ID: 1152743774

View in Genome Browser
Species Human (GRCh38)
Location 17:82030091-82030113
Sequence CAAGCTGAGACTGCTGGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 404}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152743766_1152743774 17 Left 1152743766 17:82030051-82030073 CCCTGTGCTCACAGCAACAGCGC 0: 1
1: 0
2: 1
3: 9
4: 163
Right 1152743774 17:82030091-82030113 CAAGCTGAGACTGCTGGCGCAGG 0: 1
1: 0
2: 1
3: 17
4: 404
1152743771_1152743774 -5 Left 1152743771 17:82030073-82030095 CCTGGCTCACCTGGAGGACAAGC 0: 1
1: 0
2: 1
3: 22
4: 209
Right 1152743774 17:82030091-82030113 CAAGCTGAGACTGCTGGCGCAGG 0: 1
1: 0
2: 1
3: 17
4: 404
1152743767_1152743774 16 Left 1152743767 17:82030052-82030074 CCTGTGCTCACAGCAACAGCGCC 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1152743774 17:82030091-82030113 CAAGCTGAGACTGCTGGCGCAGG 0: 1
1: 0
2: 1
3: 17
4: 404
1152743765_1152743774 18 Left 1152743765 17:82030050-82030072 CCCCTGTGCTCACAGCAACAGCG 0: 1
1: 0
2: 0
3: 17
4: 184
Right 1152743774 17:82030091-82030113 CAAGCTGAGACTGCTGGCGCAGG 0: 1
1: 0
2: 1
3: 17
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152743774 Original CRISPR CAAGCTGAGACTGCTGGCGC AGG Exonic
900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG + Intergenic
900361470 1:2291112-2291134 CGAGCTGCGAATGCAGGCGCTGG + Intronic
900385523 1:2408884-2408906 GACCCTGAGACTGCTGCCGCGGG + Intronic
901037690 1:6346229-6346251 GAAGCTGAGACTACAGGCACAGG + Intronic
901089941 1:6634511-6634533 GTGGCTGAGACAGCTGGCGCGGG - Exonic
901532793 1:9864049-9864071 GAAGCTGAGGCTGCTGGTTCAGG - Intronic
903239194 1:21971232-21971254 CCATCTGAGACAGCTGGGGCTGG + Intergenic
903243101 1:21996908-21996930 CCATCTGAGACAGCTGGGGCTGG + Intronic
904136287 1:28315092-28315114 GCAGCTGGGACTGCAGGCGCCGG + Intergenic
905215439 1:36403915-36403937 GTAGCTGGGACTGCAGGCGCCGG + Intergenic
905743034 1:40388724-40388746 CAGGCTGCCACTGCTGGCTCGGG - Intronic
907035970 1:51216551-51216573 GTAGCTGGGACTGCAGGCGCGGG - Intergenic
910547208 1:88432245-88432267 CAAGCTGCCACTGCTGGGGGTGG - Intergenic
911054443 1:93698242-93698264 CAAGCTGTGTGTCCTGGCGCAGG + Intronic
911305281 1:96224738-96224760 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
912358488 1:109074648-109074670 GTAGCTGGGACTACTGGCGCCGG - Intronic
912810936 1:112793964-112793986 TAAGCTGAGACTGCTGCAGGAGG + Intergenic
915767205 1:158374523-158374545 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
916147099 1:161749848-161749870 ACAGCTGACTCTGCTGGCGCTGG - Exonic
916835731 1:168543067-168543089 GAAGCAGAGACTGTTGGCCCAGG + Intronic
916838879 1:168579081-168579103 GAAGCAGAGACTGTTGGCCCAGG - Intronic
917477385 1:175380439-175380461 GTAGCTGAGACTACAGGCGCTGG - Intronic
918421241 1:184366024-184366046 GGAGCTCAGACTGCTGGCGATGG - Intergenic
918512058 1:185322080-185322102 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
918654437 1:187006697-187006719 CATGCTGCCACTGCTGGCTCGGG + Intergenic
918720785 1:187850163-187850185 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
919049835 1:192499459-192499481 CAAGCTGAGAGAGCCGGCTCTGG + Intergenic
919250797 1:195054283-195054305 CAAGCTGAGGCAGCCGGCTCCGG - Intergenic
919840572 1:201606162-201606184 AAAGGTGAGACAGCTGGAGCAGG + Intergenic
920315541 1:205073621-205073643 CAAGCTGAGTCAGCTGGGCCTGG - Intronic
921422136 1:214960656-214960678 CAATCTGAGACAGCTGGCATGGG + Intergenic
922310417 1:224383948-224383970 GTAGCTGAGACTACAGGCGCCGG + Intergenic
922546930 1:226464805-226464827 CAAGTTGCCACTGCTGGCTCAGG - Intergenic
1062785226 10:259325-259347 CCAGCTGAGACTGCAGCCCCTGG + Intergenic
1062814200 10:487705-487727 GTAGCTGAGACTACAGGCGCTGG + Intronic
1065308339 10:24389884-24389906 CGGGTTGAGACTGCTGGGGCAGG + Intronic
1065691243 10:28336004-28336026 ATAGCTGAGACTACAGGCGCAGG + Intergenic
1065752215 10:28897175-28897197 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1067037882 10:42932966-42932988 CCCGCTGAGACTGGGGGCGCGGG - Intergenic
