ID: 1152743943

View in Genome Browser
Species Human (GRCh38)
Location 17:82030794-82030816
Sequence CCCCCAAAGTGAGACAGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152743933_1152743943 -3 Left 1152743933 17:82030774-82030796 CCCCCGTGAGGACCCTGAGCCCC 0: 1
1: 0
2: 2
3: 21
4: 224
Right 1152743943 17:82030794-82030816 CCCCCAAAGTGAGACAGGCCGGG 0: 1
1: 0
2: 1
3: 21
4: 203
1152743930_1152743943 21 Left 1152743930 17:82030750-82030772 CCGTCCTGGCTTACGTGCAGGCG 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1152743943 17:82030794-82030816 CCCCCAAAGTGAGACAGGCCGGG 0: 1
1: 0
2: 1
3: 21
4: 203
1152743934_1152743943 -4 Left 1152743934 17:82030775-82030797 CCCCGTGAGGACCCTGAGCCCCC 0: 1
1: 0
2: 2
3: 28
4: 243
Right 1152743943 17:82030794-82030816 CCCCCAAAGTGAGACAGGCCGGG 0: 1
1: 0
2: 1
3: 21
4: 203
1152743936_1152743943 -6 Left 1152743936 17:82030777-82030799 CCGTGAGGACCCTGAGCCCCCCA 0: 1
1: 0
2: 2
3: 23
4: 324
Right 1152743943 17:82030794-82030816 CCCCCAAAGTGAGACAGGCCGGG 0: 1
1: 0
2: 1
3: 21
4: 203
1152743935_1152743943 -5 Left 1152743935 17:82030776-82030798 CCCGTGAGGACCCTGAGCCCCCC 0: 1
1: 0
2: 3
3: 38
4: 362
Right 1152743943 17:82030794-82030816 CCCCCAAAGTGAGACAGGCCGGG 0: 1
1: 0
2: 1
3: 21
4: 203
1152743931_1152743943 17 Left 1152743931 17:82030754-82030776 CCTGGCTTACGTGCAGGCGTCCC 0: 1
1: 0
2: 0
3: 0
4: 58
Right 1152743943 17:82030794-82030816 CCCCCAAAGTGAGACAGGCCGGG 0: 1
1: 0
2: 1
3: 21
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152743943 Original CRISPR CCCCCAAAGTGAGACAGGCC GGG Exonic
901825217 1:11856944-11856966 CCCACAAAGTGAGAGGGGTCTGG - Intergenic
902663354 1:17920758-17920780 CCCCCAGAGTCAGACAGACTGGG - Intergenic
902781093 1:18705544-18705566 AGCCCACAGTGAGACAGGGCGGG - Intronic
902918941 1:19655283-19655305 CCCCAACAGTGACACAGGCATGG + Intronic
903627000 1:24738026-24738048 CCCCCAAAATTAGCCAGGCATGG - Intergenic
905891586 1:41521653-41521675 CCACCAAAGCCTGACAGGCCTGG + Intronic
906154583 1:43606543-43606565 CCCCCAAACTGATAAAGACCTGG - Intronic
906395490 1:45460056-45460078 CCCCAAATGGGAGACAGGCAGGG + Intronic
906728438 1:48060949-48060971 ACCCCAAGGTGAGACACTCCAGG + Intergenic
907280821 1:53346124-53346146 CTCCCAAAGTGGGAAAGTCCTGG - Intergenic
908847840 1:68342965-68342987 CACCCAAGATGCGACAGGCCGGG + Intergenic
915213949 1:154328165-154328187 CCCCCCAGGTAAGACAGGCAAGG + Exonic
917959196 1:180128933-180128955 CACCCAAAGGAAGACAGGCCTGG + Intergenic
917967665 1:180188587-180188609 CCCCCAGAGTGAGAAATGGCCGG - Intronic
918006393 1:180545564-180545586 CCCCCAAAGAGAGACTCACCAGG + Intergenic
920267022 1:204731614-204731636 CCGCCCAGGTGAGACAGGGCTGG - Intergenic
920933889 1:210412992-210413014 CCCACAATGTGAGGCAGGACTGG + Intronic
921412881 1:214854873-214854895 TCCCAAAGGTGAGATAGGCCGGG - Intergenic
921445209 1:215238547-215238569 CTCCCATAGTGAAACTGGCCAGG + Intergenic
