ID: 1152747695

View in Genome Browser
Species Human (GRCh38)
Location 17:82048898-82048920
Sequence CCGTGGGTACAGGGAGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 388}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152747682_1152747695 14 Left 1152747682 17:82048861-82048883 CCAGGGCCGTGGGCGGCGGGAGA 0: 1
1: 0
2: 3
3: 16
4: 293
Right 1152747695 17:82048898-82048920 CCGTGGGTACAGGGAGAAGCCGG 0: 1
1: 0
2: 4
3: 24
4: 388
1152747691_1152747695 -10 Left 1152747691 17:82048885-82048907 CCTGGGGTCAGGGCCGTGGGTAC 0: 1
1: 0
2: 1
3: 14
4: 165
Right 1152747695 17:82048898-82048920 CCGTGGGTACAGGGAGAAGCCGG 0: 1
1: 0
2: 4
3: 24
4: 388
1152747683_1152747695 8 Left 1152747683 17:82048867-82048889 CCGTGGGCGGCGGGAGAACCTGG 0: 1
1: 0
2: 1
3: 14
4: 126
Right 1152747695 17:82048898-82048920 CCGTGGGTACAGGGAGAAGCCGG 0: 1
1: 0
2: 4
3: 24
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152747695 Original CRISPR CCGTGGGTACAGGGAGAAGC CGG Intronic
900484699 1:2916734-2916756 CCATGTGTACATGCAGAAGCAGG - Intergenic
900691442 1:3982921-3982943 CTGTGGGTACAGGGAGAAGATGG + Intergenic
901757895 1:11452351-11452373 CCATGGGCTCAGGGAGGAGCTGG + Intergenic
902435807 1:16397588-16397610 CCATGGGGTCAGGGAGGAGCTGG - Exonic
902897987 1:19492614-19492636 AAGTGGCTACAGGGAGACGCAGG - Intergenic
903100183 1:21023261-21023283 CCGTGGGGAGAGGGAGAGGGAGG - Intronic
903507980 1:23852461-23852483 CCGTGGGGAGAGGGAGAGGGGGG - Intronic
903931191 1:26863455-26863477 GCGTGAGTACCGGGAGAAGGTGG + Exonic
903968412 1:27103497-27103519 CCGTGTCTCCAGGAAGAAGCAGG - Intronic
904878497 1:33675521-33675543 CCAGAGGTACAAGGAGAAGCTGG + Intronic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
907807745 1:57838164-57838186 CCATGGGCACAGGGATAAGGCGG - Intronic
908467681 1:64414234-64414256 CCGTGGGGAGAGGGAGAGGGAGG - Intergenic
911326031 1:96470603-96470625 CCGTGGGGAGAGGGAGAGGGGGG + Intergenic
911432482 1:97809638-97809660 CAGTGGTCACAGGGAGATGCAGG + Intronic
911823181 1:102445627-102445649 CCAGAGGTACAGGGAGGAGCTGG + Intergenic
912806178 1:112758758-112758780 CCATGGGGAGAGGGAGAAGGTGG - Intergenic
913022974 1:114805341-114805363 CCGTGGGGAGAGGGAGAGGGAGG + Intergenic
914001949 1:143702049-143702071 CCGTGGGGAGAGGGAGAGGAGGG - Intergenic
914468500 1:147950943-147950965 CCGTGGGGAGAGGGAGATGGGGG + Intronic
914949209 1:152097220-152097242 GTGAGGGTACAGGGAGAAGATGG - Intergenic
916087659 1:161282397-161282419 CCGTGGGGAGAGGGAGAGGGAGG + Intronic
917506516 1:175632280-175632302 CCTTGGGAACAGAGAGAAACTGG - Intronic
917514628 1:175697493-175697515 CTGTGGCTACAGGCAGAGGCTGG + Intronic
918817731 1:189210945-189210967 CCAGAGGTACAGGGAGGAGCTGG + Intergenic
920116600 1:203626210-203626232 TGGTGGGTACAGGGACAAGAGGG + Intergenic
920191602 1:204197334-204197356 CCAAGGGTACAGGGGGAAGGGGG - Intergenic
920263090 1:204703004-204703026 CCTTGGCACCAGGGAGAAGCTGG + Intergenic
920799267 1:209172562-209172584 CTGTGGGGACTGGGAGGAGCGGG + Intergenic
921068833 1:211642482-211642504 CCTTGGGAACAGGGGGAGGCTGG + Intergenic
923540751 1:234886389-234886411 CCGTGGGGCCAGGGACACGCAGG - Intergenic
1062773204 10:121487-121509 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
1064108833 10:12520927-12520949 CCGTGGGGAGAGGGAGAGGGAGG + Intronic
1065230380 10:23592362-23592384 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
1066152504 10:32638808-32638830 CCAGAGGTACAAGGAGAAGCTGG - Intronic
1067077841 10:43198196-43198218 CTGTGGGCACAGGGAGGACCTGG + Intronic
1067172253 10:43917343-43917365 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
1067510364 10:46889939-46889961 CCCTGGGTATAGGTACAAGCTGG + Intergenic
1067651889 10:48161918-48161940 CCCTGGGTATAGGTACAAGCTGG - Intronic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1070734897 10:78856675-78856697 CCCTGGCTACAGGGCCAAGCTGG - Intergenic
