ID: 1152739941

View in Genome Browser
Species Human (GRCh38)
Location 17:82014442-82014464
Sequence CCGTGGTGCCTTCTCTCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 233}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152739932_1152739941 0 Left 1152739932 17:82014419-82014441 CCCCGTCTCTCCCTGCCCAGGCA 0: 1
1: 0
2: 3
3: 51
4: 455
Right 1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 233
1152739933_1152739941 -1 Left 1152739933 17:82014420-82014442 CCCGTCTCTCCCTGCCCAGGCAC 0: 1
1: 0
2: 4
3: 68
4: 590
Right 1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 233
1152739930_1152739941 18 Left 1152739930 17:82014401-82014423 CCGCTCTGTGGGTGGATGCCCCG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 233
1152739927_1152739941 25 Left 1152739927 17:82014394-82014416 CCCACTCCCGCTCTGTGGGTGGA 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 233
1152739925_1152739941 26 Left 1152739925 17:82014393-82014415 CCCCACTCCCGCTCTGTGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 204
Right 1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 233
1152739924_1152739941 27 Left 1152739924 17:82014392-82014414 CCCCCACTCCCGCTCTGTGGGTG 0: 1
1: 0
2: 0
3: 19
4: 222
Right 1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 233
1152739934_1152739941 -2 Left 1152739934 17:82014421-82014443 CCGTCTCTCCCTGCCCAGGCACC 0: 1
1: 0
2: 5
3: 134
4: 986
Right 1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 233
1152739936_1152739941 -10 Left 1152739936 17:82014429-82014451 CCCTGCCCAGGCACCGTGGTGCC 0: 1
1: 0
2: 4
3: 19
4: 288
Right 1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 233
1152739928_1152739941 24 Left 1152739928 17:82014395-82014417 CCACTCCCGCTCTGTGGGTGGAT 0: 1
1: 0
2: 1
3: 13
4: 135
Right 1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 233
1152739929_1152739941 19 Left 1152739929 17:82014400-82014422 CCCGCTCTGTGGGTGGATGCCCC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152739941 Original CRISPR CCGTGGTGCCTTCTCTCTCC CGG Intronic
900223747 1:1523254-1523276 CCGAGGTGCCTGCTCTCCACAGG + Intronic
900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG + Intronic
901908216 1:12433012-12433034 CCTTAGTACCTTTTCTCTCCTGG + Intronic
902076429 1:13790441-13790463 CCGTGGTTCCTTCACCCTCAAGG - Intronic
902244520 1:15111610-15111632 CCGTGGTGACTTCTGGCTCCAGG + Intronic
902244959 1:15114799-15114821 GGCTGGTGTCTTCTCTCTCCTGG - Exonic
902533375 1:17104869-17104891 CCGTGGTACCTTGTCACTGCTGG + Exonic
904604970 1:31693092-31693114 CCGTGCTCCCTTCTCTCCCTTGG + Exonic
904688259 1:32275650-32275672 CCGCGGTGCTCTCGCTCTCCCGG - Exonic
907620721 1:55975612-55975634 CCATGGTGCTTCCTCTGTCCAGG + Intergenic
914044697 1:144081190-144081212 TTCTGGTGGCTTCTCTCTCCCGG - Intergenic
914133413 1:144879496-144879518 TTCTGGTGGCTTCTCTCTCCCGG + Intergenic
