ID: 1152745615

View in Genome Browser
Species Human (GRCh38)
Location 17:82037335-82037357
Sequence GAGAAGCGCAGCGCCCGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 57}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152745599_1152745615 29 Left 1152745599 17:82037283-82037305 CCACGCAGGCCACCAGCCCCGAG 0: 1
1: 0
2: 4
3: 18
4: 223
Right 1152745615 17:82037335-82037357 GAGAAGCGCAGCGCCCGCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1152745598_1152745615 30 Left 1152745598 17:82037282-82037304 CCCACGCAGGCCACCAGCCCCGA 0: 1
1: 0
2: 1
3: 5
4: 126
Right 1152745615 17:82037335-82037357 GAGAAGCGCAGCGCCCGCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1152745608_1152745615 11 Left 1152745608 17:82037301-82037323 CCGAGAGAGGGTGCGCGGGCGCC 0: 1
1: 1
2: 3
3: 13
4: 100
Right 1152745615 17:82037335-82037357 GAGAAGCGCAGCGCCCGCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1152745606_1152745615 13 Left 1152745606 17:82037299-82037321 CCCCGAGAGAGGGTGCGCGGGCG 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1152745615 17:82037335-82037357 GAGAAGCGCAGCGCCCGCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1152745602_1152745615 20 Left 1152745602 17:82037292-82037314 CCACCAGCCCCGAGAGAGGGTGC 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1152745615 17:82037335-82037357 GAGAAGCGCAGCGCCCGCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1152745607_1152745615 12 Left 1152745607 17:82037300-82037322 CCCGAGAGAGGGTGCGCGGGCGC 0: 1
1: 0
2: 0
3: 16
4: 85
Right 1152745615 17:82037335-82037357 GAGAAGCGCAGCGCCCGCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1152745603_1152745615 17 Left 1152745603 17:82037295-82037317 CCAGCCCCGAGAGAGGGTGCGCG 0: 1
1: 0
2: 2
3: 5
4: 98
Right 1152745615 17:82037335-82037357 GAGAAGCGCAGCGCCCGCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1152745611_1152745615 -10 Left 1152745611 17:82037322-82037344 CCCAGGCCGCGGTGAGAAGCGCA 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1152745615 17:82037335-82037357 GAGAAGCGCAGCGCCCGCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152745615 Original CRISPR GAGAAGCGCAGCGCCCGCGA GGG Intronic
900800585 1:4734743-4734765 GAGAAGGGCAGCACCCAAGAGGG + Intronic
903700892 1:25247523-25247545 GAGAAGAGCCGCGCCCACCACGG - Intronic
906240181 1:44238033-44238055 GAGAAGAGCAGAGGCCGCGTAGG - Intronic
906532866 1:46533427-46533449 GCGCAGCACAGCGCCGGCGACGG + Intergenic
920655647 1:207872628-207872650 GAGAAGCTCAGAGCCTGCGGGGG - Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922116274 1:222617824-222617846 CAGAGGGGCGGCGCCCGCGAAGG - Intergenic
1065590677 10:27258787-27258809 GAGACGCTCTGCGCCCGCGCTGG - Intergenic
1065660318 10:27999059-27999081 GAGACGCTCTGCGCCCGCGCTGG + Intergenic
1071997524 10:91162891-91162913 GAGGAGAGCAGAGCCCGCGGCGG - Intergenic
1072241150 10:93496654-93496676 GCGAAGCGCGGCGCTCGCGTCGG - Exonic
1075398704 10:122146085-122146107 GAGAAGTGCAGCACCCTGGATGG + Intronic
1078659861 11:13277988-13278010 CAGGGGCGCAGCGCCCGCGAGGG - Intronic
1088604282 11:111513093-111513115 GAGAAGCGCGGCGTCGGCGTGGG + Intergenic
1100985637 12:100199767-100199789 GAGGAGGGCAGCGACGGCGATGG - Intronic
1103722040 12:122980412-122980434 GAGGAGGGCGGCGCGCGCGAGGG + Exonic