1071599988 10:86954361-86954383 CTGTGGGTTCAGGGAGGAGGAGG - Intronic
1071763081 10:88631164-88631186 CCAGGGGTACAAGGAGGAGCTGG - Intergenic
1072018155 10:91370610-91370632 CCGGAGGTACAAGGAGGAGCTGG - Intergenic
1074465156 10:113674966-113674988 CCGGAGGTACAAGGAGGAGCTGG + Intergenic
1075106527 10:119543106-119543128 CCGGGGCTACAGGGAGAAGGCGG - Intergenic
1076364791 10:129914803-129914825 CGTTGGGTGCAGGGAGAAGGTGG - Intronic
1077022226 11:422480-422502 CTGTGGGGACAGGGAGCAGCTGG + Intronic
1077113640 11:873068-873090 CCCTGGGGACGAGGAGAAGCTGG + Intronic
1079173751 11:18120468-18120490 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
1080482296 11:32664258-32664280 CCGGAGGTACAAGGAGGAGCTGG - Intronic
1081615339 11:44587502-44587524 ACGTGGGCACAGGCAGAAGTGGG + Exonic
1082914183 11:58413706-58413728 CCAGAGGTACAAGGAGAAGCTGG + Intergenic
1082951364 11:58819509-58819531 CCAGGGGTACAAGGAGGAGCTGG + Intergenic
1083542693 11:63524713-63524735 ACATGGGTACAAGGAGGAGCTGG + Intergenic
1083855248 11:65390027-65390049 CCTTGGGGACAGGGAGGAGAAGG + Intronic
1085046324 11:73355869-73355891 GCGTGAGAACAAGGAGAAGCAGG + Exonic
1085297457 11:75439122-75439144 CCGTGGGAACAGGGAGCAGAGGG + Intronic
1085378883 11:76094436-76094458 CCGGAGGTACAAGGAGGAGCTGG - Intronic
1085495722 11:76967371-76967393 CCAGAGGTACAAGGAGAAGCTGG + Intronic
1085712391 11:78841834-78841856 CCATTGGTGCAGGCAGAAGCAGG - Intronic
1086430346 11:86731551-86731573 CCGTGGGGAGAGGGAGAGGAGGG - Intergenic
1086874258 11:92076081-92076103 CCAGAGGTACAAGGAGAAGCTGG + Intergenic
1086881300 11:92156840-92156862 CCGTGGGGAGAGGGAGAGGGAGG - Intergenic
1086967647 11:93046450-93046472 CCAGAGGTACAAGGAGAAGCTGG + Intergenic
1088256943 11:107911790-107911812 CCGTGGGGAGAGGGAGAGGGAGG - Intronic
1089772856 11:120815755-120815777 TGGTGGGTAGAGGGAGAGGCTGG + Intronic
1090237261 11:125158521-125158543 CCCTGGGTACAGGGAGAAGAGGG + Intergenic
1090272046 11:125393641-125393663 CCGTGTGCACATGGAGAAGCAGG + Intronic
1091637097 12:2205337-2205359 GCCTGGGTACAGGGAGGAGGGGG + Intronic
1093326536 12:17782092-17782114 CCGTAGGTACAAAGAGGAGCTGG - Intergenic
1093329965 12:17824182-17824204 CCAGAGGTACAAGGAGAAGCTGG + Intergenic
1093997986 12:25663021-25663043 CCAGAGGTACAGAGAGAAGCTGG - Intergenic
1094422978 12:30291704-30291726 CCAGAGGTACAGGGAGGAGCTGG + Intergenic
1095801317 12:46272011-46272033 GGGTGAGTACAGGGTGAAGCTGG - Intergenic
1097127290 12:56784687-56784709 CCGTGGGGAGAGGGAGACGAGGG + Intronic
1097170766 12:57111375-57111397 ACCTGGGTAGAAGGAGAAGCCGG - Exonic
1097551521 12:61077559-61077581 CCGCAGGTACAAGGAGGAGCTGG + Intergenic
1098883561 12:75941028-75941050 CCGTGGGGAGAGGGAGAGGGGGG - Intergenic
1100581840 12:95946636-95946658 CCGTGGGGAGAGGGAGAGGGAGG - Intronic
1100892575 12:99142117-99142139 CTGAGGGTACAGGCGGAAGCAGG + Intronic
1102268122 12:111506649-111506671 CCGTGGGGAGAAGGAGAAGGAGG - Intronic
1105367519 13:19778392-19778414 CCGTGGGGAGAGGGAGAGGGAGG - Intronic
1105659328 13:22476213-22476235 CCATAGGTACAAGGAGGAGCTGG - Intergenic
1105707588 13:22977608-22977630 CAGTGGGCACAGTGAAAAGCTGG + Intergenic
1106795806 13:33204119-33204141 ACGTGGGTACTGTCAGAAGCTGG + Intronic
1106967184 13:35085146-35085168 CCGGAGGTACAAGGAGGAGCTGG + Intronic
1107649911 13:42534812-42534834 CCTAGGGTCCAGGGTGAAGCTGG + Intergenic
1107692298 13:42965804-42965826 CCGTGGGGAGAGGGAGACGAGGG - Intronic
1109561247 13:64052900-64052922 CAGTTTGTACAGGGAGAAGGAGG + Intergenic
1110287632 13:73768119-73768141 CCGTTGGTAAACGGTGAAGCTGG - Intronic
1113193818 13:107782039-107782061 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
1113367705 13:109691995-109692017 CCTTGAGCACAGGGAGGAGCAGG - Intergenic