914386184 1:147172287-147172309 CCCTGGAGCCCTCTCCCTCCTGG + Intronic
915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG + Intronic
917025888 1:170640979-170641001 CCATTGTGCATTCTTTCTCCAGG - Intergenic
917964454 1:180169635-180169657 CCGTTGTCCCATCTCACTCCTGG + Intronic
919924417 1:202185070-202185092 CCTTGGTGCCTTCTCTGCCCAGG - Intergenic
920692179 1:208155344-208155366 CCGAGCTGCCTTCTCTCTGTGGG - Intronic
922677490 1:227561576-227561598 CCAGGGTGTCTTCCCTCTCCCGG + Intergenic
922831716 1:228557663-228557685 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922832196 1:228609645-228609667 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922833317 1:228614127-228614149 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922833877 1:228616368-228616390 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922834434 1:228618609-228618631 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922834994 1:228620841-228620863 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922835545 1:228623044-228623066 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922836103 1:228625286-228625308 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922836661 1:228627525-228627547 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922837220 1:228629767-228629789 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922837781 1:228632008-228632030 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922838339 1:228634248-228634270 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922838897 1:228636473-228636495 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922839457 1:228638714-228638736 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922840018 1:228640945-228640967 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922840578 1:228643186-228643208 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922841141 1:228645417-228645439 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
922841681 1:228647635-228647657 TCGCGGTGCCTTCCCGCTCCCGG - Intergenic
1063345779 10:5311257-5311279 CCATGGTGCTTTTTCTCTCAAGG - Intergenic
1064306730 10:14174141-14174163 CCGTGGTGGCTCCCCTCTCCCGG + Intronic
1064943563 10:20761975-20761997 CCGTGGTTCCTTCTATCTTGGGG + Intergenic
1066956819 10:42180869-42180891 TTCTGGTGGCTTCTCTCTCCCGG - Intergenic
1070565583 10:77601698-77601720 CCATGGTGTCTCCTCTCCCCGGG + Intronic
1071566490 10:86673952-86673974 CACTGGTGCCTTCTTTCCCCTGG + Intronic
1072640587 10:97208212-97208234 CCTAGAAGCCTTCTCTCTCCAGG - Intronic
1072809023 10:98445498-98445520 GCGTGGTCCCTGGTCTCTCCAGG + Intronic
1075007278 10:118840047-118840069 CCATGGTGCCTTCCCTGCCCCGG - Intergenic
1075384630 10:122046624-122046646 CCGTGGTCCCTTTCTTCTCCTGG + Intronic
1076171388 10:128323085-128323107 CAGTGGTGCCTCCCCTCACCTGG - Intergenic
1076899829 10:133333105-133333127 CCGTGGTGCCTACCCACACCTGG - Intronic
