ID: 1152739692

View in Genome Browser
Species Human (GRCh38)
Location 17:82013493-82013515
Sequence GCCTGCCGTCAGAGAGCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 208}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152739682_1152739692 25 Left 1152739682 17:82013445-82013467 CCTCGGGGCCTCTCGGGGTGGTG 0: 1
1: 0
2: 1
3: 12
4: 175
Right 1152739692 17:82013493-82013515 GCCTGCCGTCAGAGAGCTGGCGG 0: 1
1: 0
2: 0
3: 21
4: 208
1152739685_1152739692 1 Left 1152739685 17:82013469-82013491 CCCCGGTGACGTGCCTGCCTGCC 0: 1
1: 0
2: 2
3: 14
4: 141
Right 1152739692 17:82013493-82013515 GCCTGCCGTCAGAGAGCTGGCGG 0: 1
1: 0
2: 0
3: 21
4: 208
1152739684_1152739692 17 Left 1152739684 17:82013453-82013475 CCTCTCGGGGTGGTGTCCCCGGT 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1152739692 17:82013493-82013515 GCCTGCCGTCAGAGAGCTGGCGG 0: 1
1: 0
2: 0
3: 21
4: 208
1152739687_1152739692 -1 Left 1152739687 17:82013471-82013493 CCGGTGACGTGCCTGCCTGCCTG 0: 1
1: 0
2: 2
3: 36
4: 285
Right 1152739692 17:82013493-82013515 GCCTGCCGTCAGAGAGCTGGCGG 0: 1
1: 0
2: 0
3: 21
4: 208
1152739686_1152739692 0 Left 1152739686 17:82013470-82013492 CCCGGTGACGTGCCTGCCTGCCT 0: 1
1: 0
2: 3
3: 39
4: 351
Right 1152739692 17:82013493-82013515 GCCTGCCGTCAGAGAGCTGGCGG 0: 1
1: 0
2: 0
3: 21
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152739692 Original CRISPR GCCTGCCGTCAGAGAGCTGG CGG Intronic
900198628 1:1391373-1391395 GCCTGCCGCCAGCGCCCTGGAGG - Intronic
900519330 1:3098103-3098125 GCCTCCTGTCAGTGTGCTGGGGG + Intronic
900603779 1:3514969-3514991 GGCTGGAGTCACAGAGCTGGGGG - Intronic
901665917 1:10826063-10826085 GCCTGCCCTCAGGAAGCTGTGGG - Intergenic
903262549 1:22139221-22139243 GGCTGCTGTCAGGGAGCTGCAGG - Intronic
906953986 1:50357575-50357597 ACCTGCCTGCAGAGAGCTGCAGG + Intergenic
907272453 1:53298845-53298867 TCCTTCCCTCAGAGGGCTGGTGG - Intronic
912121648 1:106479304-106479326 GCCTCCCATCACAGACCTGGAGG + Intergenic
914258403 1:145978866-145978888 GCCTGGTGACAGAGGGCTGGAGG + Intergenic
915650688 1:157308239-157308261 GTCTGCCAGCAGGGAGCTGGAGG - Intergenic
915898101 1:159826959-159826981 GCCTGTCCTCGGAGAGCTGAAGG + Intronic
918001999 1:180506176-180506198 GGATGCAGTCAGAAAGCTGGGGG - Intergenic
918241495 1:182624165-182624187 CCCTGTCCTCAGGGAGCTGGAGG - Intergenic
918342205 1:183577319-183577341 GCCTCCCTTCAGAGAGCCCGGGG + Intronic
920457218 1:206110350-206110372 GGCTGCCGTCGGAGAGCCGCCGG + Exonic
921164097 1:212493783-212493805 CCCTGCAGGCAGAGAGATGGAGG - Intergenic