1069186574 10:65429815-65429837 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1069611013 10:69772559-69772581 CAAGATGAGACTGCGGAAGCTGG + Intergenic
1069745979 10:70715373-70715395 CAAGCAGAGACTGTAGGAGCTGG - Intronic
1071085403 10:81863076-81863098 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1071332137 10:84571162-84571184 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1071391103 10:85176072-85176094 GAAACTCAGACTGCTGGTGCTGG - Intergenic
1071503751 10:86220955-86220977 CAAGCTGAGAAAGCTGGCTTTGG - Intronic
1073143094 10:101261801-101261823 CAGGCTGAGCCTGCAGGTGCTGG - Intergenic
1074996399 10:118760546-118760568 CAAGCTGAGGGTGCCGGCTCCGG + Intergenic
1075211843 10:120497908-120497930 GTAGCTGAGACTACAGGCGCTGG - Intronic
1075591626 10:123695673-123695695 CAAGCTGAGTCTTTTGGTGCAGG - Intergenic
1076101671 10:127785264-127785286 GTAGCTGAGACTACAGGCGCAGG + Intergenic
1076562079 10:131373603-131373625 CAGGCAGAGGCTGCTGGAGCTGG - Intergenic
1076616576 10:131759116-131759138 TAAGCAGAGAGGGCTGGCGCTGG - Intergenic
1076900485 10:133335342-133335364 CGGGCGGAGACTCCTGGCGCGGG - Intronic
1077253949 11:1572410-1572432 GAAGCTGAGGCGGCTGCCGCGGG + Intergenic
1077377211 11:2210687-2210709 CCAGCCGAGGCTGCTGGCCCTGG + Intergenic
1077584551 11:3440711-3440733 CCAGCTGACACTGCTGGAGGAGG - Intergenic
1081315160 11:41622838-41622860 CAAGCCGAGGCAGCTGGCTCCGG - Intergenic
1081324336 11:41727490-41727512 CAAGTTGCCACTGCTGGCTCAGG + Intergenic
1081420846 11:42873881-42873903 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1081915406 11:46727351-46727373 AAAGCTGAGACTGACGGAGCTGG + Intronic
1082813663 11:57494140-57494162 CAAGCTGAGTGGGCTGGCCCTGG - Exonic
1083074343 11:60020615-60020637 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1083162225 11:60861631-60861653 GTAGCTGGGACTGCAGGCGCTGG - Intergenic
1083162678 11:60864974-60864996 CAGGCTGAGGGTGCTGGCGAGGG - Intergenic
1084013777 11:66366998-66367020 TAAGCTGAGGCTGCAGGCGAAGG + Intronic
1084241450 11:67823364-67823386 CCAGCTGACACTGCTGGAGGAGG - Intergenic
1084830989 11:71769276-71769298 CCAGCTGACACTGCTGGAGGAGG + Intergenic
1086255239 11:84867942-84867964 GTAGCTGGGACTGCAGGCGCCGG - Intronic
1086273456 11:85096208-85096230 CAGGTTGCCACTGCTGGCGCGGG - Intronic
1088570828 11:111221940-111221962 CAAGCTGAGAGAGCCGGCTCCGG - Intergenic
1089005492 11:115087455-115087477 CAAGCTGCCAGTGCTGGGGCAGG + Intergenic
1089481305 11:118807322-118807344 GTAGCTGAGACTACAGGCGCGGG - Intergenic
1090776773 11:129972219-129972241 CAAGCTGAGGGAGCTGGCTCTGG + Intronic
1090820568 11:130337758-130337780 CAAGCTGAGGAGGCTGGCTCTGG + Intergenic
1091175390 11:133553215-133553237 CCAGCTGATACTGATGCCGCTGG + Intergenic
1091201165 11:133782311-133782333 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1092366498 12:7881242-7881264 CAAGCTGAGGGAGCTGGCTCCGG - Intronic
1092411704 12:8257999-8258021 CCAGCTGACACTGCTGGAGGAGG - Intergenic
1092545905 12:9450783-9450805 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1094409785 12:30156833-30156855 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1094507051 12:31071290-31071312 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1094549079 12:31433181-31433203 CATGCTCAGAATGCTGGCGAAGG + Exonic
1094722015 12:33075309-33075331 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1095123239 12:38442925-38442947 CAGGTTGCCACTGCTGGCGCCGG - Intergenic
1095533690 12:43221411-43221433 AAAGCTGTGACTGCTGGCTGTGG - Intergenic
1095624149 12:44295331-44295353 GTAGCTGGGACTGCAGGCGCAGG + Intronic
1095897323 12:47292951-47292973 GTAGCTGGGACTACTGGCGCCGG - Intergenic
1095901492 12:47333346-47333368 CAAGCTGAGAGAGCAGGCTCCGG - Intergenic
1097791243 12:63817793-63817815 CAAGTTCAGACTGCTGGGGTTGG - Intergenic
1098946956 12:76599998-76600020 GAAGCAGAGACTGTTGGCCCAGG + Intergenic
1099192396 12:79573880-79573902 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1099443794 12:82728733-82728755 CAAGCTGAGGAAGCTGGCTCCGG - Intronic
