ID: 1152747937

View in Genome Browser
Species Human (GRCh38)
Location 17:82049799-82049821
Sequence AGCTGAGCAGGTGCGGCTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 324}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152747937_1152747941 2 Left 1152747937 17:82049799-82049821 CCGGCAGCCGCACCTGCTCAGCT 0: 1
1: 0
2: 3
3: 39
4: 324
Right 1152747941 17:82049824-82049846 GCTCATGAAGCTGCCCAGGCTGG 0: 1
1: 0
2: 9
3: 171
4: 2791
1152747937_1152747950 28 Left 1152747937 17:82049799-82049821 CCGGCAGCCGCACCTGCTCAGCT 0: 1
1: 0
2: 3
3: 39
4: 324
Right 1152747950 17:82049850-82049872 GAGGCCGGTCAGCACCTTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 77
1152747937_1152747942 3 Left 1152747937 17:82049799-82049821 CCGGCAGCCGCACCTGCTCAGCT 0: 1
1: 0
2: 3
3: 39
4: 324
Right 1152747942 17:82049825-82049847 CTCATGAAGCTGCCCAGGCTGGG 0: 1
1: 0
2: 7
3: 57
4: 595
1152747937_1152747944 5 Left 1152747937 17:82049799-82049821 CCGGCAGCCGCACCTGCTCAGCT 0: 1
1: 0
2: 3
3: 39
4: 324
Right 1152747944 17:82049827-82049849 CATGAAGCTGCCCAGGCTGGGGG 0: 1
1: 0
2: 5
3: 39
4: 562
1152747937_1152747947 13 Left 1152747937 17:82049799-82049821 CCGGCAGCCGCACCTGCTCAGCT 0: 1
1: 0
2: 3
3: 39
4: 324
Right 1152747947 17:82049835-82049857 TGCCCAGGCTGGGGGGAGGCCGG 0: 1
1: 0
2: 9
3: 135
4: 1151
1152747937_1152747940 -2 Left 1152747937 17:82049799-82049821 CCGGCAGCCGCACCTGCTCAGCT 0: 1
1: 0
2: 3
3: 39
4: 324
Right 1152747940 17:82049820-82049842 CTGTGCTCATGAAGCTGCCCAGG 0: 1
1: 1
2: 2
3: 30
4: 232
1152747937_1152747946 9 Left 1152747937 17:82049799-82049821 CCGGCAGCCGCACCTGCTCAGCT 0: 1
1: 0
2: 3
3: 39
4: 324
Right 1152747946 17:82049831-82049853 AAGCTGCCCAGGCTGGGGGGAGG 0: 1
1: 0
2: 3
3: 80
4: 820
1152747937_1152747945 6 Left 1152747937 17:82049799-82049821 CCGGCAGCCGCACCTGCTCAGCT 0: 1
1: 0
2: 3
3: 39
4: 324
Right 1152747945 17:82049828-82049850 ATGAAGCTGCCCAGGCTGGGGGG 0: 1
1: 0
2: 2
3: 43
4: 408
1152747937_1152747943 4 Left 1152747937 17:82049799-82049821 CCGGCAGCCGCACCTGCTCAGCT 0: 1
1: 0
2: 3
3: 39
4: 324
Right 1152747943 17:82049826-82049848 TCATGAAGCTGCCCAGGCTGGGG 0: 1
1: 0
2: 3
3: 59
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152747937 Original CRISPR AGCTGAGCAGGTGCGGCTGC CGG (reversed) Exonic
900345294 1:2207612-2207634 AGCAGAGCAGACGCGGCTGCAGG + Intronic
900405452 1:2490962-2490984 AGCAGAGCCTGTGCGGCTTCTGG - Intronic
900465017 1:2821371-2821393 ATCTGAGCACACGCGGCTGCAGG - Intergenic
900618764 1:3577457-3577479 AGCTGAGCACCAGCAGCTGCTGG + Intronic
901135112 1:6987988-6988010 AGCAGAGCAGCTCCTGCTGCTGG - Intronic
901535284 1:9878765-9878787 AGCAGAGCAGGTGGTGCAGCTGG - Intronic
901631812 1:10651657-10651679 AGCTGGGCGGGTGAGGCCGCAGG + Intronic
902700496 1:18168901-18168923 AGGGGAGCAGGTGCTGGTGCAGG + Intronic
903213121 1:21829604-21829626 AGCTGAGCTGTGGCTGCTGCAGG - Exonic
903297097 1:22350804-22350826 AGCTGAGCAGGGGCTGCAACAGG + Intergenic
903570457 1:24300860-24300882 AGCAGAGGAGGTGCGACTGTCGG + Intergenic
905483894 1:38282169-38282191 AGCTGGGGAGGTGCTGCTCCAGG + Intergenic
905584203 1:39104933-39104955 AGCGGGGCCTGTGCGGCTGCTGG - Intronic
908354861 1:63319273-63319295 ATTTGAGCAGGTGAGGCAGCTGG + Intergenic
908642678 1:66242800-66242822 AGCCCAGCAGGTGGGGCTGCTGG - Intronic
911205655 1:95089679-95089701 AGGTGAGCAGGTGCAGGAGCTGG + Intergenic
912682547 1:111738628-111738650 GGCAGAGCTGGCGCGGCTGCGGG - Intronic
912971350 1:114286372-114286394 AGCCCAGCAGGGGAGGCTGCAGG + Intergenic