1079357669 11:19743457-19743479 TCCTGGTGCTTTCTCCCTCCTGG + Intronic
1083592293 11:63902818-63902840 CGGTGGGGCCTGCCCTCTCCAGG + Intronic
1084366566 11:68705099-68705121 CCGTGCTGCACTCTCTCCCCAGG - Intergenic
1084490857 11:69477554-69477576 TCCCGGAGCCTTCTCTCTCCTGG - Intergenic
1084506151 11:69569759-69569781 CAGTGGTGCCTTCCTTTTCCTGG - Intergenic
1084599295 11:70135454-70135476 ACGTGGTGGCTGCTTTCTCCAGG - Intronic
1088358479 11:108967441-108967463 CAGTGATGCCTTCTCCCACCTGG - Intergenic
1089584659 11:119502659-119502681 CTCTGGTGCCTTCTCATTCCAGG - Intergenic
1090153811 11:124414614-124414636 GCCTGCTGCCCTCTCTCTCCTGG - Intergenic
1090586883 11:128222710-128222732 CCTTGATGCCTTATCTTTCCAGG - Intergenic
1091833036 12:3563674-3563696 CCGTGGTTCCTTTCCTCACCCGG - Intronic
1096580920 12:52584474-52584496 CTGTGGTGCCTGGTCCCTCCAGG - Intergenic
1098237103 12:68427907-68427929 CCATGCTGCCTTCACTCTCTGGG + Intergenic
1102310560 12:111841837-111841859 CAGTCCTGTCTTCTCTCTCCTGG + Intergenic
1102389018 12:112534844-112534866 AAATTGTGCCTTCTCTCTCCTGG - Intergenic
1102736866 12:115169768-115169790 CCGTGCTGCCTCCTTTCTCCAGG + Intergenic
1102863273 12:116354648-116354670 TCTTGTAGCCTTCTCTCTCCTGG + Intergenic
1105704946 13:22962859-22962881 CCCTGGCTCCCTCTCTCTCCAGG - Intergenic
1107012692 13:35683917-35683939 CCCTGGAGCCTCCTTTCTCCTGG - Intergenic
1107646189 13:42496558-42496580 CCCTGCTGGCTTCTCCCTCCTGG + Intergenic
1108075983 13:46680212-46680234 CTGTGGCTCCTTCTGTCTCCAGG - Intronic
1114619137 14:24084575-24084597 CCATGGAGCCTTCAGTCTCCTGG - Intronic
1117449465 14:55836952-55836974 CCCTGGTGCCATCACCCTCCTGG - Intergenic
1118033198 14:61838446-61838468 ACATGGTGCATTCTCTCTCAGGG - Intergenic
1119130112 14:72164227-72164249 CAGAGATGCCTTCCCTCTCCTGG - Intronic
1119323440 14:73744954-73744976 CCGTGGAGCCTGCTGTCTGCTGG - Intronic
1119679930 14:76584689-76584711 TCCTGGTGCATTCTCACTCCAGG + Intergenic
1121283573 14:92716838-92716860 CCGTGATGCCTTCATTCACCTGG - Intronic
1122156837 14:99755104-99755126 CGTTGGTGCCTTATCTTTCCTGG + Intronic
1122454939 14:101842677-101842699 CCGTGGTGCCTGCTCACACCTGG + Intronic
1202936294 14_KI270725v1_random:90911-90933 TTCTGGTGGCTTCTCTCTCCCGG + Intergenic
1123723288 15:23078902-23078924 CCGTGGTGCGATCTCTATCTCGG + Intergenic
1127572990 15:60262314-60262336 ACATGCTGCCTTCACTCTCCTGG + Intergenic
1128651330 15:69415990-69416012 CCGGGGTGTCTTAGCTCTCCTGG - Exonic
1131284123 15:91043494-91043516 CCTTAGTCCCTCCTCTCTCCAGG + Intergenic
1131827109 15:96330858-96330880 CCGAGTTGCCTCCTTTCTCCGGG + Exonic
1132756348 16:1487303-1487325 CTGTGGTACTTACTCTCTCCTGG + Exonic
1132911843 16:2317764-2317786 GCGTGATGGCTTCTCTCCCCAGG - Exonic
1133908702 16:10045155-10045177 CCTTGGTGCCTTCCATCACCAGG + Intronic
1135330833 16:21558342-21558364 TCGTGGTGGCTGCTCTCACCAGG - Intergenic
