGGCTCTCCCAGAGAAAGGG - Intergenic
1023265715 7:38403653-38403675 AGAGGCCGCCCCGAGGGAAGGGG + Intronic
1023842760 7:44106280-44106302 GAGGGCCTCCCCCTGGGAACTGG + Intronic
1026909317 7:74083440-74083462 GGGGGCCTCGCGCAGGGAAGCGG + Intronic
1029727750 7:102418735-102418757 TGGTGCTTCCCCCAGGGTAACGG - Intronic
1031929358 7:127668845-127668867 AGGGGACTGCACCATGGAAATGG - Intronic
1032753535 7:134866136-134866158 AGGAGCCTACCCCAGGGAGAAGG + Intronic
1033452223 7:141472159-141472181 AGAGGTCACCCCTAGGGAAAGGG - Exonic
1033589207 7:142796509-142796531 AGGGCCCTCCTCGAGGGAAGCGG + Intergenic
1034190744 7:149211413-149211435 ACTGGCCTCCCCCAAGGAAAAGG - Intronic
1034449088 7:151127907-151127929 AGGAGCCTGCCCCGGGGACAGGG - Intronic
1034896629 7:154880384-154880406 AGGGGCCTCCTCCCAGGAATTGG + Intronic
1035068299 7:156123471-156123493 AGATGTCTCCCACAGGGAAACGG + Intergenic
1035091303 7:156314244-156314266 TGGGGCATCCCCCATGGATAAGG + Intergenic
1035235674 7:157496402-157496424 AGGGGCTTCCAACAGGGGAAGGG + Intergenic
1035312148 7:157976140-157976162 AGGGGCCTCAGCCAGGGCCATGG + Intronic
1035669745 8:1408329-1408351 AGACGCCTCCCCGAGGGAAGGGG - Intergenic
1039468819 8:37801373-37801395 GTGGGCCTCCCCCAGGGAAAAGG + Intronic
1041624733 8:60012911-60012933 AGTGGCCTACACCAGGAAAATGG - Intergenic
1043532477 8:81166183-81166205 GGTGCCCTCTCCCAGGGAAATGG - Intergenic
1044752474 8:95429687-95429709 TGGTGCCTTCCCCATGGAAATGG + Intergenic
1047716387 8:127599382-127599404 ATGGGCCTTACCCAGGGAACAGG - Intergenic
1049357239 8:142195004-142195026 AGGGGCACCCCACAGGGAAGAGG - Intergenic
1049378016 8:142298248-142298270 AGCGGCCTTTCCCAGGGCAAGGG - Intronic
1049755377 8:144309170-144309192 AGGACCCTCCCCCATGGAAGAGG - Intronic
1052752784 9:32509123-32509145 GGTGCCCTCTCCCAGGGAAATGG - Intronic
1052854163 9:33396697-33396719 AGGAGGCTCTCCCAGAGAAAGGG - Intronic
1053682176 9:40492862-40492884 AGGAGGCTCTCCCAGAGAAAGGG - Intergenic
1053932163 9:43121185-43121207 AGGAGGCTCTCCCAGAGAAAGGG - Intergenic
1054281538 9:63132067-63132089 AGGAGGCTCTCCCAGAGAAAGGG + Intergenic
1054295273 9:63328365-63328387 AGGAGGCTCTCCCAGAGAAAGGG - Intergenic
1054393292 9:64632866-64632888 AGGAGGCTCTCCCAGAGAAAGGG - Intergenic
1054427941 9:65138080-65138102 AGGAGGCTCTCCCAGAGAAAGGG - Intergenic
1054502437 9:65883465-65883487 AGGAGGCTCTCCCAGAGAAAGGG + Intronic
1056828209 9:89891358-89891380 AGTGCCCTCCCGCAGGGACAGGG + Intergenic
1057354653 9:94323320-94323342 AGGGGACTCCCCTAGGGGAATGG + Intronic
1057653105 9:96934315-96934337 AGGGGACTCCCCTAGGGGAACGG - Intronic
1057879365 9:98781640-98781662 AGGGGCCTGCAGCAGGGAAGGGG + Intronic
1059434971 9:114270634-114270656 AGGGTCCTGCCCCAGGGAGGGGG + Intronic
1059496549 9:114714464-114714486 AGGGTCCTCCACTAGGGGAATGG + Intergenic
1060059847 9:120449278-120449300 ATGGGCCTTCCTCAGGAAAATGG + Intronic
1060200082 9:121647167-121647189 ACCAGCCTCCCCCAGGGAAGGGG - Intronic
1061961981 9:133993024-133993046 AGGTCGCTCCCCCAGGGAGAAGG - Intergenic
1061970210 9:134040906-134040928 AGGGGCCTCTCCCATGGAGGTGG - Intronic
1062381935 9:136290853-136290875 AGGGCCGGCCCCCAGGGCAAGGG - Exonic
1062462162 9:136666483-136666505 CGTGGCCCCCCCCGGGGAAATGG + Intronic
1062472244 9:136711768-136711790 AGACGCCACCACCAGGGAAATGG + Intergenic
1062654067 9:137593061-137593083 AGGTGCCTGCCCCTGGGAGAGGG - Intergenic
1186849078 X:13561944-13561966 AAGGTCCTCCACCAGCGAAAAGG - Intergenic
1190573986 X:51814461-51814483 AGGGGCCTCCCCAAAGGCAATGG - Intronic
1194559587 X:95403923-95403945 AGGTGCCTGTCCCAGGGAGATGG - Intergenic
1195696194 X:107669413-107669435 AGGGCACGCCCCCAGGGAACAGG - Intergenic
1195696920 X:107674240-107674262 AGGGGCCTCCCCAAGCCACAAGG - Intergenic
1197747256 X:129939967-129939989 ATGGGGCTCCCCCAGGGATAAGG - Intergenic
1198005057 X:132484691-132484713 AAGGGCCTCCCATAGAGAAAAGG - Intronic
1200009238 X:153108862-153108884 AAGAGCCTCCCCCAGGGGCAGGG - Intergenic
1200030362 X:153291060-153291082 AAGAGCCTCCCCCAGGGGCAGGG + Intergenic
1200721454 Y:6611399-6611421 AGGGGCCACCCCTATGGAACAGG + Intergenic