1114141249 14:19913556-19913578 CCAGAGGTACAAGGAGAAGCTGG + Intergenic
1114437981 14:22723880-22723902 AAGTGGATAGAGGGAGAAGCTGG - Intergenic
1114684966 14:24520068-24520090 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
1118302190 14:64625837-64625859 CAGGGGGTGCGGGGAGAAGCTGG - Intergenic
1118550022 14:66939997-66940019 CAGTCTGTACAGGGAGAAGGGGG + Intronic
1119086056 14:71739847-71739869 TCCTGGGGAAAGGGAGAAGCAGG - Exonic
1119699951 14:76747837-76747859 CCAGAGGTACAGGGAGGAGCTGG + Intergenic
1121306975 14:92912665-92912687 CCGTGGGGAGAGGGAGAGGAGGG + Intergenic
1121800007 14:96767216-96767238 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
1122982779 14:105199102-105199124 CAGTGGGTGCAGGGAGACCCAGG - Intergenic
1123104314 14:105831010-105831032 ACAGGGGTACAGGGAGCAGCGGG - Intergenic
1124035291 15:26048851-26048873 CCTGGGGCCCAGGGAGAAGCGGG - Intergenic
1124561566 15:30778807-30778829 CCAGAGGTACAAGGAGAAGCTGG + Intergenic
1125674427 15:41494675-41494697 CCGCGGGGACTGGGCGAAGCGGG + Intronic
1125758480 15:42081757-42081779 CTGTGGGGACAGTGAGAGGCGGG - Intronic
1126907900 15:53387079-53387101 CAGTGTGTTAAGGGAGAAGCAGG + Intergenic
1127365340 15:58284279-58284301 CCTTGGGCACAGGGAGAAGGAGG + Intronic
1129534358 15:76299869-76299891 ACCAGGGTAAAGGGAGAAGCTGG - Intronic
1129747023 15:78029585-78029607 CAGTGGGTGCAGGGAGGTGCAGG + Intronic
1129787742 15:78320652-78320674 CCCTGGGCACAGAGAGGAGCAGG + Intergenic
1129963560 15:79712507-79712529 CTGGAGGTACAAGGAGAAGCTGG + Intergenic
1129978999 15:79849182-79849204 CCGTGGTTGAAGGGAGCAGCAGG - Intronic
1130220826 15:82018141-82018163 CTGTGTGTCCAGGGAGAAGTGGG + Intergenic
1130522247 15:84672252-84672274 CCGTGGGGAGAGGCAGAGGCAGG - Intronic
1130984982 15:88838820-88838842 CCGTGTGTCCAAGGAGAAGGAGG + Exonic
1131156676 15:90080099-90080121 CCGTGGGGAGTGGGAGAAGTGGG + Exonic
1131384353 15:91990923-91990945 CCGTGGGGACAGTGAAGAGCTGG + Intronic
1131983350 15:98017247-98017269 CCGTGGGGAAGGGCAGAAGCAGG - Intergenic
1132112131 15:99109357-99109379 CCGTGTTTGCAGGGTGAAGCTGG - Intronic
1132294136 15:100722973-100722995 CCCTGGGTAGAGGGAGAAGAGGG - Intergenic
1132498080 16:273244-273266 CCTTGGGCCCAGAGAGAAGCTGG + Intronic
1132645444 16:997357-997379 TCGGGGGCCCAGGGAGAAGCAGG - Intergenic
1133288048 16:4700041-4700063 CAGGGGCTGCAGGGAGAAGCCGG + Intronic
1134854473 16:17506820-17506842 CCGTGGGGAGAGGGAGAGGAGGG + Intergenic
1136413753 16:30091525-30091547 CCGTGGGAACGGGGACCAGCTGG - Intronic
1141030234 16:80581299-80581321 CATTGAGTACAGGGAGAAGAAGG + Intergenic
1141132595 16:81445658-81445680 CCGGGGGAACGGGGAGAACCAGG + Intronic
1142640248 17:1281265-1281287 GGGTGGGGAGAGGGAGAAGCAGG + Intronic
1142825155 17:2506259-2506281 CCGTGGGGAGAGGGAGAGGGAGG - Intronic
1142869078 17:2808973-2808995 GCGTGGCTGCAGGGAGAAGCAGG + Intronic
1143102582 17:4512553-4512575 CCCAGGGTACAGAGGGAAGCAGG - Intronic
1145026906 17:19475326-19475348 CCGTGGGGAGAGGGAGAGGGAGG - Intergenic
1145396462 17:22499531-22499553 CCATAGGTACAAGGAGGAGCTGG - Intergenic
1145760028 17:27420610-27420632 GCTTGGGTGCAGGGAGAGGCAGG + Intergenic
1145799027 17:27671744-27671766 GCTTGGGTGCAGGGAGAGGCAGG - Intergenic
1146911767 17:36652972-36652994 CTGTGGGTACAGGGTGTGGCTGG + Intergenic
1147446848 17:40479885-40479907 CCCTGGGCAGAGGGAGAACCTGG - Intronic
1147622158 17:41875406-41875428 CCGTGGGGAGAGGGAGAGGGAGG - Intronic
1147760094 17:42792320-42792342 CCCTGGGGATAGGGGGAAGCTGG - Intronic
1148269760 17:46253748-46253770 CCGTGGGGAGAGGGAGAGGGAGG + Intergenic
1151365105 17:73611921-73611943 GCGTGGGGAAGGGGAGAAGCAGG + Intronic
1151507851 17:74541248-74541270 CCGTTTTCACAGGGAGAAGCAGG - Exonic
1152747672 17:82048836-82048858 CCGTGGGCGGAGAGAGAAGCGGG + Intronic
1152747695 17:82048898-82048920 CCGTGGGTACAGGGAGAAGCCGG + Intronic