913097722 1:115535182-115535204 AGGTGAGCAGGTGCAGAAGCTGG - Intergenic
914352372 1:146851769-146851791 AGCTGAGTAGTTGGGACTGCAGG + Intergenic
914446177 1:147752536-147752558 AGCTGAACAGCAGCTGCTGCTGG + Intergenic
914877709 1:151524730-151524752 AGAGGAGCAGCTGAGGCTGCGGG + Exonic
915637222 1:157195412-157195434 AGCGCAGCAGGAGCGGCTGCGGG + Intergenic
915912380 1:159923082-159923104 AGCTGATGGGCTGCGGCTGCTGG + Intronic
917452160 1:175156229-175156251 GCCGGGGCAGGTGCGGCTGCAGG + Intergenic
917594907 1:176519375-176519397 AGGTGAGGAGGTGGGGCTGGTGG + Intronic
919886957 1:201941810-201941832 AGCTGAGCTGGTGGGGGTGGAGG - Intronic
920033006 1:203048573-203048595 GGCTGTGCAGGTGCGCCAGCGGG + Intronic
920396781 1:205652408-205652430 TTCTGAGCAGGTGGGACTGCAGG - Intergenic
920766009 1:208834570-208834592 AGCTGAGCAGACGCGGCTGCCGG + Intergenic
920921156 1:210298344-210298366 AGGTGAGCAGGTGCAGGAGCTGG + Intergenic
920925159 1:210334277-210334299 TGCTGAGCAGCTGGGGCTACTGG + Intronic
921217987 1:212952828-212952850 AGCTGAGCATCTGAGCCTGCAGG + Intronic
922513207 1:226186678-226186700 CGCTGAGGAGGTGCAGCAGCCGG - Exonic
922857847 1:228790368-228790390 AGCTGAGCAGCTCCAGCTGGGGG + Intergenic
923954323 1:238997558-238997580 TGCTGAGCAGTGGCGGCGGCAGG + Intergenic
924902738 1:248418680-248418702 AGCTGAGCAGGTGCAGGAGCTGG - Intergenic
1063379276 10:5574331-5574353 AGGTCAGCAGGTGGGGCGGCGGG + Intergenic
1063599985 10:7472186-7472208 AAGGGAGCAGGTGCAGCTGCTGG + Intergenic
1063947515 10:11192086-11192108 AGCTGAGCAGGTGGGACAGCTGG - Intronic
1065645017 10:27825046-27825068 AGCTGAGTAGGGGAGGCTGTGGG - Intronic
1065790540 10:29256171-29256193 AGCTGAGTAGGTGGGACTGTGGG - Intergenic
1067147343 10:43703097-43703119 CGCTCAGCAGGCGCGGCTGGGGG + Intergenic
1068789849 10:61016113-61016135 AGCAGAGCAGGATGGGCTGCAGG + Intergenic
1069125664 10:64629257-64629279 AGGTGAGCAGGTGCAGAAGCTGG - Intergenic
1069571898 10:69499276-69499298 AACTGAGCAGCTGCGGGTGGGGG + Intronic
1069856682 10:71444848-71444870 GGCTGAGCAGGTGCCCCTGATGG + Intronic
1069905000 10:71727007-71727029 AGCTGAGCAGGTGTGGCTCTGGG - Intronic
1069987757 10:72295903-72295925 ATTGGAGCAGGTGAGGCTGCAGG + Intergenic
1070521723 10:77259682-77259704 ATGTGAGCAGGTGAGGCTTCTGG - Intronic
1070713704 10:78702294-78702316 TGCTGAGCTGGGGCTGCTGCTGG - Intergenic
1070897258 10:79995474-79995496 AGCTGTGCTGCTGCAGCTGCTGG - Intergenic
1071526635 10:86363266-86363288 AGCTGGGCCGGTCCGGCTGCGGG - Intronic
1071886091 10:89952010-89952032 AGCTGAGCAGGGGTGGCTGAGGG - Intergenic
1071960438 10:90804507-90804529 AGGTGAGCAGGTGCAGGAGCTGG - Intronic
1073207317 10:101775985-101776007 AGCGGAGAGGGTGCGGGTGCGGG + Intronic
1073443372 10:103565772-103565794 ACCTGAGCAGCTGGGACTGCAGG + Intronic
1074363279 10:112839333-112839355 AGCTCAGCAGCTGCCCCTGCAGG - Intergenic
1075557650 10:123444988-123445010 AGCTGAGCAGTGGCGGGTTCAGG - Intergenic
1076260203 10:129059101-129059123 GCCTGGGCAGGTGCAGCTGCAGG + Intergenic
1076280939 10:129245081-129245103 AGCGGAACAGGGGCGGCTTCTGG - Intergenic
1076655615 10:132021690-132021712 AGGTGCACAGGGGCGGCTGCAGG + Intergenic
1076668544 10:132106369-132106391 AAATGAGCAGGTGCAGCTGTGGG - Intronic
1076764844 10:132627397-132627419 CGCTGAGCAGGTGGGTCTGGAGG + Intronic
1076890984 10:133283275-133283297 AACTGAGCACGTGCGCATGCAGG - Intronic
1077147049 11:1051021-1051043 AGCTGGGCAGGTGGGGCAGGTGG - Intergenic
1077294148 11:1816348-1816370 TCCTGAGTAGGTGGGGCTGCAGG - Intergenic