1136016194 16:27402648-27402670 CCAGGGTGCCTTCTCTGCCCAGG + Intronic
1137247374 16:46716899-46716921 CCTGGGTGCCCCCTCTCTCCAGG - Intronic
1141178892 16:81739084-81739106 CCGTCGGGCCTTCTCCCTCCAGG + Intronic
1144703774 17:17354343-17354365 CCGTGCTGCCTTGTTTCGCCGGG - Intergenic
1146660015 17:34659320-34659342 CCGTCCTGCCTTCTCTGTCTGGG - Intergenic
1147557344 17:41487737-41487759 CCGTCTTGCCTCCTCTCTGCAGG - Exonic
1148251138 17:46081938-46081960 CTGTGATTCCTTCTCTTTCCTGG - Intronic
1149476089 17:56962174-56962196 CCGTGGTGCACTCTGCCTCCCGG + Intergenic
1152293287 17:79452904-79452926 CCGTGGTGCCATCCCGCTCACGG + Intronic
1152550337 17:81026652-81026674 CCCTGGTGCCTCCTCCTTCCCGG - Intergenic
1152560284 17:81075260-81075282 CCTTGCTGCCCTCTCTCTTCCGG + Intronic
1152627136 17:81393069-81393091 CCGTGGGGCCCAGTCTCTCCTGG - Intergenic
1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG + Intronic
1152739986 17:82014599-82014621 CTGTGGTGCCGCCTCCCTCCCGG + Intronic
1152754857 17:82082924-82082946 TCGTGTTGACTTCTCGCTCCGGG - Exonic
1157323232 18:46649881-46649903 CATTCTTGCCTTCTCTCTCCAGG - Intronic
1160614992 18:80119457-80119479 CCTTGGTTCTTTCTCTCTACAGG - Intronic
1160804493 19:986114-986136 CCCTGCTGCCTCCTTTCTCCAGG + Intronic
1162022179 19:7872961-7872983 GCGTGGCCCCTTCTGTCTCCAGG - Exonic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166720048 19:44991392-44991414 GCATGGGGCCTGCTCTCTCCTGG - Intronic
1168405358 19:56107737-56107759 CTGTGGTGCCTTCTTTCTGAGGG - Intronic
1202684255 1_KI270712v1_random:34595-34617 TTCTGGTGGCTTCTCTCTCCCGG - Intergenic
924998767 2:387001-387023 CCCTGCTCCCTTCTCTGTCCTGG + Intergenic
925148826 2:1600894-1600916 CCGTGGTGCCAGCTCCCTTCAGG + Intergenic
925148843 2:1600965-1600987 CTGTGGTGCCAGCTCCCTCCAGG + Intergenic
925148861 2:1601036-1601058 CCGTGGTGCCAGCTCCCTCCAGG + Intergenic
925148880 2:1601107-1601129 CCGTGGTGCCAGCTCCCTCCAGG + Intergenic
926151418 2:10427655-10427677 CCGTGGCCCCTGCACTCTCCAGG + Intergenic
926173704 2:10570259-10570281 CCATTGTTCCTTCTCTCTTCAGG - Intergenic
926860123 2:17300706-17300728 CCCTGTTGCCTTCTCACTTCAGG + Intergenic
929648112 2:43650205-43650227 CAGTGGTGCCTTCTGCCCCCTGG + Intronic
934247465 2:90320253-90320275 TTCTGGTGGCTTCTCTCTCCCGG + Intergenic
934261860 2:91482350-91482372 TTCTGGTGGCTTCTCTCTCCCGG - Intergenic
934304900 2:91813339-91813361 TTCTGGTGGCTTCTCTCTCCCGG - Intergenic
934328357 2:92039409-92039431 TTCTGGTGGCTTCTCTCTCCCGG + Intergenic
934466736 2:94269950-94269972 TTCTGGTGGCTTCTCTCTCCCGG + Intergenic
935847441 2:107182062-107182084 CAGTGGTGACTTCTCTCTCCAGG + Intergenic
939859152 2:147396918-147396940 CAGTGGTGGCTTCTCTCACTAGG - Intergenic
939873921 2:147554956-147554978 CCCTGATGCTTTCCCTCTCCTGG - Intergenic
940455291 2:153890524-153890546 CCGTGTTGCTTTCTCAATCCAGG + Intronic
942587858 2:177504186-177504208 CTGTGGTGCTTTTTCTCTCTTGG + Intronic