922558450 1:226549971-226549993 GCGTGCAGGCAGAGACCTGGGGG - Intronic
923948412 1:238918828-238918850 GCCTGGGGTCAGGGACCTGGAGG + Intergenic
1067544201 10:47181177-47181199 GGCTGCCGTCCGAGGGCTGGAGG + Intergenic
1068188610 10:53619866-53619888 GCATGCCTGCAGAGAACTGGAGG - Intergenic
1069714826 10:70513986-70514008 GCCCGCCCTCAGAGAGCAGGGGG - Intronic
1069725010 10:70571833-70571855 GCCTGCCTTCCAGGAGCTGGTGG + Intergenic
1069836900 10:71314900-71314922 GGCGGCCGTCAGGGGGCTGGAGG + Intergenic
1071478756 10:86046972-86046994 GCCTGACTAGAGAGAGCTGGGGG - Intronic
1076668098 10:132104281-132104303 CTCTGCCGTCTGAGAGCTCGTGG + Intergenic
1076758942 10:132590401-132590423 CCCTGCCGGCAGACAGCTGCTGG - Intronic
1076788289 10:132762442-132762464 GCGTTCAGTCAAAGAGCTGGTGG + Intronic
1077311097 11:1889435-1889457 GCCTGCCCCCACAGAGCAGGAGG - Exonic
1077326091 11:1964761-1964783 GCCTGCTGCCAGAGAGGGGGAGG + Intronic
1077380642 11:2235448-2235470 GCCCGCAGTGAGCGAGCTGGAGG + Intergenic
1081855962 11:46304148-46304170 GCCTGCCCCCAGAGAGTTGTTGG + Intronic
1083896984 11:65624928-65624950 GACTGCCGTGAGCGGGCTGGTGG - Exonic
1084035589 11:66508085-66508107 GCCTGCGGTCACAAAGCTGTTGG + Intronic
1084050565 11:66596723-66596745 TCCTGCCCTCACAGAGCTGGCGG + Intronic
1084178663 11:67436076-67436098 GCCTGCAGCCAGCGACCTGGGGG + Exonic
1085310414 11:75513406-75513428 GCCTGAGGTCAGAGAGCCGGTGG + Intronic
1086494169 11:87385243-87385265 GCCTGCCATCAGGGATCTGTAGG + Intergenic
1087231333 11:95668965-95668987 ACCTGAGGTCAGACAGCTGGGGG + Intergenic
1088885013 11:113999390-113999412 GCCCGATGTCAGAGAGATGGTGG + Intergenic
1089586998 11:119516136-119516158 GCCTGCTCTCTGAGAGCTGGGGG + Intergenic
1090406586 11:126479395-126479417 GCCTGCCATCTTAGAGCTGATGG + Intronic
1090911372 11:131122550-131122572 GCCTTCCGAGAGAGTGCTGGGGG + Intergenic
1091109635 11:132953761-132953783 ACCTGCCCCCTGAGAGCTGGGGG + Intronic
1202809071 11_KI270721v1_random:19940-19962 GCCTGCTGCCAGAGAGGGGGAGG + Intergenic
1091651015 12:2309997-2310019 ACCTGTAGTCAGAGACCTGGTGG + Intronic
1091744481 12:2982467-2982489 GCCTGCCAGGGGAGAGCTGGAGG - Intronic
1091793400 12:3284103-3284125 GCGTGCCAGCAGAGAGCGGGAGG - Exonic
1094777304 12:33745642-33745664 CCCTGCCATCACAGACCTGGAGG + Intergenic
1095293217 12:40499976-40499998 GCCTGCTGACAGAGGGATGGAGG - Intronic
1096242910 12:49968755-49968777 CCCTGCCGTTAGACAGCTGTGGG - Intronic
1096258146 12:50075124-50075146 GCCTGGCATCTGGGAGCTGGTGG - Intronic
