ID: 1152748332

View in Genome Browser
Species Human (GRCh38)
Location 17:82051403-82051425
Sequence GGCCCCCGGAGGCTCCGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 231}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152748332_1152748346 6 Left 1152748332 17:82051403-82051425 CCCGCGCGGAGCCTCCGGGGGCC 0: 1
1: 0
2: 0
3: 18
4: 231
Right 1152748346 17:82051432-82051454 GGGCCTAGACCCTGGGAGGCGGG 0: 1
1: 1
2: 1
3: 35
4: 331
1152748332_1152748343 2 Left 1152748332 17:82051403-82051425 CCCGCGCGGAGCCTCCGGGGGCC 0: 1
1: 0
2: 0
3: 18
4: 231
Right 1152748343 17:82051428-82051450 GGCCGGGCCTAGACCCTGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 211
1152748332_1152748351 14 Left 1152748332 17:82051403-82051425 CCCGCGCGGAGCCTCCGGGGGCC 0: 1
1: 0
2: 0
3: 18
4: 231
Right 1152748351 17:82051440-82051462 ACCCTGGGAGGCGGGGCGGGTGG 0: 1
1: 1
2: 17
3: 211
4: 1547
1152748332_1152748347 7 Left 1152748332 17:82051403-82051425 CCCGCGCGGAGCCTCCGGGGGCC 0: 1
1: 0
2: 0
3: 18
4: 231
Right 1152748347 17:82051433-82051455 GGCCTAGACCCTGGGAGGCGGGG 0: 1
1: 0
2: 2
3: 20
4: 252
1152748332_1152748345 5 Left 1152748332 17:82051403-82051425 CCCGCGCGGAGCCTCCGGGGGCC 0: 1
1: 0
2: 0
3: 18
4: 231
Right 1152748345 17:82051431-82051453 CGGGCCTAGACCCTGGGAGGCGG 0: 1
1: 0
2: 2
3: 10
4: 213
1152748332_1152748349 10 Left 1152748332 17:82051403-82051425 CCCGCGCGGAGCCTCCGGGGGCC 0: 1
1: 0
2: 0
3: 18
4: 231
Right 1152748349 17:82051436-82051458 CTAGACCCTGGGAGGCGGGGCGG 0: 1
1: 0
2: 15
3: 92
4: 489
1152748332_1152748355 20 Left 1152748332 17:82051403-82051425 CCCGCGCGGAGCCTCCGGGGGCC 0: 1
1: 0
2: 0
3: 18
4: 231
Right 1152748355 17:82051446-82051468 GGAGGCGGGGCGGGTGGGCGTGG 0: 1
1: 0
2: 30
3: 304
4: 2098
1152748332_1152748350 11 Left 1152748332 17:82051403-82051425 CCCGCGCGGAGCCTCCGGGGGCC 0: 1
1: 0
2: 0
3: 18
4: 231
Right 1152748350 17:82051437-82051459 TAGACCCTGGGAGGCGGGGCGGG 0: 1
1: 0
2: 3
3: 55
4: 783
1152748332_1152748353 15 Left 1152748332 17:82051403-82051425 CCCGCGCGGAGCCTCCGGGGGCC 0: 1
1: 0
2: 0
3: 18
4: 231
Right 1152748353 17:82051441-82051463 CCCTGGGAGGCGGGGCGGGTGGG 0: 1
1: 0
2: 3
3: 60
4: 686
1152748332_1152748342 -1 Left 1152748332 17:82051403-82051425 CCCGCGCGGAGCCTCCGGGGGCC 0: 1
1: 0
2: 0
3: 18
4: 231
Right 1152748342 17:82051425-82051447 CTGGGCCGGGCCTAGACCCTGGG 0: 1
1: 0
2: 3
3: 24
4: 262
1152748332_1152748356 21 Left 1152748332 17:82051403-82051425 CCCGCGCGGAGCCTCCGGGGGCC 0: 1
1: 0
2: 0
3: 18
4: 231
Right 1152748356 17:82051447-82051469 GAGGCGGGGCGGGTGGGCGTGGG 0: 1