1101155022 12:101919049-101919071 GTAGCTGGGACTGCAGGCGCAGG + Intronic
1101791446 12:107931264-107931286 CAAGGTTACACTGCTGGCACAGG - Intergenic
1102243205 12:111338368-111338390 CAAGCTGAGCCTGAAGGGGCGGG + Exonic
1102377301 12:112432988-112433010 GTAGCTGGGACTGCAGGCGCAGG + Intronic
1102490423 12:113287014-113287036 CTTCCTGGGACTGCTGGCGCTGG + Exonic
1106133983 13:26960927-26960949 CGAGCTGAGCATCCTGGCGCAGG + Intergenic
1106163328 13:27219725-27219747 CAAGCAGAGAGAGCTGGCTCCGG - Intergenic
1107652536 13:42559732-42559754 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1107675573 13:42793439-42793461 TTAGCTGAGGCTGCTGGCTCAGG + Intergenic
1108380011 13:49846438-49846460 GTAGCTGAGACTACAGGCGCCGG + Intergenic
1108685511 13:52815615-52815637 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1109124748 13:58504625-58504647 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1109470550 13:62799077-62799099 CAAGCTGCGACTGCAGACCCAGG + Intergenic
1109506102 13:63305709-63305731 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1109563210 13:64077893-64077915 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1109741486 13:66561027-66561049 CAAGCTGAGGCAGCCGGCTCCGG - Intronic
1110471647 13:75866577-75866599 GCAGCTGAGACTACAGGCGCCGG + Intergenic
1110854252 13:80279017-80279039 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1110862084 13:80355508-80355530 CAAGCTGAGAGAGCCGGCTCTGG - Intergenic
1112538228 13:100282408-100282430 CAAGCTGAGAGAGCCGGCTCTGG - Intronic
1116452308 14:45080398-45080420 CAAGCTGAGAGAGCCGGCTCCGG - Intergenic
1117302459 14:54443013-54443035 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1117824429 14:59687257-59687279 GTGGCTCAGACTGCTGGCGCAGG - Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118173745 14:63416188-63416210 GTAGCTGAGACTGCAGGCGCAGG - Intronic
1118888328 14:69885789-69885811 GAAGCAGAGACTGTTGGCCCGGG - Intronic
1119027733 14:71167501-71167523 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1119566132 14:75630862-75630884 CAAGGTGAGCCTGCTGGGCCAGG - Intronic
1122342538 14:101037733-101037755 CAAGCTGTGACTGCAGGGGAGGG + Intergenic
1124389940 15:29245858-29245880 CAGGCTCAGACTGCTGGCAAAGG + Intronic
1124545912 15:30626364-30626386 CCAGTTGAGCCTGCTGGGGCTGG + Exonic
1124779430 15:32615751-32615773 CCAGTTGAGCCTGCTGGGGCTGG + Exonic
1125578234 15:40769161-40769183 CTAGCTGGGACTGCTGCAGCCGG - Intronic
1127766111 15:62186960-62186982 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1128430812 15:67591497-67591519 CCAGCTGGGACTACAGGCGCCGG + Intronic
1129113950 15:73354522-73354544 GATGCTGAGACTGCTGGTGCAGG + Intronic
1129158314 15:73732544-73732566 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1129194600 15:73956344-73956366 CAACGTGAGAATGGTGGCGCTGG + Intergenic
1129466688 15:75728132-75728154 CAAGAGGAGACTGCTGGGGAGGG + Intergenic
1131073236 15:89478968-89478990 CTAGCTGGGACTGCAGGTGCAGG - Intronic
1131899338 15:97070813-97070835 GTAGCTGAGACTACAGGCGCTGG + Intergenic
1132097660 15:99000011-99000033 CAAGCTGAGAGAGCTGGCGCTGG - Intronic
1132855975 16:2044707-2044729 CATGCAGCGACTGCGGGCGCGGG - Exonic
1133352945 16:5114305-5114327 CCAGCTGACACTGCTGGAGGAGG - Intergenic
1133950636 16:10388880-10388902 GAAGCTGGGACTACAGGCGCCGG - Intronic
1135158648 16:20074370-20074392 GAAGCTGAGCTTGCTGGCTCTGG + Intergenic
1135970340 16:27067502-27067524 CAAGCTGATGAAGCTGGCGCTGG - Intergenic
1136163248 16:28435331-28435353 CAAGCTAAGGCAGCTGGCTCCGG - Intergenic
1136216065 16:28793829-28793851 CAAGCTAAGGCAGCTGGCTCCGG + Intergenic
1139442261 16:66974242-66974264 CAAGCTGAGGGAGCTGGCTCCGG - Exonic
1139451297 16:67029619-67029641 CAAGCAGAGGCTGCGGGCGATGG - Intronic
1139476220 16:67203763-67203785 CAAGCTGCGTCTGCTGGAGCTGG + Exonic
1139602997 16:67998177-67998199 CAAGCTGAGGGAGCTGGCTCTGG - Intronic
1139805077 16:69557987-69558009 GAAGCTGAGACTACAGGCACAGG + Intergenic
1139963947 16:70735081-70735103 CAAGCTGAGACTGAGGATGCAGG + Intronic