1152747708 17:82048929-82048951 CCGTGGGCGGAGGGAGCAGCGGG + Intronic
1153523731 18:5976452-5976474 CCCTGGGTGCAGGAAGAGGCTGG + Intronic
1154411359 18:14143788-14143810 ACGGAGGTACATGGAGAAGCTGG + Intergenic
1155664894 18:28296656-28296678 CCGGAGGTACAAGGAGGAGCTGG + Intergenic
1155956280 18:31959515-31959537 CCGTGGGGAGAGGGAGAGGAGGG - Intergenic
1157074049 18:44445565-44445587 CCAGAGGTACAGGGAGGAGCTGG + Intergenic
1159592008 18:70345519-70345541 CCAGAGGTACAGGGAGGAGCTGG - Intronic
1160228575 18:77029421-77029443 CCGTGGGGAGAGGGAGAGGGAGG + Intronic
1161467988 19:4442782-4442804 CAGTGGGGACAGGCAGAGGCTGG - Intronic
1161509043 19:4660563-4660585 CCATGGGGACAGGGAGGAGAGGG - Intronic
1161707463 19:5828930-5828952 CAGTGCGGACAGGGAGACGCTGG - Intergenic
1161734888 19:5985750-5985772 CCGTGGGTTGAGGGAGAACGGGG - Intergenic
1161770550 19:6228641-6228663 CCGTGGGTGCTGGGAGACCCGGG - Intronic
1161790042 19:6354808-6354830 CCGTGGGGAAAGGGAGAGGGGGG - Intergenic
1161993571 19:7698877-7698899 CTATGGGTGCAGGGTGAAGCTGG + Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162712882 19:12609290-12609312 CTGTGTGTACAGGTAGATGCAGG - Intronic
1163574207 19:18101016-18101038 CCCTGGGTCCAGGGAGGAGGTGG + Intronic
1164420859 19:28091187-28091209 CCAGGGGTACAAGGAGGAGCTGG + Intergenic
1166733304 19:45070638-45070660 AGGTGGGTACAGGGTGAGGCTGG - Intronic
1167158981 19:47755536-47755558 CCGGGGGTTCTGGGAGAGGCTGG + Intronic
1167626381 19:50592476-50592498 CTGTAGGCACAGGGAGGAGCAGG - Intergenic
1168288762 19:55347115-55347137 CCATCGGTGCAGGGAGACGCGGG - Exonic
925342876 2:3148993-3149015 GCGTGGGCTCAGGGAGCAGCCGG + Intergenic
926124940 2:10266143-10266165 CCGTGTGTCCAGTGAAAAGCAGG - Intergenic
926335510 2:11859648-11859670 ACGTGGGGACATGGAGAAGGTGG + Intergenic
927480665 2:23451528-23451550 CCTTGGGAAGAGGGAGATGCAGG - Intronic
927640208 2:24841188-24841210 CCCTGGACCCAGGGAGAAGCAGG - Intronic
927713838 2:25340951-25340973 CGGTGGGGACAGGGAGGAGCCGG + Intronic
928728848 2:34207017-34207039 CCGTGGGCACTGGCAGGAGCAGG - Intergenic
929966516 2:46541511-46541533 CCTTGAGTACTGGGAGCAGCTGG + Intronic
930066629 2:47332663-47332685 CTGTGGGCACAGGGAGAATTGGG - Intergenic
930079557 2:47434536-47434558 CCGTGGGGAGAGGGAGAGGAGGG + Intronic
930945342 2:57067305-57067327 CCAGAGGTACAGGGAGGAGCTGG - Intergenic
931491372 2:62751562-62751584 CCGGAGGTACAAGGAGGAGCTGG - Intronic
932336236 2:70932898-70932920 CCCTGGGCACAGAGAGCAGCCGG - Exonic
932805467 2:74779066-74779088 CTGTGGGTGCAGGGAGGAGAGGG - Intergenic
933568529 2:83979945-83979967 CCATAGGTACAAGGAGGAGCTGG + Intergenic
934841378 2:97626301-97626323 CTGGGGGCACAGGGAGGAGCTGG + Intergenic
937437423 2:121892068-121892090 CCGTGGGGAGAGGGAGAGGGAGG - Intergenic
937905318 2:127050165-127050187 CAGAGGCTACAGGAAGAAGCGGG + Intronic
938950350 2:136249395-136249417 CTGTGGGCACAGGGAGAGGCAGG + Intergenic
939660589 2:144883780-144883802 CAGTGGGTAGAGGCAGCAGCAGG - Intergenic
939759153 2:146152886-146152908 CCAGAGGTACAGGGAGGAGCTGG + Intergenic
940039920 2:149349328-149349350 CTGTAGGTACAGAGAGAAGTAGG + Intronic
940637861 2:156320222-156320244 CGTTGGGTGCAGGGAGAAGCAGG + Intergenic
940895924 2:159081812-159081834 CCATGGGGCCAGGGAGGAGCTGG - Intronic
941032417 2:160527591-160527613 CCAGGGGTACAAGGAGGAGCCGG - Intergenic
941550533 2:166910190-166910212 CCAGAGGTACAAGGAGAAGCTGG - Intronic
941776862 2:169402727-169402749 CCAGAGGTACAAGGAGAAGCTGG + Intergenic
941814987 2:169787346-169787368 CCGTGGGGAGAGGGAGAGGGAGG + Intergenic
943359313 2:186898656-186898678 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
944882446 2:204027179-204027201 CCATGGGAACAGAGATAAGCAGG - Intergenic
945556384 2:211281523-211281545 CAGAGGGTACAGTGAGAAGGTGG - Intergenic
946162136 2:217841734-217841756 ACCTGGGTCCAGGGAGAGGCAGG - Intronic