1096519159 12:52174408-52174430 CCCTGAAGTCAGAGTGCTGGAGG - Intronic
1097680587 12:62645522-62645544 GTCAGCAGTCAGAGAGGTGGAGG - Exonic
1098380922 12:69868599-69868621 GTCTGCCAGCACAGAGCTGGAGG + Intronic
1099487721 12:83249176-83249198 GCCTTCCATCACAGACCTGGAGG + Intergenic
1101597201 12:106177992-106178014 GACGGCCGTGAGAGAGCTTGGGG - Intergenic
1102646043 12:114404713-114404735 GCCCGGCATCAGAGCGCTGGTGG - Intronic
1102650649 12:114439959-114439981 GCCTGCGTTCAGAGGGCCGGGGG - Intergenic
1102908481 12:116695099-116695121 GCCCGACGTCACAGAGCTGTTGG + Intergenic
1104589842 12:130075468-130075490 GCCTGGCCTCAGAAAGCTTGTGG + Intergenic
1104837281 12:131799870-131799892 GGCTGCTGTCGGAGGGCTGGGGG - Intergenic
1105003770 12:132708428-132708450 GCCTCCTGTCTGAGAGCTGTGGG - Intergenic
1112712828 13:102150137-102150159 GACTGCAGTCATGGAGCTGGTGG - Intronic
1114479649 14:23024748-23024770 CCCTGCAGTCAGGGAGCTGCTGG - Intronic
1116670074 14:47829256-47829278 CCCTCCCGTCACAGACCTGGAGG - Intergenic
1121015565 14:90546803-90546825 GCCTGCTCTCAAAGAGCTCGGGG + Intronic
1121508405 14:94493848-94493870 GCCTGAAGCCAGAGAGATGGTGG + Intronic
1121698056 14:95928802-95928824 TCCTGCCTTCAGGGAGATGGAGG - Intergenic
1122410159 14:101521659-101521681 GCCTGCCGTGGGAGGGCTGGCGG - Intergenic
1124673024 15:31658335-31658357 TCCTGCCTTCAGCAAGCTGGTGG - Intronic
1125973664 15:43932816-43932838 GGCTTCAGTCAGAGAGCTGTGGG - Intronic
1126670578 15:51111784-51111806 GCCTGCCGGCAGAGGGTTTGGGG - Intergenic
1127369941 15:58330326-58330348 GCCTGCAGGCACAGATCTGGTGG - Intronic
1127691509 15:61401966-61401988 GCCTGTCCTCTGAGAGGTGGGGG + Intergenic
1127819625 15:62643687-62643709 TGCTGCCTTCAGAGAGCAGGAGG - Intronic
1128426171 15:67543688-67543710 CCCTGCCCTCAGAGAGCTCATGG + Intronic
1128759312 15:70204663-70204685 GTCTGCTGTCAGCAAGCTGGAGG - Intergenic
1129220889 15:74131082-74131104 ACCTGCAGCCAGAGAGGTGGGGG + Intronic
1129755794 15:78098266-78098288 ACCTGAGGTCAGAGACCTGGTGG + Intronic
1136930210 16:34411425-34411447 GCCTGCTGTCAGGCTGCTGGAGG + Intergenic
1136974364 16:35000380-35000402 GCCTGCTGTCAGGCTGCTGGAGG - Intergenic
1138565060 16:57827216-57827238 GCCTGGCGTCAGCGAGCTCAGGG + Intronic
1138676481 16:58655108-58655130 ACCTGCGGGGAGAGAGCTGGGGG + Intergenic
1140033165 16:71354422-71354444 ACCAGCCATCAGAGAACTGGTGG + Intergenic
1140994510 16:80244311-80244333 GCCTGCCCTCAATGAGCTGTTGG - Intergenic
1142137702 16:88459225-88459247 TCCTGCTCTCAGAGAGCTTGTGG - Intronic