1141032212 16:80598975-80598997 CAAGCTGGGACTAATGGCACAGG + Exonic
1141465789 16:84204980-84205002 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1141734545 16:85843596-85843618 CAGCCTGAGACTGCTGCCCCTGG - Intergenic
1142397399 16:89840023-89840045 CAACCTGTGGCTACTGGCGCTGG - Intronic
1142441425 16:90100823-90100845 CAGGGTGAGACTTCTGGCCCTGG - Intergenic
1142828859 17:2532495-2532517 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1142941789 17:3386052-3386074 CAACCTGAGCATGGTGGCGCTGG + Intergenic
1143128032 17:4656907-4656929 CAAGCTGAGGGTGCCGGCTCCGG + Intergenic
1143872470 17:9966727-9966749 GTAGCTGGGACTGCAGGCGCCGG - Intronic
1144128034 17:12220864-12220886 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1145194004 17:20870515-20870537 GTAGCTGGGACTGCAGGCGCAGG + Intronic
1145352230 17:22092746-22092768 ATAGCTGGGACTGCAGGCGCAGG + Intergenic
1146667617 17:34715475-34715497 GAAGCTGAGGCTGCTGTTGCTGG - Intergenic
1146740520 17:35279312-35279334 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1146784059 17:35703140-35703162 CTAGCTGGGACTACAGGCGCTGG - Intronic
1147342144 17:39759284-39759306 CTAGCTGAGACTACAGGCGTGGG - Intergenic
1147598428 17:41731661-41731683 GAAGCTGAGGCTGCTGGAGGAGG - Exonic
1148033278 17:44638011-44638033 GTAGCTGGGACTGCAGGCGCGGG + Intergenic
1148372458 17:47110903-47110925 CATGCAGAGACTTCTGGGGCCGG - Intergenic
1148469371 17:47883936-47883958 CAAGCAGAGACTGATGCCGGAGG + Intergenic
1149469256 17:56902631-56902653 TGAGATGAGACTGCTGGCACAGG + Intronic
1149597538 17:57873184-57873206 CACCCTGAGGCTGCTGGTGCAGG - Intronic
1149753929 17:59172486-59172508 CAAGCTGAGGGAGCTGGCTCCGG - Intronic
1149979410 17:61297701-61297723 CAAGCTGAGTCTGGTGGAGAGGG + Intronic
1150222667 17:63506083-63506105 CAAGGTGAGACAGATGGAGCTGG + Intronic
1151036303 17:70804557-70804579 AATTCTGAGACTGCTGGAGCAGG - Intergenic
1152175419 17:78783597-78783619 GTAGCTGAGACTGCAGGCACCGG + Intergenic
1152462026 17:80446560-80446582 CAAGCTGGGGCAGCTGGCCCCGG + Intergenic
1152743774 17:82030091-82030113 CAAGCTGAGACTGCTGGCGCAGG + Exonic
1153070327 18:1098188-1098210 CAAGCTGAGGGCGCTGGCTCTGG - Intergenic
1153075508 18:1157481-1157503 CAAGCTGCCACTGCTGGGGGTGG - Intergenic
1153805705 18:8706620-8706642 CGAGCCGAGACTGCTCGCCCAGG - Intronic
1154057297 18:11024044-11024066 CAAGCTGAGGGAGCTGGCTCCGG + Intronic
1154199327 18:12288241-12288263 GCAGCTGAGACAGCTGGGGCGGG + Intergenic
1156079461 18:33316190-33316212 CAAGCTGAGGGAGCTGGCTCCGG - Intronic
1156659949 18:39335321-39335343 GAAGCAGAGACTGCTGGCCCGGG - Intergenic
1157807749 18:50670807-50670829 GAAGCTGAGGCTGCTGGTGTGGG - Intronic
1157856947 18:51112203-51112225 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1158282351 18:55841093-55841115 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1158311284 18:56161731-56161753 AAAGGTGACACTGCTGGCCCAGG - Intergenic
1158386271 18:56995797-56995819 CAAGCTCAGAGAGCTGACGCTGG - Intronic
1158497984 18:57973952-57973974 CCAGGTGATACTGCTGGCCCTGG - Intergenic
1159743908 18:72209087-72209109 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1160200112 18:76788931-76788953 CAAGCTGAGACAGCTGGCTGTGG + Intergenic
1160266569 18:77343925-77343947 CAAGCTGATGCCACTGGCGCAGG - Intergenic
1162297628 19:9824284-9824306 GTAGCTGAGACTACAGGCGCAGG + Intronic
1162387003 19:10365672-10365694 CCACCTGAGGCTGCTGGCCCAGG - Exonic
1162987058 19:14277598-14277620 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1162995517 19:14332773-14332795 CAAGCTGGGACTACAGGCGCCGG - Intergenic
1163824024 19:19512869-19512891 GTAGCTGAGACTACAGGCGCAGG - Intronic
1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG + Exonic
1166487064 19:43222329-43222351 CAAGCTGAGGGAGCTGGCTCTGG + Intronic
1167534558 19:50041485-50041507 AAAGCTGTGACAGCTGGGGCTGG - Intronic
926121460 2:10243370-10243392 CAGGCTGCGACTCCTGGCCCGGG - Intergenic
926552741 2:14319617-14319639 GAAGCAGAGACTGGTGGCTCAGG - Intergenic