947305408 2:228740793-228740815 CCGTGGGTTAAGGCAGAAACAGG + Intergenic
947515753 2:230802821-230802843 CCAGAGGTACAAGGAGAAGCTGG + Intronic
948836564 2:240628839-240628861 CAGTGGGTCCAGGAAGAACCCGG - Intronic
1169441954 20:5640057-5640079 CCGTGGGGAGAGGGAGCTGCAGG + Intergenic
1169444086 20:5657096-5657118 GAGAGGGCACAGGGAGAAGCTGG + Intergenic
1169617262 20:7462599-7462621 ACGTGGGTAGGGGGAGGAGCTGG - Intergenic
1170081191 20:12478518-12478540 CCAGAGGTACAAGGAGAAGCTGG + Intergenic
1170154184 20:13254633-13254655 CTCTGGGCAAAGGGAGAAGCTGG + Intronic
1171001198 20:21417395-21417417 CCAGAGGTACAAGGAGAAGCTGG + Intergenic
1171848655 20:30292662-30292684 CCGTGGGGAGAGGGAGAGGGAGG + Intergenic
1172058878 20:32175353-32175375 CCGTGGGGAGAGGGAGAGGGAGG - Intergenic
1172208634 20:33182078-33182100 CCTTGGGTGGAGGGAGAAGCTGG - Intergenic
1172890591 20:38260953-38260975 CCGTGGGAAGAGCGAGGAGCGGG - Intronic
1173086123 20:39920164-39920186 CCAGAGGTACAAGGAGAAGCTGG + Intergenic
1173502144 20:43561805-43561827 TAGTGGGTAAATGGAGAAGCAGG + Intronic
1173502888 20:43566450-43566472 CTGGGGGGACAGGGAGGAGCAGG - Exonic
1173770754 20:45654995-45655017 CCAGAGGTACAAGGAGAAGCTGG + Intronic
1173903389 20:46607499-46607521 CCATGGGATCAGGGAGGAGCAGG - Intronic
1176046328 20:63094668-63094690 CCTGGGGTACAGCGAGAAGGAGG - Intergenic
1176861698 21:14014629-14014651 ACGGAGGTACATGGAGAAGCTGG - Intergenic
1178352287 21:31880868-31880890 CACTGGGCAGAGGGAGAAGCTGG + Intronic
1178819459 21:35962113-35962135 GTGTGGGTAAAGGGAGAAGCAGG - Intronic
1179278960 21:39917463-39917485 CTGGTGGTAGAGGGAGAAGCTGG + Intronic
1179633094 21:42690795-42690817 GCGTGGGTACAGGGGTAAGTTGG - Intronic
1180583017 22:16859472-16859494 CCGTGGGCATAAGGAGAAGGGGG - Intergenic
1181009421 22:20031880-20031902 CCGTGGGTGCAGGGTCCAGCAGG + Intronic
1181602676 22:23961466-23961488 CCGGCTGGACAGGGAGAAGCAGG + Intergenic
1181605838 22:23979841-23979863 CCGGCTGGACAGGGAGAAGCAGG - Intronic
1182058174 22:27377627-27377649 TGGTTGGCACAGGGAGAAGCAGG - Intergenic
1183377802 22:37475150-37475172 CTGGGGGTACAGGGAGAATCAGG + Intronic
1183595042 22:38806316-38806338 CCGTGGGGAGAGGGAGAGGGAGG - Intergenic
1183674969 22:39294115-39294137 CCCTGGCTACAGGCAGCAGCAGG - Intergenic
1184212502 22:43044120-43044142 CAGCGGGGACAGGGAGAAGATGG - Intronic
1185328103 22:50237452-50237474 CCGTGGGATCAGGGAGTAGAGGG + Intronic
949988583 3:9559382-9559404 CCGTGGGGAGAGGGAGAGGGGGG - Intergenic
950481721 3:13248231-13248253 ACGTGGGTTCAGGAGGAAGCCGG + Intergenic
952308239 3:32164164-32164186 CCTTGGGGAAAGGGAGAAGCAGG + Intronic
952383464 3:32821773-32821795 CCGCGGGTCCCGGGAGAGGCGGG + Intronic
952405015 3:32997700-32997722 CTGTGGGTACAGGCAGCACCTGG - Intronic
952546915 3:34430319-34430341 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
953443108 3:42936612-42936634 CCCTGGGTACAGGGAAACGAGGG - Intronic
954048178 3:47951335-47951357 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
955119777 3:56046327-56046349 ACATGGGTCCAGGAAGAAGCTGG + Intronic
955282744 3:57609797-57609819 CCAGAGGTACAGGGAGGAGCTGG + Intergenic
956279303 3:67539637-67539659 CCGTAGGTACAAAGAGGAGCTGG - Intronic
957747301 3:84362503-84362525 CCAGGGGTACAAGGAGGAGCTGG - Intergenic
957799298 3:85054300-85054322 CTCTGAGTACAGGGAGCAGCTGG + Intronic
958412585 3:93835806-93835828 CCAGAGGTACAAGGAGAAGCTGG + Intergenic
959201882 3:103255911-103255933 CCGTGGGGAGAGGGAGAGGAGGG + Intergenic
959515465 3:107261625-107261647 CGGTAGCTACAGAGAGAAGCAGG + Intergenic
959990448 3:112625759-112625781 CTGTGGGTGCAGGGAGTAGCAGG + Intronic
960388474 3:117050031-117050053 CCGTGGGGAGAGGGAGACGAGGG - Intronic
960987509 3:123290437-123290459 CATGGGGCACAGGGAGAAGCAGG - Intronic
961345942 3:126263480-126263502 CCCTGGGTACTGGGAGAAAGAGG + Intergenic