1077502160 11:2914320-2914342 GGCTGAGCAGGAGGGGCTGACGG + Intronic
1083629523 11:64088431-64088453 AGCCCTGCAGGTGCGGCTGTGGG + Intronic
1083777384 11:64900863-64900885 AGGTGAGGAGGAGCGGGTGCAGG - Exonic
1084175145 11:67419000-67419022 GGCTGAGCTGGCCCGGCTGCTGG + Exonic
1084323507 11:68386317-68386339 AGCCGAGGAGGTGCTGCTGCTGG + Exonic
1084419451 11:69053063-69053085 GGCTGACCAGGTGCGCCCGCTGG + Intronic
1085212813 11:74796974-74796996 GGCTGAGTAGGTGGGGCTACAGG + Intronic
1085303547 11:75472639-75472661 TGCTGACCAGGTGGGGCAGCCGG - Intronic
1087896304 11:103590254-103590276 AGGTGAGCAGGTGCAGGAGCTGG - Intergenic
1088695551 11:112362868-112362890 AGTTGAGAAGGTGTGTCTGCCGG - Intergenic
1088748598 11:112824854-112824876 AGATGAGCAGGTGCAGGAGCTGG - Intergenic
1088859385 11:113785610-113785632 AGAAGTGCAGGTGCTGCTGCTGG - Intergenic
1089243109 11:117098375-117098397 AGCGGAGCTGGCGGGGCTGCCGG - Exonic
1089530707 11:119127061-119127083 AGCCATGCAGGTGCTGCTGCAGG - Exonic
1089682124 11:120124394-120124416 ATCTGAGAAGCTGCGGCTGGCGG - Intronic
1090400048 11:126443234-126443256 AGCAGAGCAGAGCCGGCTGCAGG + Intronic
1091592309 12:1851000-1851022 AGCTGAGTAGCTGGGACTGCAGG + Intronic
1091841241 12:3622582-3622604 AGCTCAGAATGTGCAGCTGCTGG + Intronic
1091991591 12:4960305-4960327 AGCTGGGGAGGTGTGGCTGCAGG + Intergenic
1096180954 12:49550053-49550075 AGGTGAGCAGGTGCGGGGGTGGG - Intronic
1098234514 12:68405986-68406008 TGCTGAGCAGCTGAGGCTGAAGG - Intergenic
1098539741 12:71640691-71640713 AGCTGGCCAGGGGCAGCTGCCGG + Intronic
1098545552 12:71707485-71707507 AGGTGAGCAGGTGCAGGAGCCGG + Intergenic
1098980056 12:76946173-76946195 AGCTGAGCAGGAGCTGAGGCTGG - Intergenic
1101413853 12:104491903-104491925 AGCACAGCAAGTGAGGCTGCAGG - Intronic
1102261772 12:111447430-111447452 AGCTCAGCTGGTTCAGCTGCAGG + Exonic
1103447785 12:121005522-121005544 TGCTGAGCTGATGTGGCTGCTGG - Intronic
1103891897 12:124245526-124245548 AGCTGAGATGGTGAGGCTGCGGG - Intronic
1104294628 12:127500693-127500715 AGCTGGGCAGATGCCCCTGCAGG - Intergenic
1104760798 12:131296676-131296698 AGCAGAGCAGGGTCGGCTGCGGG - Intergenic
1104789775 12:131474203-131474225 GGCTGAGCAGGGGCGGCTCCAGG - Intergenic
1104818977 12:131664116-131664138 AGGAGAGCAGGGTCGGCTGCAGG + Intergenic
1105275338 13:18918215-18918237 AGCTGAGATGGTGCCACTGCGGG - Intergenic
1105407785 13:20145901-20145923 AGCTTGGCAGGTGGGGCTGTGGG - Intronic
1105756161 13:23466403-23466425 GGCTGCGCAGCTGCGTCTGCGGG + Intergenic
1106367941 13:29101484-29101506 AGCTGAGATGGTGCTGTTGCAGG + Intronic
1112329363 13:98465045-98465067 AGCTGACCAGGTGCTGCTTGCGG - Intronic
1113467687 13:110523913-110523935 ACCTAAGCAGGTGCAGCTGGAGG - Exonic
1115441609 14:33442311-33442333 TCCTGAGTAGGTGAGGCTGCAGG - Intronic
1118016829 14:61669286-61669308 AGATGAGCAGGCCTGGCTGCAGG + Intergenic
1118475045 14:66108949-66108971 AGCTGTGAAGGGGAGGCTGCTGG + Intergenic
1118723319 14:68609246-68609268 CCCAGAGGAGGTGCGGCTGCAGG + Intronic
1121438068 14:93931950-93931972 GGCTGGGTAGGTGCGGCTGCAGG + Intergenic
1121641149 14:95485675-95485697 AGCTGAGCCTGTGGGGATGCTGG - Intergenic
1122616324 14:103020416-103020438 AGCTGTGGAGGTGCTGCTCCAGG - Intronic
1122641758 14:103164167-103164189 AGGTGAGCAGGTGCAGGAGCCGG - Intergenic
1122776690 14:104119975-104119997 AGCTGGGCACGTGGGGCTCCTGG + Intergenic
1123091731 14:105745038-105745060 AGGTGAGCAGGTGCAGGTGGGGG - Intergenic
1123091823 14:105745354-105745376 AGGTGAGCAGGTGCAGGTGGGGG - Intergenic