1: 0
2: 4
3: 90
4: 854
1152748332_1152748357 22 Left 1152748332 17:82051403-82051425 CCCGCGCGGAGCCTCCGGGGGCC 0: 1
1: 0
2: 0
3: 18
4: 231
Right 1152748357 17:82051448-82051470 AGGCGGGGCGGGTGGGCGTGGGG 0: 1
1: 0
2: 5
3: 95
4: 1436
1152748332_1152748341 -2 Left 1152748332 17:82051403-82051425 CCCGCGCGGAGCCTCCGGGGGCC 0: 1
1: 0
2: 0
3: 18
4: 231
Right 1152748341 17:82051424-82051446 CCTGGGCCGGGCCTAGACCCTGG 0: 1
1: 0
2: 5
3: 31
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152748332 Original CRISPR GGCCCCCGGAGGCTCCGCGC GGG (reversed) Intronic
900172142 1:1274241-1274263 GGCCCCTGGAGGCTCAGTGGAGG + Intergenic
900283870 1:1890376-1890398 GGCGGCCGGAGCCCCCGCGCGGG - Intronic
900344481 1:2204590-2204612 GGCTCCCGGGGGCTCGGCGGCGG - Intronic
900633690 1:3651838-3651860 AGCCCCCAGAGGCTCTCCGCGGG + Intronic
901045448 1:6393223-6393245 GGCCGCTGCAGGCTGCGCGCGGG + Intronic
901616174 1:10541478-10541500 CGCCCCCAGAGGCTCTGCACTGG - Intronic
904822672 1:33256012-33256034 GGCCCCGGGAGCCCCCGCGCTGG + Intergenic
905807025 1:40884537-40884559 GGACCCCGGCTGCACCGCGCTGG + Intergenic
905848718 1:41257415-41257437 TGCCCCTGGAGGCTCTGTGCAGG + Intergenic
905850550 1:41271170-41271192 GGCCAACGGAGGCTCAGCCCTGG + Intergenic
906315934 1:44786432-44786454 GACCCCCAGAGGCTCCCGGCGGG + Intronic
907200964 1:52726574-52726596 GCCTCCTGGAGCCTCCGCGCCGG + Exonic
910892270 1:92030218-92030240 GGCCGCCGGAAGGTCTGCGCCGG - Exonic
911615553 1:100006654-100006676 GGCCCCTGGATGGTCTGCGCAGG + Intronic
913047941 1:115089528-115089550 GCCCCCCGGAGGCCCCGCCCCGG - Intergenic
913163993 1:116168551-116168573 GCCGCCCGGAGGGTCCGCGGTGG + Intergenic
914069778 1:144276705-144276727 CGCCCCCCGCGCCTCCGCGCTGG + Intergenic
914109377 1:144689649-144689671 CGCCCCCCGCGCCTCCGCGCTGG - Intergenic
918040755 1:180912772-180912794 GGCCCCGCGGGGCTCCGGGCGGG + Intergenic
918423519 1:184386889-184386911 GGCCTCCGCAGGCCCCGCCCCGG + Intergenic
920704926 1:208243920-208243942 GGCACCCGGAGGCGCCGAGGGGG + Exonic
922116450 1:222618300-222618322 GGCCCCGGGGGTCTCCGCGGCGG + Intronic
924172446 1:241356762-241356784 CGCCCCCGGGAGCCCCGCGCCGG - Intronic
1064443006 10:15370737-15370759 GGCCCCCGAAGCCTCCGCCCGGG + Intronic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1069495731 10:68901562-68901584 GGCCCTCGGATGCTCCGGCCCGG - Intronic
1069769502 10:70888410-70888432 GGACCCCGGCGGCTCCGCAGGGG + Intronic
1070032644 10:72692311-72692333 CGCGCCCGGAGGCTCCGGGGAGG + Intronic
1070768138 10:79068144-79068166 GCGCCCCGGGCGCTCCGCGCCGG + Intergenic