921485841 1:215714594-215714616 TCCCCAAAGGGAGAAAGACCAGG - Intronic
922204336 1:223433427-223433449 TCCCAGAAATGAGACAGGCCAGG - Intergenic
922766648 1:228159538-228159560 GCCCCAAACTGAGACAGACTGGG + Exonic
1065076667 10:22086799-22086821 GCCTCATAGTGAGACAAGCCAGG - Intergenic
1066146974 10:32570370-32570392 CCACCAACATGAGACTGGCCTGG - Intronic
1066758023 10:38730164-38730186 CCCGCCAAGTCGGACAGGCCTGG + Intergenic
1068797344 10:61098131-61098153 CCCTCAAAGTGACACAGGAGAGG + Intergenic
1069578048 10:69544725-69544747 CCCAGAAAGTGTGAGAGGCCTGG + Intergenic
1070505798 10:77111612-77111634 CACCCAAAGGAAGACAGGCCTGG - Intronic
1070838105 10:79464098-79464120 CACCCAGAGTGTGCCAGGCCTGG + Intergenic
1071848549 10:89544799-89544821 ACCCCAGAGTTAGACAGACCTGG - Intronic
1074225093 10:111476997-111477019 CTCCCAAAGTGTGGCAGGCCAGG - Intergenic
1075468794 10:122672458-122672480 CCCCAGAGGTGAGGCAGGCCAGG - Intergenic
1076855557 10:133113993-133114015 CCGCCAAAGTGTGAGATGCCAGG - Intronic
1078779116 11:14420487-14420509 ACTCCAGAGTCAGACAGGCCGGG + Intergenic
1081493544 11:43584233-43584255 CCTCCAACCTGAGACAGGCAAGG - Intronic
1081733586 11:45388333-45388355 CCTCCAGAGTCAGACAGTCCTGG + Intergenic
1082835745 11:57649150-57649172 CCCCTGAAGTGAGACGGGGCTGG + Exonic
1083794159 11:65004957-65004979 CCCCCAAACTGAGGCAGACCCGG - Intergenic
1083899958 11:65638703-65638725 CACCCCTAGTGACACAGGCCCGG + Intronic
1084384897 11:68837427-68837449 CCCCCTGAGTGAGCCAGGGCTGG + Intronic
1084772065 11:71349736-71349758 CTCCCACAGTGAGTCAGGACTGG + Intergenic
1087751676 11:102013672-102013694 CCCCCAGAGTAAGAGAGACCAGG + Intergenic
1088781278 11:113136451-113136473 GCCCCCCAGTGAGACAGGGCTGG + Intronic
1091228869 11:133974898-133974920 CCCCCAATGTGGGACAAGTCTGG - Intergenic
1093298957 12:17429168-17429190 CCCCCAAAATTAGCCAGGCATGG - Intergenic
1096179579 12:49543256-49543278 CCCCCTGAGTGAGGCAGGGCAGG - Exonic
1097597859 12:61656098-61656120 GCCCCAAAGAAAGACTGGCCTGG - Intergenic
1098781354 12:74690926-74690948 GCACCAAAGTCAAACAGGCCAGG + Intergenic
1099058697 12:77878379-77878401 CCCCCAAAATTAGCCAGGCATGG - Intronic
1103555741 12:121765505-121765527 CCACCAAGGGGAGACAGGCCTGG - Intronic
1104045476 12:125159807-125159829 CCACCAATGAGAGTCAGGCCTGG - Intergenic
1104121290 12:125802632-125802654 CCCAAAAAGTTAAACAGGCCGGG - Intergenic
1104513557 12:129403310-129403332 TCTCCTAAGTGAGACATGCCTGG - Intronic
1105238926 13:18592499-18592521 ACCCCAAAGTTAGACAGCCTAGG - Intergenic
1105430459 13:20332733-20332755 GCTCCAAAGTGAGACAGACCTGG - Intergenic
1107455324 13:40549659-40549681 GACCCAAAGTCAGGCAGGCCTGG + Intergenic
1107649717 13:42532816-42532838 CCCCCAAAGTTAGACATGTGAGG + Intergenic
1110840568 13:80137385-80137407 CACCAGAATTGAGACAGGCCAGG - Intergenic
1112065963 13:95793394-95793416 ACCCTACAGTGAGACAGGCAGGG - Exonic
1113395988 13:109948355-109948377 CCTCCTAAATGAGAGAGGCCAGG + Intergenic