1123783353 15:23646790-23646812 GGCTGTGCAGGTGGGGCCGCCGG + Exonic
1125347333 15:38731732-38731754 GGCTGAGCAGGTGGGGCTCCAGG - Intergenic
1126212164 15:46111857-46111879 AGGTGAGCAGGTGCAGGAGCTGG - Intergenic
1128762446 15:70226572-70226594 AGCTGAGAAGGAGGGGCAGCAGG - Intergenic
1129453041 15:75661326-75661348 AGCTGAGCAGGCTTGGCTCCTGG - Exonic
1130014244 15:80174915-80174937 AGGGGAGCAGGTGCTGCTGGGGG + Intronic
1130064668 15:80593863-80593885 GGCCGAGCAGCCGCGGCTGCAGG - Exonic
1130420853 15:83745562-83745584 AGGTGAGCAGGTGCAGGAGCCGG - Intronic
1130524286 15:84690491-84690513 TCCTGAGCAGGTGGGACTGCAGG - Intronic
1134485064 16:14651419-14651441 AGCTGAGCATGTGAGGTTCCTGG - Intronic
1134889901 16:17831498-17831520 AGCTGAGCAGGTCCCTCTGCTGG + Intergenic
1136621955 16:31435581-31435603 ATTTAGGCAGGTGCGGCTGCGGG - Exonic
1137454761 16:48609912-48609934 AGCTGAGAAGGCGGAGCTGCTGG - Exonic
1137561150 16:49503206-49503228 TCCTGGGCAGGTGGGGCTGCTGG - Intronic
1137579074 16:49622407-49622429 AGCAGAGCAGGTGAGTCTGGGGG - Intronic
1138347106 16:56326772-56326794 AGCAGAGCAGGTGCTGCCCCGGG - Intronic
1139435396 16:66933986-66934008 AGTAGAGCAGGTGCGGGTTCAGG - Exonic
1139981657 16:70863750-70863772 AGCTGAGTAGTTGGGACTGCAGG - Intronic
1140435020 16:74939868-74939890 AGCTGAGTAGCTGGGACTGCAGG - Intronic
1141255280 16:82396518-82396540 AGCTGCGCAGGTGGTGATGCTGG + Intergenic
1141395724 16:83702742-83702764 AGCTGAGCAGGTGGCACTGTGGG + Intronic
1141674401 16:85510051-85510073 CGCTGAGCAGGTGGGGCCCCGGG + Intergenic
1142155702 16:88532054-88532076 AGTAGAGCAGGTGCGCCTGCAGG - Exonic
1143019789 17:3911448-3911470 AGCTGAGCAGGGGCCGCCCCAGG + Intronic
1143977413 17:10840145-10840167 CGCTGAGCAGGAGCAGCTACAGG - Intergenic
1144021425 17:11242094-11242116 AGCTGAGAGGGTGAGGCCGCGGG - Intronic
1147654125 17:42078815-42078837 AGGTGAGCATGTGTGTCTGCGGG + Intergenic
1148105902 17:45118741-45118763 AGCTAAGCGGGTTCTGCTGCGGG - Intronic
1148247001 17:46038978-46039000 CCCTGAGCAGGTGCAGTTGCAGG + Intronic
1148482373 17:47968444-47968466 AGCTGAGTAGCTGGGACTGCAGG + Intronic
1149544729 17:57495045-57495067 AGCTGACCAGGCTGGGCTGCAGG + Intronic
1152658020 17:81528945-81528967 CGCTCAGCAGGTGGGCCTGCGGG - Exonic
1152747937 17:82049799-82049821 AGCTGAGCAGGTGCGGCTGCCGG - Exonic
1152820802 17:82436810-82436832 GGCTGGGCAGTTCCGGCTGCAGG - Intronic
1153158841 18:2179997-2180019 AGGTGAGCAGGTGCAAGTGCTGG - Intergenic
1154466967 18:14655336-14655358 AGCTGAGATGGTGCCACTGCAGG - Intergenic
1157490752 18:48122059-48122081 AGCTCAGCTGGCTCGGCTGCAGG - Intronic
1158701695 18:59754287-59754309 AGCTAAGCAGCTGGGGCTGCTGG - Intergenic
1159976027 18:74712722-74712744 AGCTGAGCAGGTTCTGCAGTGGG + Intronic
1160256347 18:77251175-77251197 AGATGAGCAGGAGCGGCAGCAGG - Exonic
1160270894 18:77382650-77382672 AGCAGAGCAGGCGGGGCTGAAGG + Intergenic
1160535717 18:79590283-79590305 AGGTGGGCAGGTGCTGCGGCCGG - Intergenic
1160740079 19:681551-681573 AGCTGCGCAGGTGCAGACGCAGG + Exonic
1160805429 19:990404-990426 GGCTGAGGACCTGCGGCTGCTGG - Intronic
1161412516 19:4124206-4124228 TGCTGCGCAGGCGCGGCGGCTGG - Intergenic
1161514193 19:4687605-4687627 CTCTGAGCAGGTGCTGCTGTGGG + Intronic
1161701673 19:5799316-5799338 AGCAGGGCAGGTGCGGCCCCGGG + Intergenic
1162100351 19:8335151-8335173 CGCCGAGAAGGCGCGGCTGCTGG - Exonic
1162440272 19:10688214-10688236 GGCTGAGGAGAGGCGGCTGCTGG + Intronic
1162960469 19:14122783-14122805 AGCTGAACAGGTGAGGCAGGTGG + Intronic