926850618 2:17193516-17193538 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
927281346 2:21311336-21311358 CCAGCTGGGACTACAGGCGCAGG + Intergenic
927734092 2:25502754-25502776 GTAGCTGAGACTACAGGCGCTGG - Intronic
927777753 2:25915463-25915485 CAAGCTGAGGGTGCTGGCTCCGG - Intergenic
928259142 2:29750938-29750960 GTAGCTGGGACTACTGGCGCAGG - Intronic
929665893 2:43833510-43833532 GTAGCTGGGACTGCAGGCGCCGG + Intronic
930195001 2:48500777-48500799 GTAGCTGAGACTACAGGCGCAGG - Intronic
932754407 2:74396447-74396469 CAGGCTGAGCCTGGTGGCTCAGG - Intergenic
933487309 2:82938843-82938865 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
934786698 2:97014661-97014683 CAGGTTGCGCCTGCTGGCGCAGG - Intronic
934977626 2:98815869-98815891 CAAGCTGAAACTACTTGCCCTGG - Intronic
935203994 2:100881980-100882002 TATGCTGAAACTGCTGGGGCTGG + Intronic
936172750 2:110190591-110190613 CAAGCTGAGGGAGCTGGCTCCGG + Intronic
936525722 2:113240321-113240343 CCAGCTGCGAGTGCTGGCACGGG + Intronic
937574627 2:123405154-123405176 CAAGTTGAGACTGCTTCCTCAGG - Intergenic
939145821 2:138413432-138413454 GGAGCTGAGACTGCTGAAGCTGG + Intergenic
939738834 2:145881309-145881331 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
941309734 2:163913574-163913596 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
942038540 2:172035292-172035314 GTAGCTGGGACTGCAGGCGCCGG + Intronic
943222786 2:185132571-185132593 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
943835109 2:192507930-192507952 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
944055142 2:195515641-195515663 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
945298303 2:208192629-208192651 CCAGCTGAGGCTGCTGCAGCTGG + Intergenic
947171868 2:227320589-227320611 CAAGCTGAGAGAGCCGGCTCTGG - Intergenic
947844617 2:233233884-233233906 CAAGCTGAGACTTCTGTGGGAGG - Intronic
948465899 2:238151473-238151495 AAAGCTGAGGCTGCTGGGGAAGG + Exonic
948812994 2:240494524-240494546 CAAGCTGTCACTGCTGGGACAGG - Intronic
1169487190 20:6043468-6043490 GAAGCTGAGACTACAGGCTCTGG - Intronic
1171956047 20:31464633-31464655 CAAGGTGAGCCTGGTGGCTCTGG - Intergenic
1171964558 20:31519556-31519578 GATGCTGACACTGCTGGCCCAGG - Intronic
1171968925 20:31551303-31551325 CATGCTGAGAATGCTGGGGTGGG - Intronic
1172406796 20:34695789-34695811 GTAGCTGGGACTGCAGGCGCCGG - Intergenic
1172524389 20:35589781-35589803 GAAGCTGGGACTGCAGGCACTGG + Intergenic
1173907294 20:46638354-46638376 CAAGCTGAAAGTGCTGGCTCTGG - Intronic
1174109912 20:48191917-48191939 CAAGCTGAGCCTGTTGGGGATGG - Intergenic
1176408813 21:6436742-6436764 CAGCCTGAGACTGCTGCAGCAGG + Intergenic
1178282364 21:31294372-31294394 CAAGCTGAGAGTGTTGGCTTAGG + Intronic
1178454517 21:32735738-32735760 CATGCTGATACTGCTGGTCCAGG + Intronic
1178765020 21:35442273-35442295 GATGCTGACACTGCTGGTGCAGG + Intronic
1179684306 21:43045064-43045086 CAGCCTGAGACTGCTGCAGCAGG + Intergenic
1179814173 21:43893247-43893269 CTAGCAGAGGCTGCTGGCTCAGG - Intronic
1180144835 21:45913171-45913193 CAGGCTAAAAATGCTGGCGCTGG + Intronic
1181654339 22:24283206-24283228 GTAGCTGGGACTACTGGCGCTGG + Intronic
1182287165 22:29255291-29255313 CCAGCTGAGCCTGCTGCTGCAGG - Intronic
1182515934 22:30859077-30859099 CAAGCTGAGACAGAGGGCCCTGG - Intronic
1183517826 22:38277566-38277588 GTAGCTGAGACTACAGGCGCCGG + Intergenic
1183691062 22:39388672-39388694 CAAGCCGGGGCTGCTGGGGCTGG + Intergenic
1185312892 22:50166400-50166422 CACGCTGGGACTGCAGGCGTGGG - Intergenic
1185312898 22:50166424-50166446 CACGCTGGGACTGCAGGCGTGGG - Intergenic
950048824 3:9970309-9970331 CAGGCTTACACTGCTGGTGCTGG + Intronic
950576344 3:13834357-13834379 CAAGCTGGGGCTGCTGATGCTGG + Intronic
952453647 3:33453411-33453433 CAAGCTGAGTGAGCTGGCTCTGG - Intergenic
952593582 3:34988326-34988348 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
952713265 3:36453307-36453329 CAAGCTGAGGGAGCTGGCTCCGG - Intronic
954040958 3:47887168-47887190 CAAGCTGAGGGAGCTGGCTCTGG - Intronic
954163820 3:48740272-48740294 CATTCTGAAACTGCTGGCGTGGG - Intronic
