ID: 1152747363

View in Genome Browser
Species Human (GRCh38)
Location 17:82047603-82047625
Sequence GGTGCACGTGGGTGTGTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152747363_1152747373 21 Left 1152747363 17:82047603-82047625 CCTCATACACACCCACGTGCACC No data
Right 1152747373 17:82047647-82047669 AGGAGGCAAGCACGATGCTCAGG No data
1152747363_1152747370 1 Left 1152747363 17:82047603-82047625 CCTCATACACACCCACGTGCACC No data
Right 1152747370 17:82047627-82047649 GGCTCCACACAACACACGGGAGG No data
1152747363_1152747367 -3 Left 1152747363 17:82047603-82047625 CCTCATACACACCCACGTGCACC No data
Right 1152747367 17:82047623-82047645 ACCTGGCTCCACACAACACACGG No data
1152747363_1152747374 25 Left 1152747363 17:82047603-82047625 CCTCATACACACCCACGTGCACC No data
Right 1152747374 17:82047651-82047673 GGCAAGCACGATGCTCAGGAAGG No data
1152747363_1152747371 4 Left 1152747363 17:82047603-82047625 CCTCATACACACCCACGTGCACC No data
Right 1152747371 17:82047630-82047652 TCCACACAACACACGGGAGGAGG No data
1152747363_1152747369 -2 Left 1152747363 17:82047603-82047625 CCTCATACACACCCACGTGCACC No data
Right 1152747369 17:82047624-82047646 CCTGGCTCCACACAACACACGGG No data
1152747363_1152747375 28 Left 1152747363 17:82047603-82047625 CCTCATACACACCCACGTGCACC No data
Right 1152747375 17:82047654-82047676 AAGCACGATGCTCAGGAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152747363 Original CRISPR GGTGCACGTGGGTGTGTATG AGG (reversed) Intergenic