1163582951 19:18149227-18149249 AGCTGGGGAGGCGGGGCTGCTGG - Exonic
1163756717 19:19110852-19110874 AGCTCTGCAGGTGCCGCAGCAGG - Exonic
1163815744 19:19463496-19463518 AGCTGAGCAGGAGCGGGGGCGGG + Intronic
1165319018 19:35074609-35074631 CTCTGAGGAGCTGCGGCTGCTGG + Intergenic
1166355632 19:42225706-42225728 AGCTGGGCAGGTGGGGCAGGGGG - Exonic
1166700097 19:44877441-44877463 GGCTGAGCAGGTGGGGATGGGGG - Intronic
1166723647 19:45012138-45012160 TGATGACCAGGTGCGGCTGCGGG - Exonic
1167571599 19:50292365-50292387 GGCTGAGGTGCTGCGGCTGCAGG + Exonic
1167785087 19:51629745-51629767 AGTTGGGCAGGGGCGGCTGGAGG - Intronic
1167787188 19:51646169-51646191 AGTTGGGCAGGGGCGGCTGGAGG - Intronic
1168415151 19:56163025-56163047 GGCTTAGCAGGTGTGGGTGCAGG - Intergenic
1168417384 19:56177172-56177194 CGGTGGGCAGGTGCGGATGCTGG - Exonic
1168714111 19:58517228-58517250 AGCTGCGCAGGTGCGAGTGGCGG + Exonic
925084479 2:1097233-1097255 AGCGGTGCAGGTGCAGATGCAGG - Intronic
925744570 2:7033277-7033299 AGCTGGGCAGGAGCCCCTGCAGG + Intronic
926761185 2:16280377-16280399 CACTGAGCAGGTGAGTCTGCTGG - Intergenic
927156451 2:20224165-20224187 AGCTGAGCCGGCCCGGCAGCGGG - Intronic
927478531 2:23432725-23432747 AGCTGTGCAGGTGCTGAGGCAGG + Intronic
928314004 2:30232197-30232219 GGCTGAGCTGGTGCGGCCGCAGG + Intronic
928945058 2:36764765-36764787 AAATGAGCAGGTGCTGCTGTTGG + Intronic
933250576 2:80024572-80024594 AGGTGAGCGGGTGCAGGTGCCGG + Intronic
933450318 2:82441265-82441287 AGCTGAGCATGTGAGGGAGCTGG + Intergenic
933882159 2:86680657-86680679 AGCTGAGCAGGTGCAGGAGCTGG + Intronic
934900563 2:98156471-98156493 GGCTGAGCAGATGCCGGTGCGGG + Intronic
936151616 2:110025058-110025080 TGCCCAGCAGGTGAGGCTGCAGG - Intergenic
936193058 2:110346311-110346333 TGCCCAGCAGGTGAGGCTGCAGG + Intergenic
938067802 2:128291509-128291531 AGCTCAGAAGGTGCGTCAGCGGG + Intronic
938067875 2:128291807-128291829 AGCTGTGCAGGGGCGCCGGCGGG + Intronic
938109089 2:128552324-128552346 AGCTGTGCACGTGCAGATGCTGG + Intergenic
938150643 2:128879589-128879611 AGGTGAGCAGGTGCAGGAGCTGG + Intergenic
941816223 2:169798779-169798801 CTCTGAGCATGCGCGGCTGCCGG - Intronic
944616289 2:201464574-201464596 AGCTGGGCAGTGGTGGCTGCAGG - Intronic
945994041 2:216421034-216421056 CCCTGAGCTGGTGCTGCTGCTGG + Intronic
946201417 2:218072876-218072898 AGCTCACCAGGTGGGGCTGTTGG + Exonic
946565948 2:220966127-220966149 AGCAGAACAGTTGCAGCTGCAGG + Intergenic
947339977 2:229127986-229128008 AGCTGTGCAGATGCTGCTGATGG + Intronic
947455964 2:230254395-230254417 ACCTGAGCAGATGAGGCTGCGGG - Intronic
947596955 2:231419010-231419032 AGTTGAGCAGGTGCAGGAGCTGG - Intergenic
949010903 2:241677795-241677817 AGATGGCCAGGTGCTGCTGCAGG + Intronic
1168973277 20:1945533-1945555 AGGTCAGCTGGTGCGGCAGCCGG + Intergenic
1169136984 20:3203487-3203509 AGCAGAGGAGGTGAGGCTTCCGG - Intronic
1171485228 20:25481230-25481252 AGGGGAGCAGGTGGGGCTGCTGG + Intronic
1171559354 20:26108801-26108823 ACCTGAGTAGCTGGGGCTGCAGG - Intergenic
1172919889 20:38472697-38472719 AGCTGCGCAGGCGCAGCTTCCGG + Intergenic
1172935496 20:38617153-38617175 AGCTGACCTGGTTTGGCTGCTGG + Intronic
1173208655 20:41014720-41014742 TGCTGAGCAGCTGGGGCTACAGG - Intergenic
1173798156 20:45877149-45877171 AGCTGAGCCGGTCCAGGTGCTGG - Exonic
1175282642 20:57814365-57814387 TGCTGAGGAGGTGCGGGAGCAGG - Intergenic
1175579830 20:60089705-60089727 AGCTGAGCGGGGGTGGCAGCAGG - Intergenic
1175841117 20:62028127-62028149 CCCAGAGCAGGTGCGGCTCCTGG - Intronic
1175954868 20:62604079-62604101 GGCTGGGCAGGTGCTGCGGCAGG - Intergenic