961738005 3:129014435-129014457 GCGAGGATACAGGGAGAAGGCGG - Intronic
962439393 3:135398441-135398463 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
963070168 3:141298115-141298137 CCGGAGGTACAAGGAGGAGCTGG - Intergenic
967178841 3:186885562-186885584 CCGTGGGGAGAGGCAGAGGCAGG + Intergenic
967771535 3:193338812-193338834 CCAGAGGTACAAGGAGAAGCTGG - Intronic
968119517 3:196115107-196115129 AGGTGGGTACTGGGAGCAGCAGG + Intergenic
969643097 4:8411017-8411039 ACGTGGGAACAGGCAGGAGCTGG + Intronic
969683832 4:8657810-8657832 CGGTGGGTAAATGGAGAAACTGG - Intergenic
969807509 4:9621464-9621486 CCATAGGTACAAGGAGGAGCTGG + Intergenic
970791706 4:19865369-19865391 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
971279771 4:25233825-25233847 CCGTGAGCGCGGGGAGAAGCTGG - Intronic
974612792 4:64238354-64238376 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
974648097 4:64719296-64719318 ACGTGGTGACAGGGAGAAGAGGG + Intergenic
976260970 4:83144472-83144494 CCATGGGTACAGTAAGGAGCAGG + Intergenic
976491209 4:85672659-85672681 CTGGTGGTACAGGAAGAAGCTGG + Intronic
976859658 4:89648141-89648163 CCATAGGTACAAGGAGGAGCTGG + Intergenic
977588742 4:98803608-98803630 CCATGGGAACAGGCTGAAGCTGG + Intergenic
978820437 4:112958604-112958626 CCGTGGGGAGAGGGAGAGGGGGG + Intronic
979641808 4:123017132-123017154 CCGTGGGGAGAGGGAGAGGGGGG + Intronic
980090091 4:128434084-128434106 CCGGAGGTACAAGGAGGAGCTGG - Intergenic
982310546 4:153980657-153980679 CCATAGGTACAAGGAGGAGCTGG - Intergenic
982479748 4:155894805-155894827 CCATAGGTACAAGGAGGAGCTGG + Intronic
982612468 4:157593325-157593347 CTGTGGGTAATGGGAGAGGCTGG - Intergenic
983108643 4:163721607-163721629 CCATAGGTACAAGGAGGAGCTGG - Intronic
983189505 4:164740113-164740135 CTGTGGCTCTAGGGAGAAGCTGG - Intergenic
983668603 4:170210674-170210696 CCAGAGGTACAAGGAGAAGCTGG + Intergenic
983791406 4:171801855-171801877 CCAGAGGTACAGGGAGGAGCTGG - Intergenic
983978455 4:173965509-173965531 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
984340204 4:178447382-178447404 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
986565658 5:9111165-9111187 CTGTGGGTAGAAGGAGAAGTAGG + Intronic
987775475 5:22360492-22360514 CCAGGGGTACAAGGAGGAGCTGG + Intronic
989407298 5:41075854-41075876 CCAGAGGTACAAGGAGAAGCCGG - Intergenic
989528448 5:42479463-42479485 CCAGAGGTACAAGGAGAAGCTGG - Intronic
989633316 5:43510426-43510448 CCGTGGGGAGAGGGAGAGGGAGG - Intronic
991046441 5:62227909-62227931 CCAGAGGTACAGGGAGGAGCTGG - Intergenic
991087225 5:62659177-62659199 CCAGAGGTACAGGGAGGAGCTGG + Intergenic
991088969 5:62675382-62675404 CCAGAGGTACAGGGAGGAGCTGG - Intergenic
991373063 5:65939532-65939554 CCGTGGGGAGAGGGAGAGGGGGG - Intronic
991723843 5:69516507-69516529 CCGTGGGGAGAGGGAGAGGGGGG + Intronic
992506421 5:77391572-77391594 CACTAGGTACAGGGAGAAGCAGG - Intronic
992513898 5:77471841-77471863 CCAGAGGTACAAGGAGAAGCTGG + Intronic
992643779 5:78793395-78793417 TAGTGGGGACAGGGAGGAGCAGG + Intronic
992657426 5:78924007-78924029 CCGTAGGTCCAGGAAGAAGCAGG - Intronic
992676740 5:79112515-79112537 CCTTGGGTGCAGCGAGAACCCGG - Intronic
992810709 5:80385624-80385646 CCCTGGCTATAGTGAGAAGCTGG + Intergenic
993258319 5:85622367-85622389 CCAGGGGTTCAGGGAGAAACAGG - Intergenic
994093356 5:95827444-95827466 CCCTGGGCACAGGGAGCAGCAGG - Intergenic
994925218 5:106108570-106108592 CAGTGGATACAGAGAGATGCAGG - Intergenic
995309614 5:110695865-110695887 CCAGAGGTACAAGGAGAAGCTGG + Intronic
995529480 5:113078218-113078240 CCAGAGGTACAAGGAGAAGCTGG + Intronic
997084983 5:130787063-130787085 CCGGAGGTACAAGGAGGAGCTGG + Intergenic
997350488 5:133227453-133227475 CCTTGGGTAGAGGGAGGAGTGGG + Intronic
997586135 5:135044751-135044773 CCTTGAGTACAGGGAGAATTGGG - Intronic