1142847545 17:2689608-2689630 GCCTGCTGTCAGAGCCCTGGTGG - Exonic
1142914535 17:3125355-3125377 GCCTGCAGTCAGATACCTGAAGG + Intergenic
1143650109 17:8258090-8258112 GCTGGCCGTCTGGGAGCTGGAGG - Exonic
1145265392 17:21377375-21377397 GCCTCCCGTCAGAGACCTGCGGG + Intronic
1145752865 17:27367724-27367746 GTCTGCCTTCAGAGGCCTGGCGG - Intergenic
1147437290 17:40424842-40424864 GCCTGCCTTCAATGAGGTGGGGG - Intergenic
1147923734 17:43934096-43934118 TCCTGCCCTCAGAGAGCAGCAGG + Intergenic
1148122735 17:45222211-45222233 GCCCGCGGCCGGAGAGCTGGAGG + Exonic
1148694338 17:49550018-49550040 CCCTGCCCTCAGGGAGCTCGAGG - Intergenic
1151325728 17:73378936-73378958 GCCTGCCCTCAGGAAGCTGGAGG + Intronic
1151899535 17:77002629-77002651 GCCTGCCGTCAGTGGGGTGCTGG - Intergenic
1152229740 17:79108505-79108527 GCCTGGGGTCACAGGGCTGGAGG + Intronic
1152739692 17:82013493-82013515 GCCTGCCGTCAGAGAGCTGGCGG + Intronic
1155646685 18:28086961-28086983 GCATACAGTCAGAGGGCTGGAGG + Intronic
1156213974 18:34977512-34977534 GCCGGCACTGAGAGAGCTGGGGG + Intronic
1156904237 18:42335383-42335405 GCCTGCCTTCAAAGAGCCTGTGG + Intergenic
1156991318 18:43411424-43411446 CACTGCCACCAGAGAGCTGGTGG - Intergenic
1160527154 18:79544636-79544658 GCCTGCTGTCTGGGTGCTGGCGG - Intergenic
1161407628 19:4099291-4099313 GCCCGACGCCAAAGAGCTGGAGG - Exonic
1161640279 19:5418349-5418371 GCCTGGGGTCACACAGCTGGTGG + Intergenic
1163837324 19:19582853-19582875 GCATGCAGTCAGACAGGTGGGGG - Intronic
1165924379 19:39318252-39318274 GCTTGCTGTCAGCCAGCTGGGGG - Intergenic
1165963872 19:39558275-39558297 GCCTGCCCTAAGTGAACTGGTGG + Intergenic
1166007074 19:39915292-39915314 GCCTGCCTTCCGGGTGCTGGTGG - Exonic
1167030083 19:46953022-46953044 GCCTGGCTCCAGAGAGCTGGAGG + Intronic
1167056101 19:47112422-47112444 ACCTGTCGTCAGGGAGCGGGAGG + Exonic
1167461319 19:49625979-49626001 GGGTGGCTTCAGAGAGCTGGGGG + Exonic
925170146 2:1745085-1745107 GGCGGCCGGCAGAGAGCAGGTGG - Intergenic
926142207 2:10374506-10374528 GCCTGCCCTCAGGGAGCTGACGG + Intronic
926621291 2:15049198-15049220 GACTGGCTTCAGGGAGCTGGGGG - Intergenic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
929957366 2:46468630-46468652 GTCTGTGGTCAGAGAGCTGAGGG - Intronic
932411091 2:71548325-71548347 GACTGCAGTCACAGAGCTAGGGG + Intronic
933533143 2:83535838-83535860 GGCTTCAGTCAGAAAGCTGGGGG - Intergenic
933966350 2:87432533-87432555 ACCTGTCCTGAGAGAGCTGGGGG + Intergenic
936327444 2:111517952-111517974 ACCTGTCTTGAGAGAGCTGGGGG - Intergenic
937288603 2:120768441-120768463 GCCTGCAGGCTGAGAGCAGGTGG + Intronic