1175972741 20:62695099-62695121 CGCAGAGCAGGTGCAGGTGCAGG - Intergenic
1176807551 21:13502338-13502360 AGCTGAGATGGTGCCACTGCAGG + Intergenic
1176962984 21:15180687-15180709 AGCTGAGTAGCTGGGACTGCAGG + Intergenic
1178486452 21:33022841-33022863 AGCTGACCAGGGGTGGCGGCGGG - Intergenic
1179252690 21:39686012-39686034 AGCTGAGCAGGAAGGGCTGCTGG - Intergenic
1179578058 21:42320077-42320099 GGCCCAGCAGGTGGGGCTGCGGG - Intergenic
1180054531 21:45351088-45351110 AGCTGAGCAGCTGATGCTGGAGG + Intergenic
1180118146 21:45725719-45725741 GGCTGAGCAGGAGTGGCTGAGGG + Intronic
1180874382 22:19168378-19168400 AGGTGAGTAGGTGGGGCCGCGGG - Intergenic
1182898190 22:33875822-33875844 AGCCCATCAGGTGGGGCTGCCGG - Intronic
1183979387 22:41530860-41530882 AGCGGAGCAGGTGTGGGTGTGGG - Exonic
1184392769 22:44214449-44214471 AGCTGAGCTGGTGAGCCTACTGG - Intronic
1185296757 22:50058437-50058459 GTCGGAGCAGGCGCGGCTGCGGG + Intergenic
1185362118 22:50414629-50414651 AGCTGACCAGGCGCAGCAGCAGG - Exonic
949606438 3:5659183-5659205 ACCTGAGTGGGTGCAGCTGCTGG + Intergenic
950265017 3:11567132-11567154 AGCTGAGCGCGTGCCCCTGCTGG - Intronic
950346689 3:12301737-12301759 AGCTGAACAGGTGTGGTGGCAGG - Intronic
950385257 3:12653936-12653958 AGGTCAGCAGCTGCGACTGCCGG + Intronic
951931603 3:27973642-27973664 AGGTGAGCAGGTGCAGGAGCTGG + Intergenic
952181507 3:30921081-30921103 AGGTGAGCAGGTGCAGCAGCTGG - Intergenic
954106478 3:48412332-48412354 GGGTCAGCAGGTGGGGCTGCGGG + Intronic
954334673 3:49909348-49909370 AGAGGAGCAGGAGCGGCTGCTGG - Exonic
954404699 3:50338921-50338943 AGCTGAGCAGGAGCTGCAGGGGG - Intronic
954637725 3:52080383-52080405 AGGACAGCAGGTGCTGCTGCTGG - Intronic
954750023 3:52808236-52808258 TGCTGAGCAGGTGAGGGTGTGGG - Intronic
954808687 3:53234901-53234923 AGCTTTGCAGGTGCAGGTGCAGG - Intronic
956713339 3:72057353-72057375 AGCCTAGCAGGTGGGGCTGAGGG + Intergenic
957957427 3:87206102-87206124 AGTTGAGCAGGTGGGTCTGAGGG + Intergenic
960420905 3:117444327-117444349 AGGTGAGCAGGTGCAGCAGGTGG + Intergenic
962687737 3:137863519-137863541 AGGTGAGCAGGTGCAGGAGCTGG - Intergenic
963907831 3:150787920-150787942 AGCTTATCTGGTGCAGCTGCAGG + Intergenic
964790863 3:160452517-160452539 AGCTGAGCAGCTACGGCAGAAGG + Intronic
966863219 3:184241996-184242018 AGCACAGCAGGTGTAGCTGCAGG - Exonic
967254357 3:187574707-187574729 AGGTGAGCAAGTGAGGCTGATGG - Intergenic
968034481 3:195534815-195534837 ACCTGAGCAGCTAGGGCTGCAGG + Intronic
968568482 4:1327292-1327314 AGAGCAGCAGGTGCAGCTGCTGG - Intronic
968598516 4:1497804-1497826 AGCTGAGCAGCTGCAGGAGCTGG + Intergenic
968646907 4:1745767-1745789 AGCTGAGCAGCTGCACCTGCAGG - Intergenic
968813825 4:2811677-2811699 AGCAGAGCTGGTGTGGTTGCGGG + Intronic
969506823 4:7593358-7593380 AGCAGAGCAGGTGAGGCGGGAGG + Intronic
972285351 4:37642864-37642886 GGCTGAACAGGTGCAGGTGCCGG + Intronic
974226624 4:59053391-59053413 CTCTGAGCTGGTGGGGCTGCTGG + Intergenic
974505967 4:62772335-62772357 AGGCGAGCAGGTGCGGGAGCTGG - Intergenic
976454047 4:85224901-85224923 AACAGAGCTGGTGAGGCTGCAGG - Intergenic
978663522 4:111155042-111155064 AGCTGCCCAGCTGTGGCTGCTGG - Intergenic
982798639 4:159674439-159674461 AGGTGAGCAGGTGCAGAAGCCGG - Intergenic
984772126 4:183445004-183445026 AGATGAGCTGCTGCAGCTGCCGG - Exonic
984852402 4:184165427-184165449 AGGGGAGCAGGTGCTGGTGCGGG - Intronic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985197930 4:187452014-187452036 TGCAGGGCGGGTGCGGCTGCAGG - Intergenic