1113761827 13:112853516-112853538 GCCCCAAAGTGAGGCAGACATGG + Intronic
1117307994 14:54495230-54495252 CCCCAAAAGTAAAACAGGTCAGG + Intergenic
1119161081 14:72452998-72453020 CCCTCCAAGTGCAACAGGCCTGG - Intronic
1119435527 14:74595479-74595501 CCCCAGAGGTGAGACAGGCTGGG + Intronic
1121491304 14:94363366-94363388 CACCCAGAGAGAGCCAGGCCAGG - Intergenic
1122225337 14:100273442-100273464 CCCCCAAAATCAGCCAGGCATGG - Intronic
1122563670 14:102635794-102635816 CTCCCAAATTGAGCCAGGCGTGG + Intronic
1122917760 14:104866560-104866582 CCCCCAGAGTGAGAGGGTCCTGG + Intronic
1131110372 15:89761023-89761045 CCCCCAAATAGAGCCAAGCCTGG - Intronic
1131112015 15:89770477-89770499 GCTGCAGAGTGAGACAGGCCTGG - Intronic
1131336622 15:91555314-91555336 CCACCAAAGTGAGGGTGGCCAGG + Intergenic
1132600192 16:769692-769714 CCCCTAGAGCCAGACAGGCCTGG + Intronic
1132974739 16:2705663-2705685 CCCCCACAGGCAGGCAGGCCCGG - Intronic
1133069215 16:3234801-3234823 GCCCCAGAGTGAGCCTGGCCCGG - Exonic
1133116295 16:3579560-3579582 CACCAAAAGTGGGACAGGCCTGG + Intergenic
1134233751 16:12449701-12449723 GCTCTGAAGTGAGACAGGCCTGG - Intronic
1134315129 16:13111997-13112019 GCCCGAAAGTCAGACAGACCTGG - Intronic
1136325613 16:29521789-29521811 TCCCCAAAGGGAGGCAGGTCTGG - Intergenic
1136440302 16:30261771-30261793 TCCCCAAAGGGAGGCAGGTCTGG - Intergenic
1136569415 16:31087863-31087885 TCCCCAAAGCTAGGCAGGCCTGG - Intronic
1137569803 16:49557915-49557937 CCCCCAAAGCCAGAGAGGGCTGG + Intronic
1137768725 16:50997519-50997541 CCCTCAAACTGAAACATGCCTGG + Intergenic
1139437543 16:66944977-66944999 CCCTCAAAGTGGAAAAGGCCTGG - Exonic
1140254298 16:73321677-73321699 CCACCAGAGAGAGGCAGGCCTGG + Intergenic
1141226386 16:82120015-82120037 CCCCCCAAGTGTTATAGGCCTGG + Intergenic
1141980505 16:87547294-87547316 CCAGGAAAGTGAGAAAGGCCTGG - Intergenic
1146975030 17:37103884-37103906 CCCCCAAAATTAGCCAGGCATGG + Intronic
1149422132 17:56521340-56521362 CTCCCAAAGTGAGGCAGACCAGG - Intergenic
1151942038 17:77298740-77298762 CACCCAAAGTGAGAGAGGCCAGG - Intronic
1152002593 17:77655832-77655854 CCCCCAAAGGGAGTCAGCCTTGG - Intergenic
1152743943 17:82030794-82030816 CCCCCAAAGTGAGACAGGCCGGG + Exonic
1152772775 17:82180294-82180316 CCTCCAAGGAGAGGCAGGCCTGG + Intronic
1157568463 18:48696451-48696473 CACACAAAGTAACACAGGCCGGG - Intronic
1158085786 18:53650400-53650422 CTCCCAAAGTGCTGCAGGCCTGG + Intergenic
1158451947 18:57574609-57574631 AGCCCAAAGTGAGCCAGGCCAGG + Intronic
1160811328 19:1014177-1014199 CCATCAAGGTGAGCCAGGCCTGG - Exonic
1160914362 19:1489778-1489800 ACCCCAAGGTGAGCCTGGCCTGG - Exonic
1161274992 19:3410955-3410977 ACCCCAAAATCAGACAAGCCTGG + Intronic
1161695253 19:5763523-5763545 CCCACACAGTGAGAGAAGCCAGG + Intronic
1162141533 19:8588374-8588396 CATCAAAAGTGAGACAGGCACGG - Intronic
1163265503 19:16218293-16218315 CCCCAAAACTGAGACAGCCCGGG - Intronic