937379828 2:121366590-121366612 GCCTGGCCTCAGAGAGCTCAAGG - Intronic
940998880 2:160180388-160180410 GCCTGTAGTCCCAGAGCTGGAGG - Intronic
945373029 2:209044516-209044538 GCCTCCAGCCAGACAGCTGGGGG + Intergenic
947463397 2:230322114-230322136 ACCTGCCCTCAGAAAGGTGGAGG - Intergenic
947642883 2:231716731-231716753 GCCTGAGCTCAGAGAGGTGGAGG + Intergenic
947840069 2:233202137-233202159 GGCTGACTTCAGAGAACTGGGGG - Intronic
948843520 2:240672122-240672144 GGCTGCAGGCAGAGCGCTGGGGG + Intergenic
1169289322 20:4335197-4335219 GCCTGCTTTTAGGGAGCTGGAGG + Intergenic
1171959572 20:31484296-31484318 GCCGGCCGTCGGGGTGCTGGGGG - Exonic
1172898727 20:38318730-38318752 CTCTGGCCTCAGAGAGCTGGGGG - Intronic
1172991471 20:39040201-39040223 GGCTGCCTTCTGAGAGGTGGAGG - Intergenic
1174324881 20:49771237-49771259 GCCTGCAGTCAGAGGGCAGGGGG + Intergenic
1178518333 21:33266790-33266812 GCCCGCCAGCAGAGAGCTGCAGG - Intronic
1180540917 22:16446887-16446909 CCCTCCCGTCACAGAGTTGGAGG - Intergenic
1180994041 22:19955689-19955711 TCCTGCCCTCACAGGGCTGGTGG - Intronic
1181656295 22:24302654-24302676 GTCTGCCTTCAGGGAGCTTGTGG + Intronic
1182309629 22:29395402-29395424 GCCTGCCCTCAGCAAGCAGGTGG - Intronic
1183026391 22:35068643-35068665 GCCTGCCGTCATCGGGCTAGGGG - Intronic
1183444530 22:37844317-37844339 TCGTGCTGTCAGCGAGCTGGCGG + Exonic
1183709030 22:39491649-39491671 GGCAGCTGTCAGAGGGCTGGGGG + Exonic
1184374694 22:44104244-44104266 ACCTGCAGTCTGAGAGCAGGTGG - Intronic
1184594396 22:45505008-45505030 CCCTGCTCTCAGAGAGCTGTGGG + Intronic
1184639724 22:45864056-45864078 TACTGCCGCCAGAGAGCTGCTGG - Intergenic
1185358065 22:50386929-50386951 GCCTGCAGTCACACAGGTGGAGG + Intronic
950235742 3:11318785-11318807 GTCTGCAGGCAGAGAGATGGGGG - Intronic
950260195 3:11537851-11537873 GCTAGCCCACAGAGAGCTGGTGG + Intronic
950336775 3:12200972-12200994 GCCTGCCTTCACCGGGCTGGAGG - Intergenic
953328698 3:42034200-42034222 CCCTGCCTTCTGAGAGCTGCTGG + Intronic
955350907 3:58192234-58192256 GCCTGACCTCAGAGAGGAGGGGG + Intergenic
955751737 3:62190355-62190377 GCCTGCCTTCATGGAGCTGATGG - Intronic
960692813 3:120364705-120364727 ATCTGCAGTCAGCGAGCTGGAGG + Intergenic
961449838 3:126997719-126997741 GAGTGCCGTCCCAGAGCTGGTGG + Intronic
961620322 3:128218978-128219000 GCCTGCCGTCAGGAAGCTCACGG + Intronic
962891502 3:139677021-139677043 GCTGGCCTGCAGAGAGCTGGGGG - Intronic
964705938 3:159618760-159618782 GCCAGCACTCAGAGGGCTGGAGG - Intronic
965691769 3:171364824-171364846 GCCAGCCATGAGAGGGCTGGGGG + Intronic