985678902 5:1245938-1245960 AGCTGAGCAAGCGCGGCCACCGG - Exonic
986309648 5:6542806-6542828 TGCTGAGCAGGTGTGGCTGAAGG - Intergenic
986880290 5:12161611-12161633 AGCTGTGGAGGTGAGACTGCTGG + Intergenic
990693647 5:58391107-58391129 CGCTGAGCAGGTGGGACTACAGG + Intergenic
991492566 5:67197167-67197189 AGCTCAGCAGGTGCCACTGAAGG - Intergenic
992226040 5:74620506-74620528 AGATGGGCAGGTGCAGCAGCTGG + Intergenic
996065171 5:119071418-119071440 AGCTGAGCGGCTCCGGCTCCAGG + Intronic
996831440 5:127744455-127744477 CACTGAGCAGGGGCTGCTGCTGG + Intergenic
997303563 5:132823456-132823478 CACGGAGCAGGAGCGGCTGCAGG - Exonic
997605641 5:135174035-135174057 ACCTGAGCAGGTGGTGCTGGGGG - Exonic
998042894 5:138964391-138964413 AGCTGAGCAGGAGGGCATGCTGG + Intronic
998250233 5:140547639-140547661 AGCCGACCACGTGCAGCTGCTGG - Intronic
998394059 5:141806826-141806848 AGTTGGGCAGGTGCGGCGGGGGG + Intergenic
1000633304 5:163615502-163615524 AGCTGACCAGTAGCAGCTGCTGG + Intergenic
1001318780 5:170663434-170663456 AGCTGGCCTGGTGCAGCTGCTGG - Intronic
1002051855 5:176575812-176575834 GGATGAGGAGGTGCAGCTGCAGG + Exonic
1002159684 5:177307835-177307857 GGCCGAGCGGGAGCGGCTGCGGG - Exonic
1002546047 5:179945964-179945986 AGCTGGGCAGATGCGGCCGTGGG - Intronic
1002571073 5:180139710-180139732 GGCTGAGCAGGTGGGCATGCAGG + Intronic
1005168957 6:22959010-22959032 AGCTGAGCACATGGGGCTGTGGG - Intergenic
1005916849 6:30359826-30359848 AGCTCAGCAGCAGCAGCTGCTGG - Intergenic
1006201423 6:32295550-32295572 AGCTAGGCAGGTGCGGAGGCAGG - Intronic
1006443247 6:34064987-34065009 AACTGTCCAGGAGCGGCTGCAGG - Intronic
1009946622 6:70347989-70348011 ACCTGAGTGGGTGCCGCTGCTGG - Intergenic
1010681971 6:78808416-78808438 AGCTGTGCTGCTGCGGCTGCTGG - Intergenic
1011755738 6:90496778-90496800 AGCTGTGCAGCTGCGGCTGCTGG + Intergenic
1013048513 6:106510637-106510659 AGCCGAGGAGGTGTGGCTGAAGG - Intergenic
1015919828 6:138255643-138255665 AGCCGAGCTGGTCCGGCTGGTGG + Exonic
1016250248 6:142032184-142032206 AGCTGAGTAGTTGGGACTGCAGG - Intergenic
1016569039 6:145492276-145492298 AGGTGAGCAGGTGCAGGAGCTGG + Intergenic
1018122315 6:160647286-160647308 AGCTGAGGAGTTTGGGCTGCGGG + Intronic
1018959919 6:168441053-168441075 AGCGGAGCGGGCGCGGCAGCGGG + Intergenic
1019306955 7:340159-340181 AGAGGAGCAGGTTCTGCTGCAGG + Intergenic
1019458417 7:1144653-1144675 ACCTGGGCTGGTGCGGCCGCGGG - Intergenic
1019524849 7:1476305-1476327 AGCTGAGCAGCAGGGGCAGCCGG + Exonic
1023822781 7:43989103-43989125 AACTGAACAGGGGCAGCTGCTGG - Intergenic
1024253155 7:47521360-47521382 TACTGAGCAGGTGCGGCAGCTGG - Intronic
1025619564 7:63156441-63156463 ACCTGAGCAGCTGGGGCTACAGG - Intergenic
1026603828 7:71799049-71799071 TGCTGAACATGTGCTGCTGCTGG - Intronic
1027277107 7:76568491-76568513 GGCTGAGCATGTGGGGCAGCAGG + Intergenic
1028834006 7:95354238-95354260 ACCTGAGCAGCTGGGACTGCAGG - Intergenic
1029016173 7:97317054-97317076 AGATGAGCAGGTGCAGGTCCTGG - Intergenic
1029751045 7:102542518-102542540 AACTGAACAGGGGCAGCTGCTGG - Intronic
1029768998 7:102641629-102641651 AACTGAACAGGGGCAGCTGCTGG - Intronic
1029855558 7:103512819-103512841 AGCTGAACAGGTGCAGCCGGAGG + Intronic
1030231546 7:107213110-107213132 CTCTGATCAGGTGCCGCTGCTGG - Intronic
1030907059 7:115198915-115198937 AGCTGAGCAGTTCCTGCTACTGG - Intergenic
1032072138 7:128814694-128814716 GGATGAGCAGGGGCGGCTTCTGG + Exonic
1032587934 7:133164734-133164756 AGAAGAGCAGGTGGTGCTGCCGG + Intergenic
1033071700 7:138209101-138209123 AGGTGAGCAGGTGCAGGAGCTGG + Intergenic