1163393337 19:17044014-17044036 CCCCACAAGTGAGACATCCCTGG - Intergenic
1163611602 19:18304645-18304667 CCGCCAGAGTGCGACAGGCCCGG - Intergenic
1163797964 19:19348069-19348091 CCTCCAAAGTGTATCAGGCCAGG + Intronic
1164479365 19:28599482-28599504 ACCCCAAGGTGAGCCAGGCCAGG - Intergenic
1166299694 19:41906733-41906755 CCCCCAAGCTGAGACAGGAGGGG - Exonic
1166504451 19:43362242-43362264 CCCCCCAAGTGAGAGACTCCAGG - Exonic
1166506110 19:43372798-43372820 CCCCCCAAGTGAGACACTCCAGG + Intergenic
1166689138 19:44812410-44812432 CCCCCGAAGGGAGGCAGGCAGGG + Intronic
1167296983 19:48656548-48656570 CCCCCAAAATTAGCCAGGCCCGG - Intergenic
926865540 2:17353540-17353562 CACCCAAAGGGAGACATGCTGGG + Intergenic
927088378 2:19691914-19691936 CTCCCAGAGGGAGACAGGGCAGG - Intergenic
928065691 2:28162341-28162363 ACTCCAAAGTCAGACAGACCTGG + Intronic
928140348 2:28723375-28723397 CCCCCAAAAAAAGAAAGGCCAGG + Intergenic
930866448 2:56126690-56126712 CCCCCAATGAGGGACAGGCAGGG + Intergenic
933816129 2:86070068-86070090 CCCCCAGAGTGAGCTGGGCCGGG - Exonic
934321338 2:91974605-91974627 CCCGCCAAGTCGGACAGGCCCGG + Intergenic
937367148 2:121271699-121271721 CCCACAAAGTGAAACTGTCCTGG + Intronic
937425310 2:121794095-121794117 ACCTCAAAGTGACCCAGGCCAGG - Intergenic
937656663 2:124384801-124384823 CCCGCAAAGTGAAAAGGGCCAGG + Intronic
939392298 2:141584087-141584109 CCCCCAACGTTAGCCAGGCATGG + Intronic
945373560 2:209051828-209051850 CCCCAATAGTGAGGCAGCCCTGG + Intergenic
946069797 2:217024318-217024340 TGCCCACAGTGAGACTGGCCTGG + Intergenic
946448816 2:219762580-219762602 ACCCCAAAATAAGACAAGCCTGG - Intergenic
946848157 2:223879501-223879523 CCCCCAAAATTAGCCAAGCCTGG + Intronic
948039237 2:234886318-234886340 CACCCAAAGTGAAACTGGCTTGG - Intergenic
948899273 2:240947928-240947950 CCCCCAAGGAGAGAGAGGCTGGG + Intronic
1169190343 20:3654973-3654995 CCCACTAAGCGAGTCAGGCCGGG - Intergenic
1169244875 20:4017254-4017276 CCCCCAAAGTGAGAGAAGGGTGG + Intergenic
1174359216 20:50017395-50017417 CAGCCAATGAGAGACAGGCCTGG + Intergenic
1174488136 20:50874029-50874051 CCCCAAAAGTGAGAGTGGCCAGG - Intronic
1174732888 20:52935501-52935523 CCCCCAAAGTGAGCCAGCTCTGG + Intergenic
1175285058 20:57832318-57832340 CTCCCACAGTGAGTGAGGCCAGG - Intergenic
1175490501 20:59377431-59377453 CCTTCAAAATCAGACAGGCCTGG - Intergenic
1176249290 20:64112594-64112616 GCCCCAAGAGGAGACAGGCCTGG - Intergenic
1176782922 21:13220758-13220780 ACCCCAAAGTTAGACAGCCTAGG - Intergenic
1178599538 21:33984041-33984063 TCCCCAAAGTGGTTCAGGCCAGG - Intergenic
1180000507 21:44993401-44993423 CCCCCGAACTGAGGCTGGCCTGG + Intergenic
1181123482 22:20688566-20688588 CTCCCAAAGTGCCACAGCCCCGG + Intergenic
1181189686 22:21129074-21129096 CTCCCAAAGTGCCACAGCCCAGG - Intergenic
1181209517 22:21281430-21281452 CTCCCAAAGTGCCACAGCCCAGG + Intergenic
1182146985 22:28002551-28002573 AACCCAAAGTGACACATGCCTGG + Intronic
1183529282 22:38344142-38344164 CCCACCAACTGAGTCAGGCCTGG + Intronic