970307681 4:14750177-14750199 GCCTAAGGTCACAGAGCTGGTGG - Intergenic
970673464 4:18421704-18421726 GCCTGCCCTCAGCCACCTGGAGG + Intergenic
972637801 4:40899792-40899814 GCATGCTGTCAGAAAACTGGGGG + Intronic
972731943 4:41803258-41803280 GCCTGCCCAAAAAGAGCTGGGGG + Intergenic
976799017 4:88967232-88967254 GCCTGCTCTCAGTGAGCTTGTGG - Intronic
977917815 4:102613433-102613455 GGGTACAGTCAGAGAGCTGGTGG + Exonic
978404692 4:108366870-108366892 CCCTGCCCTCATAGAGCTGTTGG + Intergenic
980106925 4:128596664-128596686 GCCTGCCTTCAGTGAGCTTATGG - Intergenic
980116388 4:128683476-128683498 ACCTGCAGTCGGAGAGCTGCAGG - Intergenic
984427525 4:179606969-179606991 GCCTTCCCTCAGAGCTCTGGGGG - Intergenic
986540922 5:8843049-8843071 AGCTGCCGTGAGGGAGCTGGTGG - Intergenic
987118148 5:14742617-14742639 GCCTGCCCTCAGAGAGCTCCAGG - Intronic
989205662 5:38806827-38806849 GCCTGCCGTCCAGGAGGTGGGGG - Intergenic
990903632 5:60779648-60779670 CCCTCCCGTCACAGACCTGGAGG - Intronic
993267143 5:85740405-85740427 CCCTCCCATCAGAGATCTGGAGG - Intergenic
997210147 5:132072408-132072430 GCGAGCCTTCAGAGAGCAGGTGG - Intergenic
997309412 5:132867097-132867119 GCCTCCCCTCTGAGCGCTGGCGG + Intronic
997591036 5:135072491-135072513 CCCTGCCTTCAAAGAGCTTGTGG - Intronic
997655407 5:135550644-135550666 TCCTGCCATCAGAGAGGTGGTGG + Intergenic
999174728 5:149624035-149624057 GCCTGCCTTCAGGAAGCTGGTGG + Exonic
1000645600 5:163757032-163757054 ACCTGCAATCAGAGAGGTGGAGG - Intergenic
1001925201 5:175631112-175631134 CACTGCAGTCAGGGAGCTGGAGG + Intergenic
1004909631 6:20270539-20270561 CCCTGCTGTCAAAGAGCTTGTGG - Intergenic
1006256383 6:32835758-32835780 GCCTGCAGACAGTGAGCTGTGGG + Exonic
1006445908 6:34079736-34079758 GCCTGTGGCCAGAGGGCTGGAGG - Intronic
1007809162 6:44474210-44474232 TCCTGGGGTCAGAGGGCTGGTGG + Intergenic
1007809195 6:44474318-44474340 TCCTGGTGTCAGAGGGCTGGTGG + Intergenic
1007809213 6:44474372-44474394 TCCTGGGGTCAGAGGGCTGGCGG + Intergenic
1007830788 6:44636875-44636897 GCCTTCCTTCACAGAGCTGGCGG - Intergenic
1013591092 6:111620214-111620236 GCCTGCTGGCAGAGGCCTGGAGG - Intergenic
1013748751 6:113376207-113376229 CCCTGCCGTTGGGGAGCTGGGGG + Intergenic
1014715228 6:124856915-124856937 ACCTGCCATCAGTAAGCTGGAGG - Intergenic
1015579131 6:134704440-134704462 GCGTTCCGTCAGAGAGCCTGGGG - Intergenic
1019362337 7:611348-611370 GCCTGCCCAGAGAGAGCTGGGGG - Intronic
1020773397 7:12424127-12424149 GCCTGCCAGCAGAAAGCTGGCGG + Intergenic