1033422600 7:141217003-141217025 AGCTGGGCTGGTGCTGCTCCTGG + Intronic
1033529224 7:142246061-142246083 TGCTGAGCTGCTGCGGCTGACGG - Intergenic
1034172104 7:149070692-149070714 GGCTGAGCAGCTGCGCCTTCAGG + Exonic
1034457029 7:151176147-151176169 AGCGGAGCAGGCGCGGTGGCAGG + Exonic
1035199117 7:157248801-157248823 AGCTCCGCAGGAGGGGCTGCCGG - Intronic
1035816747 8:2549758-2549780 GGCAGAGCAGGTGCTGGTGCAGG + Intergenic
1036750112 8:11438323-11438345 AGCTGATGAGTTGGGGCTGCTGG - Intronic
1037748863 8:21667075-21667097 AGCAGAGCAGCTCGGGCTGCGGG + Intergenic
1038963588 8:32548348-32548370 AGCTGAGCGGCGGCGGCTGCCGG + Intronic
1039503488 8:38034666-38034688 AGGTGAGCAGGTAGGGCTGCAGG + Intronic
1039892536 8:41694977-41694999 AGCAGAGCAGATGCGGCTGCAGG + Intronic
1041510741 8:58652494-58652516 AGCTCAGCATGTGTGGCTGCAGG - Intronic
1041716522 8:60937431-60937453 AGGTGATCAAGTGTGGCTGCAGG - Intergenic
1042732465 8:71952195-71952217 AGCTGAGCAACTGCAGCTGGGGG - Intronic
1043844454 8:85148679-85148701 TGCTGACCAGCTGGGGCTGCCGG - Intergenic
1044863044 8:96541974-96541996 AGGTGAGCATGTGATGCTGCTGG + Intronic
1045357218 8:101399952-101399974 TGCTGAGCATGTGTGGCTGCAGG - Intergenic
1046748034 8:117896967-117896989 AGCTGAGCAAGTGGGGGTGAAGG - Intronic
1049392832 8:142380960-142380982 AGCTGTGCAGGTGTGTGTGCAGG - Intronic
1049399507 8:142418676-142418698 GGGTGAGCAGGTCTGGCTGCAGG - Intergenic
1049583202 8:143421916-143421938 AGCTGGGCAGAGGCGGCGGCTGG + Intronic
1049584490 8:143426623-143426645 ACCTTAGCAGCTGCTGCTGCTGG - Intronic
1049697191 8:143990108-143990130 CGCCGAGCGGGTGCGGGTGCGGG + Exonic
1049733838 8:144192827-144192849 GGCTGAGCAGCTGGGGCAGCTGG + Intronic
1050829167 9:9989850-9989872 AGGTGAGCAGGTGCAGGAGCTGG - Intronic
1055551001 9:77432255-77432277 GGCTGAGCAGGTCCGCATGCAGG + Intronic
1055818284 9:80232498-80232520 AGCAGGGCAGCTGAGGCTGCTGG + Intergenic
1056768415 9:89459615-89459637 GGCTGAGCAGGGACAGCTGCAGG - Intronic
1057486194 9:95486490-95486512 TGCTGACCAGGTGCGTCTGATGG - Intronic
1057568658 9:96186778-96186800 ACCTGAGCTGGGCCGGCTGCGGG - Intergenic
1060583130 9:124770258-124770280 AGCTGAGCAGGGGCGGAGACCGG + Intronic
1060727683 9:126016901-126016923 AGGAGAGCAGGTGCGGCTTCGGG + Intergenic
1062209994 9:135358361-135358383 AGCCTAGGAGGTGGGGCTGCCGG + Intergenic
1062390994 9:136333828-136333850 TGCTGCGGAGGTGTGGCTGCGGG - Intronic
1062718367 9:138022552-138022574 AGCTGTGCTGGTGCTGCAGCAGG + Intronic
1186185170 X:7013712-7013734 AGATGGGCAGGTGCGGGGGCTGG + Intergenic
1188554726 X:31398920-31398942 AGGTGAGCAGGTGCAGCAGCTGG + Intronic
1188818111 X:34739960-34739982 AGATGAGCAGGTGCCACTTCAGG - Intergenic
1192360360 X:70435065-70435087 AGCTGAGAGGTTGGGGCTGCAGG - Intergenic
1194620346 X:96163119-96163141 AGGTGAGCAGGTGCAGGAGCCGG - Intergenic
1195244465 X:102983070-102983092 AGCTGAGCAGGCAGGGCTGAAGG + Intergenic
1197031210 X:121818391-121818413 AGCTGAGCAGATGCAGATGCTGG - Intergenic
1197775593 X:130116883-130116905 AACTGAGCAGGGTGGGCTGCAGG - Intergenic
1199337099 X:146630822-146630844 AGGTGAGCAGGTGCAGGAGCTGG - Intergenic
1200216669 X:154371193-154371215 AGCGCAGCAGGCGCGGCTCCGGG - Exonic
1201416275 Y:13751877-13751899 AGCTGAGCAGCAGCTGCTCCGGG - Intergenic
1201637961 Y:16146260-16146282 AGGTGAGCAGGTGCAGGAGCTGG - Intergenic
1202199170 Y:22328943-22328965 TCCTGAGCAGCTGCGACTGCAGG + Intronic
1202367001 Y:24172453-24172475 AGAGGAGCAGGAGAGGCTGCTGG + Intergenic
1202503780 Y:25497670-25497692 AGAGGAGCAGGAGAGGCTGCTGG - Intergenic