954268716 3:49490697-49490719 GTAGCTGAGACTGCAGGTGCAGG + Intronic
955183297 3:56691842-56691864 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
956563585 3:70611818-70611840 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
957056925 3:75450272-75450294 CCAGCTGACACTGCTGGAGGAGG - Intergenic
957419723 3:79951769-79951791 CAAGCTGAGCGAGCTGGCTCTGG + Intergenic
957918764 3:86721242-86721264 GTAGCTGAGACTACAGGCGCCGG + Intergenic
958001010 3:87748966-87748988 GTAGCTGGGACTGCAGGCGCAGG + Intergenic
958847098 3:99278257-99278279 CAAGCAGGGACTGCTGGGGTTGG - Intergenic
959087933 3:101870891-101870913 GTAGCTGGGACTGCAGGCGCCGG + Intergenic
960685452 3:120289678-120289700 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
961296545 3:125889444-125889466 CCAGCTGACACTGCTGGAGGAGG + Intergenic
963743055 3:149098247-149098269 CAAGCTGAGGCAGCTGGCTCTGG + Intergenic
964065298 3:152570481-152570503 GTAGCTGAGACTACAGGCGCAGG + Intergenic
964407759 3:156367303-156367325 GTAGCTGAGACTACAGGCGCTGG + Intronic
965003472 3:162987313-162987335 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
966159332 3:176951360-176951382 CCAGCTGAGACTGCTGATACAGG - Intergenic
968361686 3:198151799-198151821 CAGGGTGAGACTTCTGGCCCTGG - Intergenic
968768790 4:2489864-2489886 CCAGCTGAGACTTCTGTTGCTGG - Intronic
968999741 4:3970557-3970579 CCAGCTGACACTGCTGGAGGAGG - Intergenic
969290598 4:6236805-6236827 GTAGCTGGGACTGCTGGCGTTGG + Intergenic
969362305 4:6672686-6672708 CAAGCTGAGAGAGCCGGCTCTGG - Intergenic
969415564 4:7055684-7055706 CACGCTGAAACTGCTGCCGCCGG - Exonic
969754269 4:9138078-9138100 CCAGCTGACACTGCTGGAGGAGG + Intergenic
969814164 4:9674354-9674376 CCAGCTGACACTGCTGGAGGAGG + Intergenic
970673214 4:18418736-18418758 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
970827109 4:20289348-20289370 CAAGCTGGGCTTGCTGGCACTGG - Intronic
971201727 4:24515525-24515547 GTAGCTGAGACTACAGGCGCCGG + Intergenic
971280584 4:25239630-25239652 CAAGCTGAGGGAGCTGGCTCTGG + Intronic
971723365 4:30275691-30275713 GTAGCTGAGACTACAGGCGCCGG + Intergenic
972538728 4:40020912-40020934 CAAGCTCAGACTGCCAGCTCTGG + Intergenic
973037049 4:45420125-45420147 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
973878072 4:55241464-55241486 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
975376894 4:73656839-73656861 GTAGCTGGGACTACTGGCGCCGG + Intergenic
975744909 4:77466348-77466370 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
975990428 4:80254185-80254207 GTAGCTGAGACTGCAGGCTCAGG + Intergenic
977081587 4:92536103-92536125 CAGGCTGCCACTGCTTGCGCCGG + Intronic
977189720 4:93984626-93984648 CCAGCTGAGAGTGGTGGCACAGG + Intergenic
977206467 4:94169803-94169825 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
977717402 4:100196918-100196940 CAAGCTGAGGGAGCTGGCTCGGG + Intergenic
977885815 4:102250684-102250706 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
978254935 4:106681852-106681874 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
978584729 4:110265131-110265153 GGAGCTGAGACTGCTGAAGCTGG + Intergenic
979683255 4:123484073-123484095 GTAGCTGAGACTACAGGCGCCGG + Intergenic
981176635 4:141690256-141690278 CAAGCTGAGGGAGCTGGCTCTGG + Intronic
981298221 4:143156940-143156962 CAAGTTCAGACTGCTGGCTTTGG + Intergenic
981476485 4:145192241-145192263 GTAGCTGAGACTACAGGCGCTGG + Intergenic
984014440 4:174408864-174408886 GTAGCTGAGACCGCAGGCGCAGG - Intergenic
984069242 4:175092074-175092096 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
984491344 4:180438492-180438514 CCAGGTGACACTGCTGGGGCTGG - Intergenic
985145380 4:186890078-186890100 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
986871105 5:12047930-12047952 CAGGTTGCGACTGCTGGCTCAGG + Intergenic
987146302 5:14994203-14994225 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
987305111 5:16630151-16630173 CTAGCTGGGACTACAGGCGCGGG + Intergenic