1072654295 10:97319647-97319669 GGCCCCCGGGGGCGCCGCTGCGG + Exonic
1073208260 10:101779994-101780016 GGCCTCTAGAGGCTCCGGGCGGG - Intronic
1074586033 10:114768322-114768344 GGGCCCCGGCGGCTCGGGGCGGG - Intergenic
1074815410 10:117138220-117138242 GGCCGCCGAAGCCTCCCCGCGGG - Intronic
1075587132 10:123666245-123666267 GGCCGCCTGAGGCTCCGGGGTGG + Intergenic
1075693704 10:124418631-124418653 TGCCCCCTGAAGCTGCGCGCCGG + Intronic
1076543348 10:131228148-131228170 GGCCTCCGGAGTCTCCCCTCCGG + Intronic
1076821681 10:132942768-132942790 GGACGCCGGGGGCTCCGCGCGGG + Intronic
1077205028 11:1337769-1337791 GTCCCCCGGAGGCGCCCCCCAGG - Intergenic
1077214811 11:1390830-1390852 GGCCACCGGGGCCTCCGGGCAGG + Intronic
1078246091 11:9574123-9574145 GGCTCCGTGGGGCTCCGCGCGGG - Exonic
1080551294 11:33376018-33376040 AGCGCGCGGTGGCTCCGCGCGGG + Intergenic
1083551035 11:63590412-63590434 GGGCCACGGAGGCTCAGAGCTGG + Intronic
1084165590 11:67373427-67373449 GACCCCCGGGAGCCCCGCGCCGG - Intronic
1087672913 11:101128182-101128204 GGCGCCCGGGCGCTCCCCGCTGG - Exonic
1089676254 11:120092003-120092025 GGGCCCCAGAGGCTCTGAGCAGG + Intergenic
1091049436 11:132354154-132354176 GGGCCAAGGAGGCTCCGCACAGG + Intergenic
1094218594 12:27970600-27970622 GGCTCCCGGATCCGCCGCGCCGG - Intronic
1100679832 12:96907255-96907277 GGCCGCGGCCGGCTCCGCGCTGG - Intronic
1101023108 12:100573527-100573549 GACGCCCGGAGGCGCAGCGCTGG + Intergenic
1101940710 12:109097564-109097586 GGCCCGCGCATGCTCCGAGCGGG - Exonic
1102028285 12:109725899-109725921 GGCGCCCGGATGGTGCGCGCCGG + Intronic
1102518001 12:113463151-113463173 GGCCCCCGGGGGCCGAGCGCGGG + Exonic
1102967750 12:117141236-117141258 GGATCCCGGAGGCGCCACGCTGG + Intergenic
1103321931 12:120097171-120097193 GGCCCACGGAGGTTCCTCGGGGG - Exonic
1103926918 12:124428259-124428281 GGCCCTCGAAGGCTGGGCGCCGG - Intronic
1104049457 12:125186179-125186201 GGCTCCCGGAGCCTCCCGGCCGG + Intergenic
1104049619 12:125186702-125186724 AGCCCCCGGCGGCTACGCCCGGG - Intergenic
1104854622 12:131895937-131895959 GGCCCCTGGAGACTCCACCCTGG + Intronic
1105000588 12:132687641-132687663 TGCCCCCGGCGGCACGGCGCTGG + Exonic
1106050591 13:26186572-26186594 GGCCCCGTCAGGGTCCGCGCTGG - Intronic
1106232301 13:27830096-27830118 GTCCGCCCCAGGCTCCGCGCCGG - Intergenic
1106956226 13:34942246-34942268 CCCCCCCGGAGGCTGTGCGCAGG + Intergenic
1114117632 14:19638171-19638193 GGCCTGCGGAGGCTCAGCCCTGG - Intergenic
1115754569 14:36518889-36518911 GGCGCCGGCAGGCTGCGCGCTGG - Intronic
1122847727 14:104509983-104510005 GGCCACAGGAGGCTCCGTGAAGG + Intronic
