ID: 1152748509

View in Genome Browser
Species Human (GRCh38)
Location 17:82051983-82052005
Sequence GCGCGGGGGCGCGGAGGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 802
Summary {0: 1, 1: 2, 2: 19, 3: 105, 4: 675}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152748509_1152748527 3 Left 1152748509 17:82051983-82052005 CCCGGGCCTCCGCGCCCCCGCGC 0: 1
1: 2
2: 19
3: 105
4: 675
Right 1152748527 17:82052009-82052031 CCGCCACTGGGGCCGGGCTGAGG 0: 1
1: 1
2: 4
3: 27
4: 302
1152748509_1152748529 12 Left 1152748509 17:82051983-82052005 CCCGGGCCTCCGCGCCCCCGCGC 0: 1
1: 2
2: 19
3: 105
4: 675
Right 1152748529 17:82052018-82052040 GGGCCGGGCTGAGGTCGAGCAGG 0: 1
1: 0
2: 0
3: 25
4: 288
1152748509_1152748521 -3 Left 1152748509 17:82051983-82052005 CCCGGGCCTCCGCGCCCCCGCGC 0: 1
1: 2
2: 19
3: 105
4: 675
Right 1152748521 17:82052003-82052025 CGCCCCCCGCCACTGGGGCCGGG 0: 1
1: 0
2: 3
3: 24
4: 251
1152748509_1152748530 13 Left 1152748509 17:82051983-82052005 CCCGGGCCTCCGCGCCCCCGCGC 0: 1
1: 2
2: 19
3: 105
4: 675
Right 1152748530 17:82052019-82052041 GGCCGGGCTGAGGTCGAGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 206
1152748509_1152748535 21 Left 1152748509 17:82051983-82052005 CCCGGGCCTCCGCGCCCCCGCGC 0: 1
1: 2
2: 19
3: 105
4: 675
Right 1152748535 17:82052027-82052049 TGAGGTCGAGCAGGGGCGCGGGG 0: 1
1: 0
2: 1
3: 12
4: 131
1152748509_1152748533 19 Left 1152748509 17:82051983-82052005 CCCGGGCCTCCGCGCCCCCGCGC 0: 1
1: 2
2: 19
3: 105
4: 675
Right 1152748533 17:82052025-82052047 GCTGAGGTCGAGCAGGGGCGCGG 0: 1
1: 0
2: 0
3: 26
4: 252
1152748509_1152748520 -4 Left 1152748509 17:82051983-82052005 CCCGGGCCTCCGCGCCCCCGCGC 0: 1
1: 2
2: 19
3: 105
4: 675
Right 1152748520 17:82052002-82052024 GCGCCCCCCGCCACTGGGGCCGG 0: 1
1: 0
2: 3
3: 26
4: 201
1152748509_1152748534 20 Left 1152748509 17:82051983-82052005 CCCGGGCCTCCGCGCCCCCGCGC 0: 1
1: 2
2: 19
3: 105
4: 675
Right 1152748534 17:82052026-82052048 CTGAGGTCGAGCAGGGGCGCGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1152748509_1152748513 -10 Left 1152748509 17:82051983-82052005 CCCGGGCCTCCGCGCCCCCGCGC 0: 1
1: 2
2: 19
3: 105
4: 675
Right 1152748513 17:82051996-82052018 GCCCCCGCGCCCCCCGCCACTGG 0: 1
1: 0
2: 3
3: 87
4: 578
1152748509_1152748517 -8 Left 1152748509 17:82051983-82052005 CCCGGGCCTCCGCGCCCCCGCGC 0: 1
1: 2
2: 19
3: 105
4: 675
Right 1152748517 17:82051998-82052020 CCCCGCGCCCCCCGCCACTGGGG 0: 1
1: 0
2: 6
3: 55
4: 359
1152748509_1152748515 -9 Left 1152748509 17:82051983-82052005 CCCGGGCCTCCGCGCCCCCGCGC 0: 1
1: 2
2: 19
3: 105
4: 675
Right 1152748515 17:82051997-82052019 CCCCCGCGCCCCCCGCCACTGGG 0: 1
1: 0
2: 3
3: 47
4: 384
1152748509_1152748531 14 Left 1152748509 17:82051983-82052005 CCCGGGCCTCCGCGCCCCCGCGC 0: 1
1: 2
2: 19
3: 105
4: 675
Right 1152748531 17:82052020-82052042 GCCGGGCTGAGGTCGAGCAGGGG 0: 1
1: 0
2: 1
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152748509 Original CRISPR GCGCGGGGGCGCGGAGGCCC GGG (reversed) Exonic