987476749 5:18400069-18400091 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
987532837 5:19143168-19143190 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
988144856 5:27292306-27292328 GTAGCTGAGACTACAGGCGCCGG - Intergenic
988511206 5:31866126-31866148 CGAGCTGGGACTGCAGGCGGGGG + Intronic
990056119 5:51580900-51580922 GGAGCTGAGACTGCAGGCGTGGG - Intergenic
990408033 5:55511791-55511813 GTAGCTGGGACTGCAGGCGCCGG + Intronic
991359435 5:65803730-65803752 CAAGCTGTGGCTGCTGACCCAGG - Intronic
995526411 5:113053832-113053854 CAAGCTGACCATGCTGGAGCTGG - Exonic
996465638 5:123799433-123799455 GATGCTGATACTGCTGGCCCAGG + Intergenic
996585948 5:125088666-125088688 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
997548865 5:134734986-134735008 GTAGCTGAGACTACAGGCGCCGG - Intergenic
997623734 5:135317926-135317948 TAAGCGGACACTGCTGGTGCAGG - Intronic
997760508 5:136444176-136444198 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
998257774 5:140601694-140601716 GATGCTGAGACTGCTGGCACAGG - Intergenic
998307858 5:141096704-141096726 CAAGCAGAGGCTGGTGGTGCTGG + Exonic
998315027 5:141174743-141174765 CAAGCAGAGGCTGGTGGTGCTGG + Exonic
998315604 5:141179945-141179967 CAAGCAGAGGCTGGTGGTGCTGG + Exonic
998316144 5:141184467-141184489 CAAGCAGAGGCTGGTGGTGCTGG + Exonic
998419521 5:141970758-141970780 GGAGCTGAGACTGCTGAAGCTGG - Exonic
1000432403 5:161166503-161166525 CAAGCTGAGGGCGCTGGCTCTGG + Intergenic
1001563197 5:172683549-172683571 CAAGCTGGGCCACCTGGCGCTGG + Exonic
1002292025 5:178206483-178206505 CACGCTGGGACTGCTTGGGCAGG + Intronic
1003236969 6:4303395-4303417 CCAGCAGAGACTGTTGGGGCTGG - Intergenic
1003577990 6:7315181-7315203 CAAGCTGAGGGAGCTGGCTCCGG - Intronic
1003897060 6:10617414-10617436 CAAGCTGAGGGAGCTGGCTCTGG + Intronic
1006183414 6:32167231-32167253 CACGCTGAGTATGCTGGCACTGG - Exonic
1006978413 6:38124716-38124738 CAAGCTGAGGGAGCTGGCTCTGG + Intronic
1007107047 6:39290797-39290819 CATGCTGATCCTGCTGGCCCAGG - Intergenic
1007500836 6:42295546-42295568 CAAGGTGAGGCTGCTGGAGAAGG - Intronic
1007502940 6:42312581-42312603 AAAGCAGACAATGCTGGCGCTGG + Intronic
1008005641 6:46406163-46406185 CAAGCTGAGGGAGCTGGCTCTGG + Intronic
1009915362 6:69988702-69988724 CAAGTTGAGACTGCTGAGGGAGG - Intronic
1011178082 6:84587395-84587417 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1011641412 6:89419312-89419334 GTAGCTGGGACTGCAGGCGCCGG - Intergenic
1012713593 6:102639464-102639486 GTAGCTGAGACTACAGGCGCCGG - Intergenic
1014788958 6:125649676-125649698 CAATCTGAGAATGCTGGTGCTGG - Intergenic
1014940136 6:127428552-127428574 CAGGTTGAGGCTGCTGGCCCCGG + Intergenic
1016836134 6:148478787-148478809 CAGGCTGAGAATGAAGGCGCAGG - Intronic
1016954961 6:149617804-149617826 GTAGCTGAGACTACAGGCGCAGG - Intronic
1017581274 6:155867152-155867174 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1017873136 6:158502942-158502964 CAAGCTGACAGTGCTGGGACAGG - Exonic
1018064288 6:160114898-160114920 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1018675663 6:166220306-166220328 CTAGCTGGGACTACAGGCGCCGG + Intergenic
1019023348 6:168937639-168937661 ATAGCTGAGACTACAGGCGCAGG - Intergenic
1019253998 7:36923-36945 CAGGGTGAGACTTCTGGCCCTGG + Intergenic
1019361378 7:605910-605932 CGGGCTGCGACTGCTGGGGCTGG - Intronic
1019618718 7:1979153-1979175 GAAGCAGAGGCTGCTGCCGCGGG + Intronic
1021965353 7:25913042-25913064 CAAACTGAGACTGTTGGCCATGG + Intergenic
1022174189 7:27857409-27857431 CAAGCTGAGGAAGCTGGCTCTGG + Intronic
1022278568 7:28881868-28881890 GTAGCTGAGACTTCAGGCGCAGG + Intergenic
1022388675 7:29924958-29924980 CAAGATGAGGCTGCTGAGGCTGG - Intronic
1024640043 7:51321004-51321026 GAAGTGGAGACTGCTGGCCCAGG + Intergenic
1024700684 7:51901292-51901314 CAAGCTGAGAGAGCCGGCTCCGG + Intergenic
1025275300 7:57577680-57577702 GTAGCTGGGACTGCAGGCGCAGG - Intergenic
1026237047 7:68535498-68535520 CAAGCTGAGGGTGCTGGCTCCGG + Intergenic
1027052165 7:75027406-75027428 CAGGGTGAGGCTGCTGGCGAGGG - Intronic
1027790751 7:82637128-82637150 CAAGTTGCCACTGCTGGCTCAGG - Intergenic