1122922887 14:104887218-104887240 GGACCCGGGAGGCACCGCCCTGG + Exonic
1123059186 14:105586776-105586798 GGCCCCCCGAGGCTCAGGGCAGG + Intergenic
1123083517 14:105707007-105707029 GGCCCCCCGAGGCTGAGGGCAGG + Intergenic
1123110955 14:105866653-105866675 GGCCCCCTCAGGCACCGTGCGGG + Intergenic
1123688873 15:22820689-22820711 AGGCCACGGAGGCTCCCCGCAGG - Intronic
1126800833 15:52295454-52295476 GGGCCGCGGAGGCGCCGCGGAGG - Intronic
1128354008 15:66911677-66911699 GGGCCCCGGAGGCTCGAAGCTGG + Intergenic
1128455230 15:67828117-67828139 GCCCCTAGGAGGCCCCGCGCCGG + Exonic
1129228033 15:74181138-74181160 GGCCACAGGAGGCACAGCGCAGG + Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1130486091 15:84399192-84399214 GCCCCCCTGAGGCCCCGCCCCGG + Intergenic
1130656355 15:85794547-85794569 GGCACCCCGCGGCTCCGCGAGGG - Intronic
1132365143 15:101251615-101251637 GCCGCCCGCAGGCCCCGCGCCGG + Exonic
1132549700 16:549266-549288 GTCACCCTGAGGCTCTGCGCAGG + Exonic
1132599010 16:765652-765674 GGCCACCCGAGGCTCAGCCCAGG + Intronic
1137244165 16:46689170-46689192 GACCGCGGGAGGCTACGCGCGGG - Exonic
1138179232 16:54931040-54931062 GGCCCGCGGCGCCTCCTCGCTGG - Exonic
1139373510 16:66482467-66482489 GGCTCCAGGAGGCTGCACGCAGG - Intronic
1141695144 16:85615562-85615584 GGTCACCGGAGGCTCCTGGCGGG - Intronic
1141709395 16:85689116-85689138 GGCCGAGGGAGGCTGCGCGCCGG + Intronic
1141910095 16:87053073-87053095 GGCCCTCGGAGGCGCTGTGCAGG - Intergenic
1143370217 17:6434869-6434891 GCTCCCCGGAGGCCCAGCGCTGG + Intronic
1143548512 17:7614600-7614622 GGCCCCCGGCGTCTCCCCGGAGG + Exonic
1143595102 17:7909343-7909365 GGGCCGCGGCGGCCCCGCGCGGG + Intronic
1144185142 17:12789738-12789760 TCGCCCGGGAGGCTCCGCGCGGG + Exonic
1144812597 17:18010174-18010196 GGCACCAGGAGACTCCGCGTTGG + Intronic
1148770827 17:50064932-50064954 GGCCCCAGGCAGCTCAGCGCTGG + Intronic
1148782451 17:50129622-50129644 GGCCGCGGGGGGCTCCGGGCGGG + Exonic
1149660335 17:58331428-58331450 GGCCCCCCGAGGGCCCGCCCTGG + Intergenic
1149993969 17:61397322-61397344 GGCCCCGGGGGGCGCCTCGCGGG - Intergenic
1151683531 17:75634143-75634165 AGCACGTGGAGGCTCCGCGCTGG + Intronic
1152364276 17:79845894-79845916 AGGCCCAGGAGGCTCCGTGCAGG + Intergenic
1152426432 17:80220792-80220814 CGCCCCCGGCCGCTCCGCTCCGG - Intronic
1152722511 17:81929880-81929902 GGCCCCCGCAGGCACCTCCCGGG + Intergenic
1152748332 17:82051403-82051425 GGCCCCCGGAGGCTCCGCGCGGG - Intronic
1152834368 17:82519852-82519874 GCCCCCGGGCCGCTCCGCGCGGG - Exonic
1152861432 17:82698660-82698682 GGCCCCGAGAGGCGCCGCGCGGG + Exonic