1023236814 7:38098923-38098945 CCCTGCCATCACAGATCTGGAGG + Intergenic
1025251285 7:57353208-57353230 GCCTGCAGGCAGCAAGCTGGTGG + Intergenic
1026221422 7:68401078-68401100 GGCAGCCTTCAGAGAGGTGGTGG + Intergenic
1028333335 7:89623051-89623073 GCCTGCCATCAGGGGACTGGTGG + Intergenic
1029060010 7:97787538-97787560 GCCTGCCGTAAAAGAGCTAAAGG + Intergenic
1029870457 7:103686169-103686191 GCCAGCTTGCAGAGAGCTGGTGG + Intronic
1031568617 7:123330392-123330414 ACCTGCAGACAGAGGGCTGGGGG - Intergenic
1034732034 7:153396321-153396343 TCCTGCTGACAGAGAGGTGGTGG - Intergenic
1035827393 8:2659580-2659602 ACCTGCCCCCAGAGAGCTGCAGG - Intergenic
1037680689 8:21095133-21095155 GTGTGCCTTCAGAGACCTGGAGG - Intergenic
1037761643 8:21745572-21745594 ACCTGCGGTCAGAAACCTGGAGG + Intronic
1040405591 8:47099129-47099151 GCCTGCCCTAAAAGAGCTGAAGG - Intergenic
1041463052 8:58132536-58132558 GCCTGCGGTCAGTGAGCTGAAGG - Intronic
1041842488 8:62288390-62288412 GCCTGTCGTCAGGTAGGTGGAGG - Intronic
1045017098 8:98009642-98009664 GCTTGCGGTCAGGGGGCTGGAGG - Intronic
1045064477 8:98433514-98433536 GCCTACAATCACAGAGCTGGAGG - Intronic
1045866479 8:106871561-106871583 GCCGGCCCTCAGAGAGGTAGTGG - Intergenic
1051135178 9:13912097-13912119 ACCTGCCGTCAGCAGGCTGGAGG + Intergenic
1051142014 9:13988044-13988066 GGCTGCCCTCAGAGAGCATGAGG - Intergenic
1053200511 9:36148816-36148838 GCCAGCCATCAGAGACCTTGTGG - Intronic
1056785367 9:89588909-89588931 ACCTGGCCTCAGAGAGCAGGTGG + Intergenic
1059910101 9:119033645-119033667 CCCTGCAATCAGAGAGCTGCTGG - Intergenic
1060279629 9:122207052-122207074 CCCTGCCCTCAGGGAGCTTGTGG - Intronic
1061079258 9:128360495-128360517 GCCGGCCCTCAGAGGGATGGGGG - Exonic
1061093269 9:128439018-128439040 GCCTGCACTCAGGCAGCTGGAGG + Intergenic
1061484497 9:130913520-130913542 CTCTGACGTCAGGGAGCTGGAGG + Intronic
1062342381 9:136099548-136099570 GCCTGGCCTCAGAGGGCTTGTGG + Intergenic
1187701253 X:21966271-21966293 GCCAGCCTTCAGAGGGCTGGTGG + Intronic
1189878010 X:45456810-45456832 GCCTGCAGTGGGAGAGCTGGGGG - Intergenic
1189926416 X:45959839-45959861 GCGTGCTGGCAAAGAGCTGGGGG - Intergenic
1192503108 X:71665936-71665958 GCCGGCTGTGGGAGAGCTGGAGG - Intergenic
1192510314 X:71717314-71717336 GCCGGCTGTGGGAGAGCTGGAGG - Exonic
1192516383 X:71764239-71764261 GCCGGCTGTGGGAGAGCTGGAGG + Exonic
1194130351 X:90073952-90073974 GCATGGGGTCAGGGAGCTGGTGG + Intergenic
1198158173 X:133983458-133983480 GCAGGCAGCCAGAGAGCTGGGGG + Intronic
1200228329 X:154431629-154431651 CCCTGCCCTGAGAGTGCTGGAGG + Intronic