997828051 5:137125150-137125172 CTGGGGGTACAGGGCCAAGCTGG - Intronic
998025473 5:138811929-138811951 CCGTGGGGAGAGGGAGAGGGAGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998133383 5:139662176-139662198 CTAAGGGGACAGGGAGAAGCAGG - Intronic
998156410 5:139789209-139789231 CCCTGGGCTCAGGGAGGAGCTGG + Intergenic
999392005 5:151199982-151200004 CCAGGGGTACAGGGAGAAATCGG - Intronic
999593914 5:153181277-153181299 CCAGGGGTACAAGGAGGAGCTGG + Intergenic
1000566054 5:162848840-162848862 CCAGAGGTACATGGAGAAGCTGG + Intergenic
1002212341 5:177606478-177606500 CAGTGGCAACAGCGAGAAGCGGG - Intronic
1002414135 5:179109965-179109987 CAGCAGGTATAGGGAGAAGCAGG - Intergenic
1003225436 6:4201094-4201116 CCGGAGGTACAAGGAGGAGCTGG - Intergenic
1004862586 6:19820102-19820124 TCGAGGGTAAAGGGAGAACCTGG + Intergenic
1006014366 6:31068127-31068149 CCGTGGGGAGAGGGAGAGGGAGG + Intergenic
1007192683 6:40033019-40033041 CTGTGGGTAGAGGGAAAGGCAGG + Intergenic
1007651339 6:43424622-43424644 CCGTGGGGAGAGGGAGAGGGAGG - Intergenic
1007745917 6:44042838-44042860 CCTGGGGAAAAGGGAGAAGCTGG + Intergenic
1007747987 6:44054977-44054999 CCTTGGGCTCAGGGAGAGGCTGG - Intergenic
1007845405 6:44750986-44751008 CCAGAGGTACAAGGAGAAGCTGG + Intergenic
1008112378 6:47506776-47506798 CCGTGGGGAGAGGGAGACGGAGG + Intronic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1010718139 6:79253877-79253899 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
1011587908 6:88946665-88946687 CCGTGGGGAGAGGGAGAGGGAGG - Intronic
1012821384 6:104088984-104089006 CCGGAGGTACAAGGAGGAGCTGG + Intergenic
1012979343 6:105813252-105813274 CTGTAGGTACAGGGAGAAGCAGG + Intergenic
1013190740 6:107802729-107802751 CCGTGGGGAGAGGGAGAGGGAGG - Intronic
1013204385 6:107933699-107933721 CCGTGGGGAGAGGGAGAGGCAGG - Intronic
1013909214 6:115253638-115253660 CCAGGGGTACAAGGAGGAGCTGG + Intergenic
1015799664 6:137047251-137047273 CTGGGAGTACAGGAAGAAGCTGG - Intergenic
1016973771 6:149787282-149787304 CCGTGGGTAGAGGGAGACCGTGG + Intronic
1017170225 6:151449642-151449664 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1020753933 7:12177049-12177071 CAGAGGGGACAGGGAAAAGCAGG - Intergenic
1023160406 7:37291933-37291955 CCGTGGGCAGAGGGAGAGGGAGG - Intronic
1023455697 7:40336326-40336348 CCAGAGGTACAGGGAGGAGCTGG - Intronic
1024031553 7:45465073-45465095 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
1024532034 7:50401282-50401304 CCCTGGGTGGAGGGAGACGCCGG + Exonic
1024538517 7:50458942-50458964 CCGTGGGGAGAGGGAGAGGGGGG - Intronic
1024671175 7:51596576-51596598 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
1025153700 7:56584353-56584375 CCATGCGTACAGTAAGAAGCAGG + Intergenic
1025573173 7:62600659-62600681 CCGTGGGGAGAGGGAGAGGGAGG + Intergenic
1025763588 7:64418492-64418514 CCATGTGTACAGTAAGAAGCAGG - Intergenic
1025852668 7:65257404-65257426 CCGTGGGGAGAGGGAGACGAGGG - Intergenic
1025874419 7:65467070-65467092 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
1027134988 7:75617682-75617704 CCTTGGGGAAAAGGAGAAGCGGG + Intronic
1027871523 7:83713979-83714001 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
1028105023 7:86867185-86867207 TCGTGGGTAGAGGGAGAAGCAGG - Intergenic
1028513192 7:91647788-91647810 CCAGAGGTACAAGGAGAAGCTGG + Intergenic
1029190256 7:98766873-98766895 CCGTGAGTTCATGGAGAAGTGGG + Intergenic
1029231193 7:99070246-99070268 CCGTGGGGACAGGCAGCAGGTGG - Intronic
1029481575 7:100816669-100816691 CTGGGGGTACAGAGTGAAGCAGG + Intronic
1030682839 7:112451000-112451022 CCGTGGGGGCAGGGAGGAACGGG + Intronic
1030706503 7:112698038-112698060 CCGTGGGAAGAGGGAGAGGGAGG + Intergenic
1031548668 7:123081906-123081928 CCGGAGGTACAAGGAGGAGCTGG - Intergenic
1032043079 7:128577702-128577724 CCGTGGGGAGAGGGAGAGGGGGG + Intergenic
