ID: 1152741132

View in Genome Browser
Species Human (GRCh38)
Location 17:82018935-82018957
Sequence TGCACACTATTGTCCCAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152741126_1152741132 -2 Left 1152741126 17:82018914-82018936 CCTGTAGGACCCCGGGTGGCATG 0: 1
1: 0
2: 1
3: 5
4: 81
Right 1152741132 17:82018935-82018957 TGCACACTATTGTCCCAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 95
1152741118_1152741132 14 Left 1152741118 17:82018898-82018920 CCTTTCCCAGCACCTGCCTGTAG 0: 1
1: 0
2: 1
3: 42
4: 478
Right 1152741132 17:82018935-82018957 TGCACACTATTGTCCCAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 95
1152741117_1152741132 19 Left 1152741117 17:82018893-82018915 CCAGGCCTTTCCCAGCACCTGCC 0: 1
1: 0
2: 4
3: 72
4: 769
Right 1152741132 17:82018935-82018957 TGCACACTATTGTCCCAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 95
1152741121_1152741132 8 Left 1152741121 17:82018904-82018926 CCAGCACCTGCCTGTAGGACCCC 0: 1
1: 0
2: 4
3: 25
4: 258
Right 1152741132 17:82018935-82018957 TGCACACTATTGTCCCAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 95
1152741120_1152741132 9 Left 1152741120 17:82018903-82018925 CCCAGCACCTGCCTGTAGGACCC 0: 1
1: 0
2: 3
3: 33
4: 319
Right 1152741132 17:82018935-82018957 TGCACACTATTGTCCCAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 95
1152741116_1152741132 27 Left 1152741116 17:82018885-82018907 CCTGCTGGCCAGGCCTTTCCCAG 0: 1
1: 0
2: 2
3: 35
4: 356
Right 1152741132 17:82018935-82018957 TGCACACTATTGTCCCAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 95
1152741124_1152741132 2 Left 1152741124 17:82018910-82018932 CCTGCCTGTAGGACCCCGGGTGG 0: 1
1: 0
2: 2
3: 9
4: 104
Right 1152741132 17:82018935-82018957 TGCACACTATTGTCCCAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152741132 Original CRISPR TGCACACTATTGTCCCAGGG AGG Exonic
900189080 1:1345750-1345772 TGCACCCCATTCTCCCAAGGCGG + Intronic
909467247 1:75985921-75985943 GGCACAGTATTGTCCCTTGGGGG - Intergenic
920685038 1:208102777-208102799 TGCACACTCTTGGCACAGAGGGG + Intronic
1068446752 10:57134893-57134915 TGCAAAGTATTGACCCTGGGTGG + Intergenic
1073362448 10:102910621-102910643 TGCAAAGTATTGTTCCTGGGTGG + Intergenic
1078457857 11:11489402-11489424 CTCACACTATTATCTCAGGGAGG - Intronic
1082267738 11:50137931-50137953 TGCACAATAGTGTACCAGGGTGG + Intergenic
1082288350 11:50340627-50340649 TGCACAATAGTGTACAAGGGTGG - Intergenic
1084888883 11:72226872-72226894 GGAACATTATTGTCCCAGGAGGG + Intronic
1089310198 11:117552910-117552932 TGCTCAGTATTGTCCCAGGCTGG + Intronic
1101535599 12:105613551-105613573 TCCACACCACTATCCCAGGGCGG + Intergenic
1102695924 12:114799463-114799485 TTCACACTATTCACCCAGGCTGG - Intergenic
1103768893 12:123304388-123304410 TGCAAAATATTATCCCAGGATGG - Intronic
1104714907 12:131010224-131010246 TTCACACTGTGTTCCCAGGGTGG + Intronic
1106456791 13:29934924-29934946 GGAACACTTTTGTGCCAGGGAGG + Intergenic
1108586437 13:51874132-51874154 CTCACACTACTGTCCCAGGCAGG - Intergenic
1115381773 14:32747707-32747729 TTCACACTACTGTCTGAGGGTGG + Intronic
1116170959 14:41401610-41401632 TACAAACTCTTGTCCCAGTGCGG + Intergenic
1118045989 14:61971885-61971907 TAGACACTATTGTCCCAGCTGGG + Intergenic
1119433337 14:74582607-74582629 TGGACACTATTGGCTCAGAGAGG + Intronic
1122139841 14:99656396-99656418 TGCACTCTATCGTGCCAAGGAGG - Intronic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1123706838 15:22956724-22956746 TGCACACTGCTGTCTCGGGGCGG - Intronic
1123992196 15:25691938-25691960 TTAACTCTATTCTCCCAGGGTGG - Intronic
1130424021 15:83777012-83777034 TGCACAGTGTTAGCCCAGGGTGG - Intronic
1132814535 16:1819415-1819437 TACACGCTCTTGTTCCAGGGTGG - Intronic
1133146733 16:3792853-3792875 TGCACTGTATCATCCCAGGGGGG - Intronic
1137906241 16:52325018-52325040 TGCAAAGTGTTGTCCCTGGGAGG + Intergenic
1139119335 16:63996897-63996919 TACACATTATTATCACAGGGAGG + Intergenic
1139130453 16:64136468-64136490 TGCTCACTATGCTCCCATGGAGG + Intergenic
1139235873 16:65338442-65338464 TGTACACTATACTCCCAGAGTGG + Intergenic
1142814236 17:2412747-2412769 TGCTCACCAGTGTCCCAGGAGGG + Intronic
1146297523 17:31661464-31661486 TGCACATTCTTGGCCCAGCGCGG - Intergenic
1149592243 17:57838999-57839021 GGCACACTTTGGCCCCAGGGAGG + Exonic
1152741132 17:82018935-82018957 TGCACACTATTGTCCCAGGGAGG + Exonic
1153751968 18:8241600-8241622 TGCACACTGATGCCCCATGGAGG - Intronic
1154318437 18:13325024-13325046 TGTACACATTTGTCTCAGGGCGG + Intronic
1155618231 18:27745966-27745988 TGCAAACTATTGTTCCTAGGTGG + Intergenic
1160234780 18:77077423-77077445 TGCAAACTAGTGTCCAAGGCTGG + Intronic
1161848436 19:6725725-6725747 TGCTCTCCATTTTCCCAGGGCGG - Intronic
1162907354 19:13831627-13831649 TGGGCACTAGGGTCCCAGGGTGG + Exonic
1164563363 19:29309177-29309199 TACACACGCTTCTCCCAGGGAGG + Intergenic
1164618867 19:29682078-29682100 TGCCCACTGTGGTCCCAGGCTGG + Intergenic
925595687 2:5553319-5553341 TGGCCACTATTGTTCTAGGGAGG + Intergenic
930077675 2:47420268-47420290 TTCTCACTATTTTCCCAGGGTGG - Intronic
931078664 2:58744469-58744491 TGCTCACTATTTTCCTAGGGTGG + Intergenic
941802983 2:169681692-169681714 AACTCACTATAGTCCCAGGGTGG + Intronic
942761958 2:179410126-179410148 ACCACACTATTGCCCCATGGTGG - Intergenic
947896615 2:233680202-233680224 TGCACTTTATAGTCCCATGGTGG + Intronic
948896421 2:240929978-240930000 GGCACAGTATGGCCCCAGGGTGG + Intronic
1169146591 20:3256609-3256631 TGGACACTATTATCCCAGAAGGG + Intronic
1172553801 20:35822990-35823012 TGCAAACTATGGTCCTTGGGTGG - Intronic
1173234017 20:41227171-41227193 TTCACATTATTGTCCTGGGGTGG + Intronic
1174274949 20:49396900-49396922 TGCACTCTATAGGCCCAGGAAGG - Intronic
1176098709 20:63355518-63355540 TCCACACTATTCTCCCAGAAAGG + Intronic
1177188107 21:17819659-17819681 TGCAAACTACTGCCCCGGGGCGG + Intergenic
1181508477 22:23377744-23377766 TTCACCATATTGGCCCAGGGTGG - Intergenic
1182728326 22:32466967-32466989 TCCTCACTATTTTCCCCGGGTGG + Intergenic
951400664 3:22228643-22228665 TGCAAAGTATTGTTCCTGGGTGG + Intronic