1185284908 22:49995828-49995850 CCCCCCACCTGAGCCAGGCCCGG + Exonic
1203217427 22_KI270731v1_random:14005-14027 CTCCCAAAGTGCCACAGCCCAGG - Intergenic
949948324 3:9207936-9207958 ACTCCGCAGTGAGACAGGCCTGG - Intronic
950661925 3:14472041-14472063 ACCCAAAGGCGAGACAGGCCTGG + Intronic
951409462 3:22344543-22344565 ACCCCAAAATGAGGCAGGCATGG - Intronic
952502935 3:33980869-33980891 CCCCCAAATTTGGAAAGGCCTGG - Intergenic
953176637 3:40559446-40559468 CCCCAAAAGTCAAAAAGGCCAGG + Intronic
953325952 3:42013122-42013144 CCACCAAAGGGTGACAGGCAGGG - Intergenic
954425575 3:50441157-50441179 ACCACAAGGTGAGAAAGGCCTGG + Intronic
960997250 3:123348405-123348427 CACCAAGAGTGAGACAGGCAAGG + Intronic
964519213 3:157544770-157544792 CTGCCAAAGTGGGACAGGCATGG + Intronic
967500998 3:190197418-190197440 CCCCCAGAGTCTGAAAGGCCAGG + Intergenic
968915832 4:3496710-3496732 CCCCAAGAGTGACACAGGCTGGG - Intronic
968939123 4:3628907-3628929 GCCCCAGAGTCACACAGGCCCGG + Intergenic
969427597 4:7134788-7134810 GCCCCACAGGGAGAGAGGCCAGG - Intergenic
971292874 4:25360588-25360610 CCCCCAAACTGGGACAGTGCAGG + Intronic
972282430 4:37615621-37615643 CTCCCGAAGAGAGATAGGCCAGG - Intronic
975374973 4:73632608-73632630 CCCCAAAAGTCAGGCAGCCCTGG + Intergenic
975426844 4:74239323-74239345 CCCCCAAACTACGACAGGCCTGG - Intronic
976347058 4:84016185-84016207 CGCCAAAAGTGAGAAAGTCCTGG - Intergenic
986721308 5:10563464-10563486 CCCCGCACGTGACACAGGCCAGG + Intergenic
995381162 5:111534942-111534964 CACACAAAGTGAAACAGGCAAGG + Intergenic
997340794 5:133142917-133142939 TCACCAAAGGGAGCCAGGCCAGG - Intergenic
998151242 5:139758733-139758755 CACGCACAGGGAGACAGGCCAGG + Intergenic
1000094947 5:157963378-157963400 CACCAAAAGTAATACAGGCCAGG - Intergenic
1001274382 5:170339620-170339642 CACTCACAGTGACACAGGCCAGG - Intergenic
1004627985 6:17394110-17394132 CCCCCAAAGTTAGAGCGGCCGGG - Intronic
1005004481 6:21274083-21274105 CCCCCAAAATTAGACAGGCATGG - Intergenic
1007138030 6:39541851-39541873 TCCCTAAAGAGAAACAGGCCCGG + Intronic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1007476460 6:42122856-42122878 CCCTCTGAGTCAGACAGGCCTGG - Intronic
1008343593 6:50398234-50398256 GACCTAAAGTGTGACAGGCCAGG + Intergenic
1012235702 6:96812072-96812094 CACACAAAGTGAGACAGGGTAGG + Intronic
1013207134 6:107955418-107955440 CTCCCAAAGTGAGCCACGGCAGG + Intronic
1014803695 6:125806028-125806050 CCTTTAAAGTAAGACAGGCCTGG - Intronic
1015292468 6:131553247-131553269 CCCCCAACCTCTGACAGGCCCGG + Intergenic
1015848123 6:137543188-137543210 CCTCCAAAGAGAAACAGACCAGG + Intergenic
1017553591 6:155538928-155538950 TCCCCAAAGTGTTACTGGCCTGG + Intergenic
1019456619 7:1130890-1130912 CCCCAAAAGTAAAACAGTCCAGG + Intronic
1019964204 7:4485388-4485410 CCCCCAAATTGAGACTGGATTGG - Intergenic
1020268227 7:6576168-6576190 CCCTCAAAGGAGGACAGGCCTGG + Intergenic
1020268282 7:6576584-6576606 CCCCCTAAGTGTGACTGCCCTGG + Intergenic
