ID: 1152744132

View in Genome Browser
Species Human (GRCh38)
Location 17:82031462-82031484
Sequence CCGGCCCGGGGGTCTCCTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 78}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152744132_1152744150 25 Left 1152744132 17:82031462-82031484 CCCGTAGGAGACCCCCGGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1152744150 17:82031510-82031532 CAGCTCGCGCAGCTCTGCCCGGG 0: 1
1: 0
2: 0
3: 18
4: 200
1152744132_1152744143 -6 Left 1152744132 17:82031462-82031484 CCCGTAGGAGACCCCCGGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1152744143 17:82031479-82031501 GGCCGGGGTCGCGCTGGAGGCGG 0: 1
1: 0
2: 2
3: 52
4: 381
1152744132_1152744142 -9 Left 1152744132 17:82031462-82031484 CCCGTAGGAGACCCCCGGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1152744142 17:82031476-82031498 CCGGGCCGGGGTCGCGCTGGAGG 0: 1
1: 0
2: 4
3: 40
4: 341
1152744132_1152744151 30 Left 1152744132 17:82031462-82031484 CCCGTAGGAGACCCCCGGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1152744151 17:82031515-82031537 CGCGCAGCTCTGCCCGGGTTCGG 0: 1
1: 0
2: 0
3: 1
4: 74
1152744132_1152744149 24 Left 1152744132 17:82031462-82031484 CCCGTAGGAGACCCCCGGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1152744149 17:82031509-82031531 GCAGCTCGCGCAGCTCTGCCCGG 0: 1
1: 0
2: 2
3: 24
4: 192
1152744132_1152744144 -5 Left 1152744132 17:82031462-82031484 CCCGTAGGAGACCCCCGGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1152744144 17:82031480-82031502 GCCGGGGTCGCGCTGGAGGCGGG 0: 1
1: 0
2: 3
3: 31
4: 295
1152744132_1152744146 -4 Left 1152744132 17:82031462-82031484 CCCGTAGGAGACCCCCGGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1152744146 17:82031481-82031503 CCGGGGTCGCGCTGGAGGCGGGG 0: 1
1: 0
2: 3
3: 23
4: 219
1152744132_1152744147 -3 Left 1152744132 17:82031462-82031484 CCCGTAGGAGACCCCCGGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 78
Right 1152744147 17:82031482-82031504 CGGGGTCGCGCTGGAGGCGGGGG 0: 1
1: 0
2: 5
3: 42
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152744132 Original CRISPR CCGGCCCGGGGGTCTCCTAC GGG (reversed) Intergenic