955933490 3:64080391-64080413 TGCACACAATTGTCAAGGGGCGG + Intergenic
956093815 3:65695319-65695341 TGGCCAATCTTGTCCCAGGGAGG + Intronic
956126169 3:66012968-66012990 TGCAAACTATTGACCTAGAGTGG - Intronic
957185966 3:76941460-76941482 TGCAAAATATTGTCCTAGAGAGG - Intronic
957739237 3:84241978-84242000 TTCACTCTTTTGTCCCAGGCTGG - Intergenic
961336694 3:126184589-126184611 TGCACACTGCTTTCCCTGGGAGG - Intronic
966272278 3:178121589-178121611 TGCAAAGTATTGTTCCTGGGTGG - Intergenic
966287188 3:178311847-178311869 TGCAAAGTATTGTTCCTGGGTGG + Intergenic
966314855 3:178633573-178633595 TGCACACAGTGGTCACAGGGTGG + Intronic
967405073 3:189106294-189106316 TGCAGACAATATTCCCAGGGTGG - Intronic
967955515 3:194874744-194874766 TGCACACTATGGTCCCGAGAGGG - Intergenic
968519457 4:1029071-1029093 TGCACACCATTGCACCATGGGGG + Intergenic
969878786 4:10156076-10156098 GGCACCCTATAGTCCTAGGGAGG - Intergenic
970349443 4:15186597-15186619 AGCACACTATTTCCCCAGTGTGG - Intergenic
980872723 4:138627926-138627948 TGCACACTGTTTCCCCTGGGGGG + Intergenic
983797479 4:171882784-171882806 TGCAAAGTATTGTTCCTGGGTGG - Intronic
985685914 5:1281398-1281420 TGCACACTCGAGTCCCTGGGGGG - Intronic
992945722 5:81808190-81808212 TGCAAACTATTCTCCCACTGGGG + Intergenic
995731891 5:115253788-115253810 TACACTCTATTTTCCCAGAGAGG + Intronic
998484051 5:142486398-142486420 TGCAAACCATGATCCCAGGGTGG - Intergenic
1001159449 5:169300695-169300717 TGCACACCATGGCCCCCGGGTGG - Exonic
1001364371 5:171122124-171122146 CGCACTCTATTGTCCCTGTGTGG - Intronic
1006473348 6:34240393-34240415 CCCACACCTTTGTCCCAGGGTGG + Intronic
1008828248 6:55725982-55726004 TGCAAACTATTGTCTGAGGCTGG + Intergenic
1012322727 6:97870821-97870843 AGCACACTTTTATCCCATGGAGG - Intergenic
1012324165 6:97893996-97894018 TGCAGTTGATTGTCCCAGGGTGG + Intergenic
1014750041 6:125245406-125245428 TGCACTAAATTGTCCAAGGGAGG + Intronic
1019430243 7:995801-995823 TGCACCCCACTGGCCCAGGGCGG - Intergenic
1026341526 7:69438211-69438233 TGCACACCTTAGTCCCAGGTGGG + Intergenic
1027580417 7:79987903-79987925 TGCAAAGTATTGTTCCTGGGTGG + Intergenic
1033822105 7:145147321-145147343 TTCACCCTATTGTACCAAGGGGG - Intergenic
1036046548 8:5147916-5147938 TGCCCACTATTATCCTTGGGAGG - Intergenic
1037906255 8:22717614-22717636 GGCAGCCTCTTGTCCCAGGGCGG + Intronic
1042143516 8:65703628-65703650 TGCACCCTGTTGGCCCAGGCTGG + Intronic
1044868098 8:96592063-96592085 AGCACACTCTTGGCTCAGGGTGG + Intronic
1046062077 8:109151730-109151752 TACACACTTATGTCCCTGGGAGG + Intergenic
1052491828 9:29179284-29179306 TGCTGCCTATAGTCCCAGGGAGG + Intergenic
1052545932 9:29879554-29879576 TGCCCACTATTGACACAGGTAGG - Intergenic
1058165645 9:101615826-101615848 TGAAAACTATTGACCCAGGGAGG + Intronic
1058935484 9:109766015-109766037 TCCTCACTAATGTCCCAGGGAGG + Intronic
1059886330 9:118748896-118748918 TGCTCACCTTTGTCCCATGGGGG - Intergenic
1192512655 X:71733451-71733473 CTCACTCTATTGTCCCAGGCTGG + Intergenic
1192514042 X:71748058-71748080 CTCACTCTATTGTCCCAGGCTGG - Intergenic