1020692059 7:11368202-11368224 CCCACACAATGAGAGAGGCCAGG - Intergenic
1020987800 7:15157645-15157667 CCTCCAAAGGGGGACAAGCCTGG + Intergenic
1021454394 7:20813779-20813801 ATACCAAAGTGAGACATGCCAGG - Intergenic
1021575790 7:22104542-22104564 TCCACAAAGAGAGACACGCCTGG - Intergenic
1022165986 7:27762794-27762816 CCCCCAAAATTAGCCAGGCATGG + Intronic
1022527277 7:31046454-31046476 CAGTCAAAGTGAGCCAGGCCTGG - Intergenic
1023456145 7:40340656-40340678 ACCTCAAAGTGTGACAGGTCAGG + Intronic
1023660720 7:42468649-42468671 CCTCCAGAGAGACACAGGCCTGG - Intergenic
1029704669 7:102269986-102270008 CCCCCACAGGGGGCCAGGCCCGG + Intronic
1034103442 7:148470868-148470890 CCCCCACAGCAAGAGAGGCCAGG + Intergenic
1034547722 7:151800005-151800027 CCCCCTCAGTGAGGCAGGCCTGG + Intronic
1035158746 7:156935503-156935525 CCCTCAGAGTGGGCCAGGCCTGG + Intergenic
1042222035 8:66483586-66483608 CACCCAAAGTGAGAGAGGATGGG - Intronic
1042566281 8:70115441-70115463 CCCCTAAAGTGACACAGCCAGGG - Intronic
1046537906 8:115539700-115539722 CCCCCAAAATTAGCCAGGCATGG + Intronic
1048990530 8:139757704-139757726 CCTCAAGAATGAGACAGGCCTGG - Intronic
1052820991 9:33137829-33137851 CCCACAAGGTCAGCCAGGCCTGG + Intronic
1054451626 9:65406413-65406435 GCCCCAGAGTCACACAGGCCTGG - Intergenic
1054707109 9:68473886-68473908 CCCCCCATGTGAGCAAGGCCAGG + Intronic
1056126019 9:83537500-83537522 TCCCCAGAGTGAGAGAGGCCGGG - Intronic
1056633685 9:88314536-88314558 CCCCCAAAAAGACACAGGCTGGG + Intergenic
1057038847 9:91833068-91833090 CCCCCAAAGAGGGACAGGGAAGG + Intronic
1057467726 9:95330917-95330939 CCCCCAAAGCTAAAGAGGCCAGG + Intergenic
1057582478 9:96299721-96299743 GCCCCAAAGTCAGACAGCCTGGG - Intronic
1058959563 9:109979921-109979943 CCCCCAGACGCAGACAGGCCTGG + Intronic
1060217701 9:121748334-121748356 ACCTCACAGTGAGTCAGGCCTGG - Intronic
1061202114 9:129143861-129143883 CCCCCACTGTGGGACAGGCGGGG - Intronic
1061395370 9:130340928-130340950 CCCCCAAAGTGAGTGAGCTCCGG - Intronic
1062187984 9:135228791-135228813 CCCCCACAGTGTGCCAGGGCAGG - Intergenic
1062376681 9:136264959-136264981 CCAGGAATGTGAGACAGGCCTGG - Intergenic
1062483966 9:136765029-136765051 CCCACACTGTGAGAGAGGCCTGG + Intronic
1185506701 X:637083-637105 TCCCCAAAGCGATACAGCCCAGG + Intronic
1185799286 X:2995225-2995247 CTCTCAAAGTGTGGCAGGCCAGG - Intergenic
1186570531 X:10710599-10710621 CCTCCAAAGTAAGAGTGGCCTGG - Intronic
1186575940 X:10766087-10766109 CACCCAAGGGGAGACAGGCAGGG + Intronic
1186631243 X:11351410-11351432 CGACCCAAGTGAGCCAGGCCAGG + Intronic
1189308445 X:40004649-40004671 CCCCCAGATACAGACAGGCCAGG - Intergenic
1194412258 X:93571655-93571677 CCCCCAAAGTCAAAGAGGTCAGG + Intergenic
1197769676 X:130082172-130082194 CCCCCACAGCGAGGCAGGCATGG - Intronic
1197986502 X:132271459-132271481 CACCCAGAGTGAGACAGGAGTGG + Intergenic
1200955645 Y:8942253-8942275 ACTCCAAAGGGAGACAGGCAGGG - Intergenic