943670336 2:190653532-190653554 CCGTGGTTTCTTCCCACTCCTGG + Intronic
948265627 2:236633367-236633389 CCCCGCTGCCTCCTCTCTCCTGG - Intergenic
948289683 2:236816000-236816022 CCTTTGTGCCTGCTCTCTCCTGG + Intergenic
948476049 2:238220764-238220786 CCCTGGTGACTCCTCTCTGCAGG + Intergenic
948491184 2:238314302-238314324 GCTTTGTGGCTTCTCTCTCCTGG + Intergenic
948650822 2:239442570-239442592 CTGTGCTGCCTTCTGTCTCCTGG - Intergenic
1168880804 20:1204595-1204617 CTGAGCTGCCTCCTCTCTCCTGG - Intronic
1168957135 20:1842012-1842034 CCGTGGTGGCTGTTCTCCCCTGG + Intergenic
1169077082 20:2767983-2768005 ACTTGGCGCCTTCTCTCTCAAGG - Intergenic
1171206205 20:23283248-23283270 CCCTGGTGGCCTCTCCCTCCTGG + Intergenic
1171724514 20:28603483-28603505 CCGACTTGCCTTCTCTATCCTGG - Intergenic
1171788711 20:29498008-29498030 CCGATTTGCCTTCTCTATCCTGG - Intergenic
1171858822 20:30376492-30376514 CCGATTTGCCTTCTCTATCCTGG + Intergenic
1174569416 20:51491080-51491102 CAGTGGTACTTTTTCTCTCCTGG - Intronic
1175266139 20:57704628-57704650 CGGTGTGGCCTTCTCTCTTCAGG - Intronic
1175924731 20:62466127-62466149 CCCTGGTGCCTTCTGGCCCCTGG - Intronic
1176587204 21:8598694-8598716 TTCTGGTGGCTTCTCTCTCCCGG - Intergenic
1179899246 21:44380415-44380437 CCCTGGAGCCCTCTCTCTGCTGG + Intronic
1180141524 21:45896186-45896208 CAGCTGTGCCTTCTCTCTCCAGG + Exonic
1180147681 21:45930350-45930372 CCCTGGAGGCTTTTCTCTCCAGG + Intronic
1180270035 22:10575691-10575713 TTCTGGTGGCTTCTCTCTCCCGG - Intergenic
1180298066 22:10962180-10962202 CCGACTTGCCTTCTCTATCCTGG - Intergenic
1180410347 22:12601618-12601640 CCGACTTGCCTTCTCTATCCTGG + Intergenic
1180587868 22:16909125-16909147 TTCTGGTGGCTTCTCTCTCCCGG + Intergenic
1181022185 22:20109403-20109425 CAGTGGTGTCTTCTGTCTTCAGG + Intronic
1181026233 22:20129363-20129385 CCGAGGGGCCTTCTCACTGCTGG - Intergenic
1181096379 22:20507842-20507864 CCCCGGCGCCTTCTGTCTCCCGG - Intronic
1181097845 22:20518243-20518265 GCCTGGTGACTTCTCTCACCTGG + Intronic
1182544821 22:31068983-31069005 CCATGCTGCTTTCTCTCCCCTGG - Intronic
1183182670 22:36271509-36271531 CCTAGGTGCCCTCTCTGTCCGGG + Intergenic
1183524462 22:38315334-38315356 CCGGGGTTCCCTGTCTCTCCTGG - Intronic
1183692765 22:39400090-39400112 CCGTGTTCCCTTCTGGCTCCAGG - Intronic
1184215346 22:43063266-43063288 GCCTGCTGCCTTCTTTCTCCAGG + Intronic
1184858057 22:47157246-47157268 CCGGAGTGGTTTCTCTCTCCAGG - Intronic
1184890678 22:47377110-47377132 CCGAGGTGCCTTCCCTCCCAGGG - Intergenic
1184951258 22:47844019-47844041 CCCTGGTGATCTCTCTCTCCTGG - Intergenic
950072586 3:10164728-10164750 CCGTGTGGCCTTCTCCCACCAGG + Intergenic
950112398 3:10427819-10427841 CCATGTTTCCTTCTCTCTCGTGG + Intronic
950507440 3:13403969-13403991 CCCTGGGGCCTGCTCTCTCTGGG + Intronic
951981864 3:28575547-28575569 CCCTGGTCCCCTCCCTCTCCCGG - Intergenic
952401793 3:32970034-32970056 CTCTAGTGCCTTCTCTGTCCAGG - Intergenic
953051629 3:39349476-39349498 CTCTAGTGCCTTCTCTGTCCAGG - Intergenic
956778304 3:72584873-72584895 CCATGGTGCCTTCCTTCTCCTGG + Intergenic
957229488 3:77493638-77493660 CCTGGGTGCCTTCTTTCCCCTGG + Intronic
961326527 3:126112437-126112459 CCCTGGTCTCTTCTCTTTCCAGG + Intronic
963052402 3:141153248-141153270 CTGTTGTGCCTTCTCTCCACTGG - Intergenic
964695467 3:159503003-159503025 AAGTGATGCCTTCTCTCCCCAGG + Intronic
968474005 4:794696-794718 CCGTGGCTCTTTCTCCCTCCTGG + Intronic
968830747 4:2932001-2932023 GCGTGGAGCCTGCTCTCCCCTGG - Intronic
970450317 4:16160089-16160111 CCCAGGTTCCTTCTCTCTCATGG + Intergenic
972248158 4:37268236-37268258 CCGTATTATCTTCTCTCTCCTGG + Intronic
973538172 4:51905781-51905803 CCGTGGTCTCTGCTCTCACCTGG - Intronic
974293259 4:59961833-59961855 CCATGGTGCCTACTCTCTGTAGG + Intergenic
979870434 4:125813510-125813532 CCTTTCTGACTTCTCTCTCCTGG - Intergenic
980250680 4:130310545-130310567 CCGTGGTGTTTGCTCTCTGCTGG - Intergenic
985436964 4:189940161-189940183 CCGACTTGCCTTCTCTATCCTGG + Intergenic
985518871 5:361349-361371 GCGTGGTGCCATCCCACTCCTGG - Intronic
986646076 5:9917283-9917305 CGGTGGTGACTTCCCTCTCAGGG - Intergenic
988099749 5:26660919-26660941 CCGTGGTGCTTTGTTTCTTCTGG - Intergenic
988589820 5:32539073-32539095 ACATGGTTCATTCTCTCTCCAGG + Intronic
992068976 5:73132250-73132272 GCTTGGTCCATTCTCTCTCCAGG + Intergenic
992614495 5:78535547-78535569 GGGAGGGGCCTTCTCTCTCCTGG - Intronic
994164717 5:96596710-96596732 CAGTGGAGCCTCCACTCTCCAGG - Intronic
994965461 5:106664209-106664231 CCATGGTGCCTTCTCTCTCATGG + Intergenic
997246123 5:132351099-132351121 CCCTGGTTCATTCTCTATCCTGG + Intergenic
997257161 5:132437904-132437926 CCTGGGTCCCTGCTCTCTCCTGG - Intronic
999825303 5:155267902-155267924 CCATGCTGACTTCTCTCTTCTGG + Intergenic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1003858863 6:10303624-10303646 CCATGGTGACTTTTCTCACCTGG - Intergenic
1004312171 6:14555291-14555313 CCTGGGGGCCTCCTCTCTCCAGG + Intergenic
1006367233 6:33622680-33622702 GCGTGGTGCCTTCTTTCTGATGG + Intronic
1007565021 6:42843333-42843355 CCATGGTCTCTTTTCTCTCCAGG - Intronic
1012638371 6:101577824-101577846 CTTTGGTCCCTTCTCTCTCAAGG - Intronic
1016871327 6:148819985-148820007 CCATGGGGGCCTCTCTCTCCGGG + Intronic
1019162174 6:170076050-170076072 CCGTCTTGCGTTCTCTCTCCAGG - Intergenic
1019600602 7:1881798-1881820 CCATGGTGCCCCCTCACTCCAGG + Intronic
1020066766 7:5194244-5194266 CCCTGGTGCCCTCTCTTTCAGGG - Intronic
1024311078 7:47969690-47969712 CCGTGGTTCCTTCTCAGTGCAGG - Intronic
1026172122 7:67963095-67963117 CAGTGCTGCCTCCTCTCCCCTGG - Intergenic
1027186268 7:75972570-75972592 CCGGGCTGCGTTCCCTCTCCTGG - Intronic
1029371496 7:100153816-100153838 CTGTGCTCCCTTCCCTCTCCTGG + Intronic
1031979435 7:128115303-128115325 CAGTGGTGACTTCATTCTCCCGG + Intergenic
1032501111 7:132400630-132400652 CCCTGGAGGCTTCTCTTTCCTGG - Intronic
1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG + Intergenic
1033661662 7:143407305-143407327 GCATGGTGCATTCTCTCCCCGGG + Intronic
1034120291 7:148620679-148620701 CCAAGGAGCCTTCTGTCTCCTGG - Intergenic
1035079212 7:156202333-156202355 CCTTGGGGCCATCTCTCTCCTGG - Intergenic
1035695146 8:1590403-1590425 CCGTGTTGGCTTTTCTCTTCCGG + Intronic
1036209257 8:6828735-6828757 CCCTGGTGCCATCTGTCTACAGG + Intronic
1039411856 8:37361342-37361364 CCATCTTGCCTTCTCTCTTCTGG - Intergenic
1039506289 8:38054782-38054804 CAGTGGTGCCCTCTCTTTGCAGG - Intronic
1041529601 8:58850271-58850293 CTGCTGTGCCTTCTCTTTCCAGG - Intronic
1048594814 8:135855135-135855157 CCGATTTGCCTTCTCTGTCCTGG - Intergenic
1048958567 8:139556943-139556965 CAGCAGTGCCTTCTCTCTCTAGG - Intergenic
1049320114 8:141991795-141991817 CTCTGCTGTCTTCTCTCTCCAGG + Intergenic
1049388810 8:142357797-142357819 CCGTGGTGGCTTCTCTCCCTGGG - Intronic
1049483951 8:142841734-142841756 CTCTGGTGCCCTCTCTCCCCAGG + Intronic
1052819711 9:33129127-33129149 CTGTGGAGCCTTCCCTCTGCAGG + Intronic
1053066294 9:35071914-35071936 TCGCGGGGCCTGCTCTCTCCGGG + Intronic
1053071433 9:35104382-35104404 CTGGGGTGCCTCCTCTCACCTGG - Exonic
1053696789 9:40646744-40646766 TTCTGGTGGCTTCTCTCTCCCGG + Intergenic
1053725094 9:40991676-40991698 CCGACTTGCCTTCTCTATCCTGG + Intergenic
1053943182 9:43276887-43276909 TTCTGGTGGCTTCTCTCTCCCGG + Intergenic
1054308040 9:63445975-63445997 TTCTGGTGGCTTCTCTCTCCCGG + Intergenic
1054340874 9:63860317-63860339 CCGACTTGCCTTCTCTATCCTGG - Intergenic
1054406770 9:64769974-64769996 TTCTGGTGGCTTCTCTCTCCCGG + Intergenic
1054440397 9:65255434-65255456 TTCTGGTGGCTTCTCTCTCCCGG + Intergenic
1054490010 9:65766504-65766526 TTCTGGTGGCTTCTCTCTCCCGG - Intergenic
1057075059 9:92134292-92134314 CCTTGATGCCTTCTCTGCCCAGG - Intergenic
1061087863 9:128409631-128409653 CCCTAGGGCCTTCTCTCTCGAGG - Intergenic
1061550337 9:131331023-131331045 CCGTGTGGCCTGCTCTCCCCAGG - Intergenic
1062253166 9:135608463-135608485 CCGTGGTTCCTGCCCTCTCCAGG - Intergenic
1062334560 9:136059374-136059396 CCGTGCTGGCTTCTCTCTGGAGG - Intronic
1062681909 9:137786726-137786748 CCGTGTGGCCTCATCTCTCCCGG + Intronic
1202779241 9_KI270717v1_random:20395-20417 TTCTGGTGGCTTCTCTCTCCCGG + Intergenic
1203449723 Un_GL000219v1:100313-100335 CCGACTTGCCTTCTCTATCCTGG - Intergenic
1203453476 Un_GL000219v1:143348-143370 CCGAGTTTCCTTCTGTCTCCAGG - Intergenic
1203586302 Un_KI270747v1:6792-6814 TTCTGGTGGCTTCTCTCTCCCGG + Intergenic
1203617163 Un_KI270749v1:76405-76427 TTCTGGTGGCTTCTCTCTCCCGG - Intergenic
1185608398 X:1380383-1380405 CCATGGTGACTTCTGTCTCCCGG + Intronic
1188113886 X:26221686-26221708 CTGTGGTGCCTTCTCTGTTCTGG - Intergenic
1189320901 X:40086573-40086595 CCGTGGAGCTTTCTCTCATCTGG + Intronic
1198618221 X:138481003-138481025 CTGTGGTGCCTTCTCTATCTGGG - Intergenic
1199622608 X:149713620-149713642 CAGGGGTGCCTCCTCTCTCTGGG - Intronic