1110765537 13:79276638-79276660 GCGAAGCTCAGCGTCCGTGATGG - Intergenic
1117546020 14:56795233-56795255 GAGGAGCGCTGGCCCCGCGAAGG + Intergenic
1125202225 15:37110374-37110396 GCGAAGCGCAGGGCCCCAGAGGG + Intergenic
1125485742 15:40109481-40109503 GAGAAGCGGAGCGCTCAAGAAGG + Intergenic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1131657725 15:94479014-94479036 AAGAAGCGCAGCGCTCTCTAGGG + Exonic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1135003854 16:18801322-18801344 GAGAAGGGCCGGGCCCGCGGCGG + Intronic
1143153800 17:4823130-4823152 GAGAAGCACAGCTCCTGCCAGGG + Exonic
1146062506 17:29614544-29614566 GAGAAGCACAGACCCCGCCAGGG + Exonic
1148559626 17:48598364-48598386 GAGGAGCGCAGCCCGCACGAGGG + Intronic
1150300044 17:64040231-64040253 GAGAAGCCCAGCGCCCTGGAAGG - Exonic
1150704888 17:67477757-67477779 GGGAAGCCCAGGGCCCTCGATGG - Intronic
1152745615 17:82037335-82037357 GAGAAGCGCAGCGCCCGCGAGGG + Intronic
1158137717 18:54224570-54224592 AAGAAGCGCAGCGCCGGCTGGGG - Exonic
1160047538 18:75400736-75400758 GAGAAGAGCAGCCCCCGATAGGG - Intergenic
1160541799 18:79628002-79628024 GAGCTGCCCAGCGCCCGCCAGGG + Intergenic
925146090 2:1584392-1584414 CAGCAGGGCAGCGCCCGCGGTGG - Intergenic
931057971 2:58494115-58494137 GAGCAGCGCAGCCTCAGCGAAGG + Intergenic
934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG + Intronic
946416627 2:219543303-219543325 GAGAAGCCCGGGGCCGGCGAAGG - Exonic
948304261 2:236935097-236935119 GAGAATCCCAGAGCCCGAGAGGG + Intergenic
1175448540 20:59043001-59043023 GCGCAGCACAGCGCCCGCGCCGG - Intergenic
1177669729 21:24209177-24209199 GAGACGCGGAGAGCCAGCGAGGG + Intergenic
1180729307 22:17969761-17969783 GAGAAGCGCAGCGTCTAGGATGG + Intronic
1180875210 22:19171919-19171941 GAGAGGCGCTGTGCCCGCCAGGG - Intergenic
1183546184 22:38455741-38455763 GAGAAGGACAGGGGCCGCGAGGG - Intergenic
1184035312 22:41915175-41915197 GAGGAGCGCGGCTGCCGCGAGGG + Intergenic
1184241529 22:43213419-43213441 GAGAAGCACAGTGCCTGTGAGGG - Intronic
1185082579 22:48718106-48718128 CAGAAGCGGAGGGCCCGGGAGGG + Intronic
969195620 4:5561529-5561551 GAGAAGTGCAACCCCAGCGAAGG + Intronic
977908260 4:102501567-102501589 GGGAAGCGCAGGGCGCGCGGTGG - Exonic
979755792 4:124338904-124338926 GAGACGCCCAGAGCCAGCGAGGG - Intergenic
992089358 5:73303649-73303671 GAGATGCGCGGCGTCCGCGCGGG + Intergenic
997727355 5:136132915-136132937 GAGAAGCGCAGCGACGGCGTCGG + Exonic
998292222 5:140926613-140926635 GAGGAGCGCAGCGCCGCCTAGGG - Intronic
1008597975 6:53061892-53061914 GGGACGCGCAGGGCCAGCGAGGG - Intronic
1017175013 6:151494301-151494323 GAGCAGCTCTGTGCCCGCGAGGG + Intronic
1017810625 6:157981486-157981508 GGGAGGCGCAGCGCCCCCGGCGG + Intergenic
1034306623 7:150048921-150048943 GCGGGGCGCAGCGCCCGCGAGGG - Intergenic
1034800222 7:154051722-154051744 GCGGGGCGCATCGCCCGCGAGGG + Intronic
1034976806 7:155453845-155453867 GCGAAGCGCTGGGCACGCGAGGG + Intergenic
1042216474 8:66433295-66433317 GAGAAGAGCAACACCAGCGATGG + Intronic
1054608773 9:67212318-67212340 CAGAAGCGCAGCTTCCGGGAAGG - Intergenic
1061501973 9:131009213-131009235 CAGAAGCGCAGCCGCCGCCATGG - Exonic
1061594285 9:131618940-131618962 CAGAAGGGCAGGGGCCGCGACGG + Intronic
1061930347 9:133829132-133829154 GGGAAGCGCAGTGCCTGCCAAGG + Intronic
1062499438 9:136845957-136845979 GAGAAGGGCCGCGCGGGCGAGGG + Exonic