1153514476 18:5891332-5891354 GGCCCCGGGGGGCGCCGCGGCGG + Exonic
1153855088 18:9137199-9137221 GGGCCCCGGCGGACCCGCGCCGG - Intronic
1156253452 18:35374077-35374099 GGCCCCATGAGGCTCTGAGCCGG - Exonic
1159772101 18:72558358-72558380 GGCACCCGGAAGCTCCACACTGG + Intronic
1160575243 18:79849349-79849371 GCCCCCCAGAAGCTCAGCGCTGG - Intergenic
1160691148 19:461109-461131 AGCCCCCCGCGGCTGCGCGCTGG - Intergenic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1160864318 19:1250329-1250351 CGCCGCCGGGGGCCCCGCGCCGG - Exonic
1160896922 19:1407516-1407538 CGCCCCCGGAGACCCCGTGCGGG + Intergenic
1160987986 19:1848380-1848402 GGGCCCGGGCGGCTCCGGGCCGG - Exonic
1161015501 19:1980920-1980942 TGCTCCCGGAGGCTGCGCCCCGG + Exonic
1161027358 19:2042731-2042753 GGCCCTAGGAGACTCCGGGCGGG + Intronic
1161190204 19:2950410-2950432 GGCCTCCGGAGCCTCCTCCCTGG + Intergenic
1161678765 19:5668177-5668199 GGCCCCGGGAGGCCCCGCCTGGG - Exonic
1161925289 19:7294623-7294645 GACCCCCGGAGGCGCCCCACAGG + Intergenic
1162370303 19:10274811-10274833 GCCCCGGGGAGGCTCCGTGCTGG + Exonic
1162916271 19:13876082-13876104 GGCCCCCTGAGGCTAGGTGCTGG - Intronic
1163725177 19:18919303-18919325 GGCCTCCGGCGGCTCCGGGGAGG - Exonic
1164639244 19:29812327-29812349 GGCCCCGGGAGGCGACGGGCCGG + Intronic
1164977089 19:32581400-32581422 GGCGCCCAGAGCCTCCGCCCCGG - Intronic
1165300207 19:34963836-34963858 CGCCCCCGGAGCCTGCGCCCCGG - Exonic
1165428331 19:35757589-35757611 GCCCCCCGGGGGCCGCGCGCTGG + Intronic
1165749881 19:38253210-38253232 GGCCCCGGGAGCCTCGGGGCTGG + Intronic
1165787970 19:38473676-38473698 CGCCCCCGGGGGCACCCCGCAGG + Exonic
1166834535 19:45659247-45659269 GGCCCCCGCCTGCTCCCCGCAGG + Intergenic
1167621952 19:50565720-50565742 GGCCCCAGCAGGCACCCCGCGGG + Intronic
1168246926 19:55117190-55117212 GGCCCCGGGAGACGCCGGGCGGG + Intronic
925184737 2:1839294-1839316 GGCACCCGGAGGCGCTGCGATGG + Exonic
927159218 2:20242386-20242408 GGCCCCCGGACCCGCGGCGCAGG + Intergenic
927713969 2:25341263-25341285 GCCCCGCGCAGGCTCCGCGGCGG - Intronic
932342996 2:70978574-70978596 GGCCCCCGGGGGCGGGGCGCCGG + Intronic
934180088 2:89612062-89612084 CGCCCCCCGCGCCTCCGCGCTGG + Intergenic
934290379 2:91686322-91686344 CGCCCCCCGCGCCTCCGCGCTGG + Intergenic
934764051 2:96870394-96870416 GTCCCCCGAAGACTCCGGGCGGG + Intronic
937083854 2:119158129-119158151 TGCACCCGGGGGCTCCCCGCCGG + Exonic
938338830 2:130522465-130522487 GTCCCCAGGAGGCCCCTCGCCGG + Intronic
938351008 2:130598285-130598307 GTCCCCAGGAGGCCCCTCGCCGG - Intronic
938414631 2:131093813-131093835 GGCGCCCGCAGCCTCCGCACTGG - Intergenic
942449446 2:176099977-176099999 GGCGCCCGCAGGCTGCGCGGGGG - Exonic
944114297 2:196171112-196171134 GGTTCCCTGGGGCTCCGCGCGGG - Intronic
945045284 2:205776328-205776350 GGCCGCCGGGGGCGCCGTGCTGG + Intronic
946191527 2:218010320-218010342 GTCTCCCGGAGGCTCAGCCCCGG + Intergenic
947506791 2:230713451-230713473 GGCCCCCGGGCGCCCCACGCCGG - Intronic
947592884 2:231395443-231395465 CGCCCCGGGAGGCTCCGCCAGGG + Intergenic
948457697 2:238114466-238114488 TGCTCCCGGAGGCTCTGGGCTGG - Intronic
948572403 2:238925978-238926000 GGTCCCAGGAGGCTCTGCGAAGG - Intergenic
1171452828 20:25248009-25248031 CGCCCCCCGAGGCCCCGCCCCGG + Intergenic
1171983710 20:31644920-31644942 GTCTCCCTGAGGCTCCGCCCTGG + Exonic
1172534750 20:35664674-35664696 GGCCTCCGAAGGCCCCGCCCCGG + Intronic
1175847021 20:62064838-62064860 GGCCGCCGGGGGCCCCGCGGGGG - Exonic
1175947704 20:62566430-62566452 AGCCCCCGGAGGCTCCCAGGAGG - Intronic
1176077417 20:63254643-63254665 GGCCCCTGGGGGCTTCGCGCCGG + Intronic
1176111116 20:63411274-63411296 GGCCCTGGGTGGCTCCGAGCAGG - Intronic
1179882639 21:44299979-44300001 CGCCCCCGGCGCCTCCTCGCAGG - Intergenic
1180465118 22:15603915-15603937 GGCCTGCGGAGGCTCAGCCCTGG + Intergenic
1181574928 22:23787513-23787535 GGGCCCCAGTGGTTCCGCGCTGG + Intronic
1181595871 22:23914050-23914072 GTCCCCAGCATGCTCCGCGCGGG + Intergenic
1181811411 22:25405579-25405601 GCCGCCGGGAGGCTCGGCGCGGG + Intergenic
1183683767 22:39350206-39350228 GGCCCCCGGCGGCGGCGCGGCGG + Intronic
1184481896 22:44752796-44752818 GGGACCCGGAGGCTGCGCGCCGG - Intronic
1184568861 22:45309846-45309868 GGTCCCCGGAGGCCCCGCCCCGG - Intronic
1184728174 22:46358094-46358116 AGCCCAGGGAGGCTCCGTGCTGG - Intergenic
1184760019 22:46538512-46538534 GGCCCCCCGTGGTTCCCCGCAGG - Intergenic
1184898776 22:47430721-47430743 GGTCCCCGGAAGCTCAGAGCAGG - Intergenic
1185038018 22:48489764-48489786 GGCCCCGGCAGGCGCCCCGCGGG + Intronic
1185259360 22:49853314-49853336 GTCCCCCGGGGGGGCCGCGCGGG + Intergenic
949896006 3:8768119-8768141 GGCCCCCGGCGGCGCGGCGCTGG + Exonic
953436424 3:42881089-42881111 GGCCCCCGAAGCCTCAGCGAGGG + Intronic
961478131 3:127161313-127161335 GGCCACCGTAGTCTCCCCGCTGG + Intergenic
964786301 3:160399927-160399949 GGCGCCCGGGAGCTGCGCGCGGG - Intronic
964819663 3:160755879-160755901 CACCCCCGGAGGGACCGCGCGGG + Intronic
966000531 3:174943898-174943920 TGCCCCTGGAGGCTCTGCCCAGG + Intronic
966684902 3:182682975-182682997 GGAACCTGGGGGCTCCGCGCTGG + Intergenic
967284757 3:187858270-187858292 GGCCCCTGGAAGCTCCGCCGGGG - Intergenic
968503775 4:962791-962813 GGCCACAGAAGGCTCCGGGCAGG + Exonic
968509462 4:989021-989043 GGGCCCCGTAGTCTCGGCGCAGG + Exonic
969529392 4:7722331-7722353 GGACCCAGGAGGCTGCTCGCTGG - Intronic
969577302 4:8043883-8043905 GGCTCCCAGAGGCTCCAGGCGGG + Intronic
975022119 4:69502696-69502718 GGCCCCTGGAGGCTCTGTCCAGG - Intronic
981920236 4:150078538-150078560 GGCCCCCGGGGGAGTCGCGCGGG - Intronic
983904646 4:173169852-173169874 GGCGCCCGGCCGCCCCGCGCCGG + Intronic
985535763 5:465011-465033 GGCTCCCGGTGGCTCCCCGGAGG - Intronic
985797209 5:1972141-1972163 GGCCCCCGGAGCCCCCGAGCAGG - Intergenic
992487547 5:77210746-77210768 GGTCCCCGGAGGCTCGGCGGGGG + Intronic
998339843 5:141407918-141407940 GGCGCCCAGAGGCTCCGTGCGGG - Intronic
1000328323 5:160188562-160188584 GGTCCCCGGAGGGTCGGTGCAGG - Intronic
1002021890 5:176368766-176368788 GGGCCCGGGAGGCTCTGAGCTGG + Intronic
1002089534 5:176796317-176796339 GGTCCCTGGAGGCTCCACTCTGG + Intergenic
1002195004 5:177496837-177496859 GGCCGCCCGAGGCTCCAGGCTGG - Intronic
1003279463 6:4679123-4679145 GGCCCCAGGAGGCCCCACCCTGG + Intergenic
1006461808 6:34163705-34163727 GGCCCGGGGAGGCTCGGTGCAGG - Intergenic
1006496369 6:34426130-34426152 GGCCACCCCAGGCTCCCCGCGGG - Intergenic
1007614482 6:43172013-43172035 GGCCACCGGGGGCTACGGGCCGG + Exonic
1009964791 6:70566912-70566934 GACTCCCCGAGCCTCCGCGCAGG - Exonic
1010703165 6:79077288-79077310 GGCCCCCGCAGACCCCGCGCCGG + Intronic
1016923215 6:149317064-149317086 GGCGGCCGGCGGCGCCGCGCGGG - Intronic
1019164020 6:170087360-170087382 GGGACCCGGAGGCCCCGCGGTGG + Intergenic
1019164196 6:170087785-170087807 GGGACCCGGAGGCCCCGCGGTGG + Intergenic
1019266423 7:119792-119814 GGCCCCCGAAGGCTCGACCCCGG - Intergenic
1019379134 7:712252-712274 GGTCCCGGGAGGGTCCTCGCCGG - Intronic
1019516383 7:1442029-1442051 GACCCCAGGAGGCTGCGAGCAGG + Intronic
1019536140 7:1530854-1530876 GGCGCGCGGCGGCTCCTCGCGGG - Exonic
1019959338 7:4445549-4445571 GGGCCCCAGAGGCTCAGCCCTGG + Intergenic
1021845338 7:24757558-24757580 GGCCGCCGGAGGCTGCGGGAGGG + Intronic
1025756820 7:64352022-64352044 GGCCCCTGGAGGCTCTGTCCAGG + Exonic
1028841640 7:95435081-95435103 GGGCCGCGGAGGCTCCGCCCTGG + Exonic
1029458435 7:100682559-100682581 GGCACCTGGAGGCTCCGGGATGG - Intronic
1029715137 7:102321560-102321582 GGCCTCCGGGGGCTCCTCGGCGG - Exonic
1029813908 7:103074971-103074993 GGGCCCCGGCGTCTCCGCGTGGG + Exonic
1032074497 7:128830172-128830194 GGCCCCCGGTGCCGCCGCGCTGG - Intergenic
1033099845 7:138460613-138460635 GGCCCTCGGCGGCGCCGAGCGGG + Exonic