1032068946 7:128792036-128792058 CCGGGGGGACAGGGAGGAGAGGG - Exonic
1032569344 7:132983980-132984002 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
1033685019 7:143630988-143631010 CACTGGAGACAGGGAGAAGCCGG + Intronic
1033688192 7:143710207-143710229 CACTGGAGACAGGGAGAAGCCGG + Intronic
1033699594 7:143826633-143826655 CACTGGAGACAGGGAGAAGCCGG - Intergenic
1034133072 7:148738964-148738986 CGGTGGGTTCAGGGAGCAGCAGG + Intronic
1034368921 7:150577050-150577072 CCATAGGTACAAGGAGGAGCTGG - Intergenic
1034785781 7:153924830-153924852 CCGTTGGTTCAGGGGGTAGCAGG + Intronic
1034989999 7:155542288-155542310 CCGTAGGTCCGGGGAGCAGCTGG - Intergenic
1035493628 7:159301925-159301947 CCGTAGGTACAAGGAGGAGCTGG + Intergenic
1036285893 8:7443889-7443911 CAGTGGGTATTGGGAGAAGCCGG - Intronic
1036335580 8:7867640-7867662 CAGTGGGTATTGGGAGAAGCCGG + Intronic
1039471196 8:37814730-37814752 CGGAGATTACAGGGAGAAGCTGG - Intronic
1041423878 8:57698691-57698713 CCGTAGGTACAAAGAGGAGCTGG + Intergenic
1042324559 8:67515328-67515350 CAGTGGGCACAAGGAAAAGCAGG - Intronic
1042753832 8:72187750-72187772 CCATAGGTACAGAGAGGAGCTGG + Intergenic
1045195487 8:99926595-99926617 CCGTGGGGAGAGGGAGAGGGAGG - Intergenic
1045360587 8:101429283-101429305 CCAGAGGTACACGGAGAAGCTGG + Intergenic
1049391745 8:142375229-142375251 CTGTGGGTGCCGGGAGCAGCTGG - Intronic
1049583157 8:143421776-143421798 CAGAGGCTGCAGGGAGAAGCTGG + Intronic
1049671708 8:143872962-143872984 CCTTGGACACAGGGAGCAGCTGG + Exonic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1050475364 9:6034979-6035001 CAGTGGGGAGAGGGGGAAGCGGG - Intergenic
1051910952 9:22154190-22154212 CCCAGGGTACAGGAGGAAGCTGG + Intergenic
1053169710 9:35869768-35869790 CCAGGGGTACAGGCAGCAGCAGG + Exonic
1054718693 9:68582367-68582389 CAGGGGGTCCAGGGAGAAGAAGG + Intergenic
1056239144 9:84626704-84626726 CCAGAGGTACAAGGAGAAGCTGG + Intergenic
1057204661 9:93164091-93164113 CAGAGTGTCCAGGGAGAAGCTGG - Intergenic
1058961427 9:109995939-109995961 CCTTGGATTCATGGAGAAGCTGG - Intronic
1059262383 9:112990691-112990713 CCACGGGTACAAAGAGAAGCTGG - Intergenic
1061817094 9:133203990-133204012 GCGTGGGTGCAGGGAGATGCTGG - Intergenic
1061912368 9:133732000-133732022 CCACTGGGACAGGGAGAAGCTGG + Intronic
1186038044 X:5445935-5445957 AACTGGGTACAGGGAGAAGGCGG - Intergenic
1187835230 X:23425870-23425892 CCATAGGTACAAGGAGGAGCTGG - Intergenic
1188057266 X:25555731-25555753 CTGTGGGAGCAGGGAGAGGCGGG - Intergenic
1190820130 X:53966217-53966239 CCGTGGGGAGAGGGAGAGGAGGG - Intronic
1191002847 X:55679643-55679665 CCAGGGGTACAAGGAGGAGCTGG - Intergenic
1191027574 X:55930962-55930984 CCTGAGGTACAGAGAGAAGCTGG - Intergenic
1191990476 X:67029732-67029754 CCAGAGGTACAGGGAGGAGCTGG + Intergenic
1192879065 X:75263297-75263319 CCAGAGGTACAGGGAGGAGCTGG - Intergenic
1192918732 X:75683095-75683117 CCAGGGGTAAAAGGAGAAGCTGG - Intergenic
1193007407 X:76635842-76635864 CCAGAGGTACAGGGAGGAGCTGG - Intergenic
1193990385 X:88299747-88299769 GTGAGGGTACAGGGAGAAGATGG + Intergenic
1194612131 X:96057329-96057351 CCAGAGGTACAAGGAGAAGCTGG - Intergenic
1195533337 X:105982467-105982489 CAGTGGGGAGAGGGAGAGGCTGG + Intergenic
1195957074 X:110342905-110342927 CCAGGGGTACAAGGAGGAGCTGG + Intronic
1196649010 X:118149851-118149873 CAGTGGATACGGGGAGAAGATGG - Intergenic
1197455493 X:126673204-126673226 CCGTGGGGAGAGGGAGACGAGGG - Intergenic
1197892461 X:131280418-131280440 CGGGGGGTACAGCCAGAAGCAGG + Intronic
1198689321 X:139263083-139263105 CCATAGGTACAAGGAGGAGCCGG + Intergenic
1198718797 X:139592755-139592777 CTGTGGGTTCAGAGTGAAGCAGG + Intronic
1199662756 X:150068687-150068709 CCACAGGTACAAGGAGAAGCTGG - Intergenic
1199762135 X:150913029-150913051 CAGTGGGACCAGGGAGCAGCTGG - Intergenic
1201930196 Y:19336302-19336324 CCATAGGTACAAGGAGGAGCCGG - Intergenic