1029046865 7:97639253-97639275 CCAGCTGAGACTGCAGGCTCTGG + Intergenic
1029532041 7:101131912-101131934 CCAGCTGACACGGCTGGTGCTGG + Exonic
1030215771 7:107042715-107042737 CAAGCTGAGGGAGCTGGCTCAGG + Intergenic
1033207890 7:139438179-139438201 CCAGCTGAGATTGGTGGAGCCGG + Intergenic
1033758647 7:144418295-144418317 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1034044362 7:147912429-147912451 CAGGCTGAGACAGCTGCAGCTGG - Intronic
1034858641 7:154577367-154577389 CCAGGAGAGACTGCTGGTGCAGG + Intronic
1034908087 7:154968658-154968680 CAAGCTGCTGCTGCTGGAGCTGG + Exonic
1036070160 8:5433857-5433879 CAAGGTGAGACAGCTGGAGTTGG - Intergenic
1036377490 8:8213402-8213424 CCAGCTGACACTGCTGGAGGAGG + Intergenic
1036409100 8:8481929-8481951 CTAGCTGGGACTACTGGTGCTGG - Intergenic
1036873435 8:12452268-12452290 CCAGCTGACACTGCTGGAGGAGG - Intergenic
1039068686 8:33631641-33631663 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1040323914 8:46331696-46331718 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1041087431 8:54269781-54269803 GTAGCTGAGACTGCAGGTGCAGG + Intergenic
1041499013 8:58519257-58519279 TAAGCTGAGACATCTGGAGCTGG - Intergenic
1044441593 8:92230752-92230774 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1046018525 8:108635335-108635357 CTATCTGAGACTGCTGCCTCTGG + Intronic
1046251835 8:111642814-111642836 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1048263273 8:132963786-132963808 CCAGATCAGACTGCTGGCACAGG + Intronic
1049423420 8:142526717-142526739 CAATCTGAGACTGCAGGTCCAGG + Intronic
1049722602 8:144126406-144126428 GTAGCTGAGACTACTGGCACGGG + Intergenic
1050253994 9:3774929-3774951 AAAGCTGATACAGCTGGCTCTGG + Intergenic
1050455015 9:5826139-5826161 CAAGATCAGACTGCTGAAGCTGG + Intronic
1051174287 9:14347532-14347554 CAAGCTAACAGTGCTGGGGCGGG + Intronic
1053173444 9:35906628-35906650 CTCGCTGAGGCTGCTGTCGCCGG + Exonic
1056722030 9:89080894-89080916 GTAGCTGGGACTGCAGGCGCCGG + Intronic
1056786636 9:89597298-89597320 GAAGCTGAGGCTGCTGGCCCTGG + Intergenic
1057603154 9:96476934-96476956 CAAGCTGATACTGCTGAAGGAGG + Intronic
1058234935 9:102478181-102478203 GTAGCTGAGACTACAGGCGCAGG - Intergenic
1058707647 9:107650442-107650464 TAAGCTGAGAAGGCTGGCTCTGG + Intergenic
1060893883 9:127205201-127205223 CAAGCTGGGACAGATGGCCCAGG - Intronic
1061095180 9:128452564-128452586 GTAGCTAAGACTGCTGGTGCGGG - Intergenic
1061550914 9:131334202-131334224 TCAGCTGAGGCTGCTGGCGGGGG + Intergenic
1061799756 9:133107329-133107351 CCAGCCCAGACTGCTGGGGCAGG - Intronic
1061839550 9:133349967-133349989 GAAGCAGAGACTGTTGGCCCGGG + Exonic
1061889498 9:133610121-133610143 CGAGCTGAGCCTGCGGTCGCAGG + Intergenic
1062571235 9:137186331-137186353 CAGGCTCAGTCTGCTGGAGCGGG - Exonic
1062746400 9:138215620-138215642 CAGGGTGAGACTTCTGGCCCTGG - Intergenic
1186763521 X:12747677-12747699 CAAGCTGAGGCTGATGCTGCTGG + Intergenic
1188242515 X:27809101-27809123 CAAGCTGAGAGAGCCGGCTCCGG - Intronic
1193040245 X:76997040-76997062 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1193917164 X:87379422-87379444 CAAGGTGAGACTGATGGTGGTGG + Intergenic
1194025634 X:88746724-88746746 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1194316042 X:92379169-92379191 CCAGCTGGGACTGCTGCCCCAGG + Intronic
1195244411 X:102982668-102982690 GAAGCAGAGACTGCTGTGGCTGG - Intergenic
1196866415 X:120075279-120075301 TAAGCTGAGACTGATGGCGGGGG - Intronic
1196876683 X:120161002-120161024 TAAGCTGAGACTGATGGCGGGGG + Intronic
1199845885 X:151692983-151693005 CAAGCTGAGGCTGGAGGGGCTGG - Intergenic
1200624088 Y:5490743-5490765 CCAGCTGGGACTGCTGCCCCAGG + Intronic
1202271544 Y:23078738-23078760 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1202294482 Y:23341944-23341966 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1202424539 Y:24712482-24712504 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1202446250 Y:24957603-24957625 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic