ID: 1152748415

View in Genome Browser
Species Human (GRCh38)
Location 17:82051638-82051660
Sequence CGGGGCCGGGGCGGGGGTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2210
Summary {0: 2, 1: 6, 2: 39, 3: 351, 4: 1812}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152748396_1152748415 16 Left 1152748396 17:82051599-82051621 CCGCAGGCTGGGGGCAGCGGGCC 0: 1
1: 0
2: 2
3: 61
4: 563
Right 1152748415 17:82051638-82051660 CGGGGCCGGGGCGGGGGTCCGGG 0: 2
1: 6
2: 39
3: 351
4: 1812
1152748405_1152748415 -5 Left 1152748405 17:82051620-82051642 CCGGGACGGGGGCGCGCGCGGGG 0: 1
1: 1
2: 10
3: 68
4: 488
Right 1152748415 17:82051638-82051660 CGGGGCCGGGGCGGGGGTCCGGG 0: 2
1: 6
2: 39
3: 351
4: 1812

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152748415 Original CRISPR CGGGGCCGGGGCGGGGGTCC GGG Exonic
Too many off-targets to display for this crispr