1034911649 7:155002938-155002960 CGGCCCGGGAGGCTCCGCGGCGG + Exonic
1035171112 7:157017990-157018012 GGCCCCCGGAGCCGCAGCCCGGG + Intergenic
1035635851 8:1143680-1143702 GGCCCACGGATGCTACACGCTGG + Intergenic
1036601362 8:10263647-10263669 GGCCCCTTGAGGCTTCGTGCTGG + Intronic
1037482106 8:19314227-19314249 GGCCCCGGGAGGGTCCGGGCTGG + Intronic
1037816832 8:22116898-22116920 GGCCCCCGGAGAGGCCGTGCTGG - Exonic
1038002425 8:23403442-23403464 GGACCCCGGGGGCTGCGCCCGGG - Intronic
1040501441 8:48008628-48008650 GGCCGCCGGGGCCTCGGCGCCGG - Intronic
1040564851 8:48556183-48556205 GGACCGCGGAGGCGCCGGGCGGG - Intergenic
1041726587 8:61023707-61023729 GCCGCCGGGAGGCTGCGCGCCGG + Intergenic
1042591521 8:70402848-70402870 GGGCCCCGGCGGCGCCGAGCCGG - Intronic
1043472593 8:80578043-80578065 GGCCCCCGGAGGGGAGGCGCCGG - Intergenic
1047235904 8:123041913-123041935 GGCCCCAGGAGGCCCAGCGGCGG - Intronic
1047782776 8:128123396-128123418 GGCCCCGGGAGGCTGCACGGTGG + Intergenic
1048009399 8:130443799-130443821 GGCCCCGAGCCGCTCCGCGCCGG + Intergenic
1049009789 8:139879625-139879647 GGCCCCCGCAGGCTCTCCCCAGG + Intronic
1049212299 8:141392299-141392321 GGCCTCCTGAGGCTCGGCCCCGG - Intronic
1049554704 8:143276035-143276057 GCCCGCCGGCCGCTCCGCGCTGG - Exonic
1057516836 9:95729181-95729203 GGCTCCCGGAGGGTCCGGGCTGG - Intergenic
1057665235 9:97039343-97039365 GGCGCCCGGGGGCTGCGCGGAGG + Intronic
1059769926 9:117415126-117415148 GGCCCCGGGAGGCGGCGCGGGGG - Intergenic
1060176281 9:121499603-121499625 GGTCCCCGGAGGCCACGAGCAGG - Intergenic
1060974191 9:127755015-127755037 GACCCCCGGCCGCTCCGCCCGGG - Intronic
1061818329 9:133208940-133208962 GGCCCCCCGAGGCCCAGGGCCGG - Intronic
1062242122 9:135546418-135546440 GGCCCCCCGAGGCCCAGGGCCGG + Intronic
1062395201 9:136349989-136350011 GTCCCCAGGAGGCTCCTCGGTGG - Intronic
1062542058 9:137045884-137045906 GGCCGGCGGCGGCTCCACGCAGG + Exonic
1062619710 9:137414816-137414838 GGCCCCCGTGGGCTCCACGTAGG + Intronic
1185610788 X:1392673-1392695 AGCCGCCGCAGGCTTCGCGCGGG - Exonic
1186426183 X:9465510-9465532 GGACCCTGGAGGGTCAGCGCGGG - Intronic
1190322280 X:49186263-49186285 GGGTCCCGGAGGCGCCGCTCCGG - Exonic
1196227936 X:113188649-113188671 TGCCCCCGGAGGCTCTGTCCAGG + Intergenic
1198683402 X:139204518-139204540 GGCCTCCCTGGGCTCCGCGCGGG + Intronic
1199772571 X:150983977-150983999 GGCCACCGGGCGCTCCGCGACGG - Intronic
1200100951 X:153688893-153688915 GACCCCCGGAGCCGCCGCGGAGG + Intronic
1200142148 X:153907685-153907707 TGCCCCCGGCGGCTACCCGCTGG - Exonic
1201416495 Y:13752932-13752954 CGCACCCAGAGCCTCCGCGCAGG - Intergenic