ID: 1152748683

View in Genome Browser
Species Human (GRCh38)
Location 17:82052587-82052609
Sequence AGGGAGCCCCGGTGGGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152748670_1152748683 13 Left 1152748670 17:82052551-82052573 CCGAGGACAGGGACTCAGTGCCA 0: 1
1: 1
2: 4
3: 23
4: 256
Right 1152748683 17:82052587-82052609 AGGGAGCCCCGGTGGGCCCGGGG 0: 1
1: 0
2: 3
3: 25
4: 263
1152748677_1152748683 -7 Left 1152748677 17:82052571-82052593 CCAAGCGCAGGAGGGGAGGGAGC 0: 1
1: 0
2: 7
3: 64
4: 442
Right 1152748683 17:82052587-82052609 AGGGAGCCCCGGTGGGCCCGGGG 0: 1
1: 0
2: 3
3: 25
4: 263
1152748667_1152748683 29 Left 1152748667 17:82052535-82052557 CCTGCTGCTCTGCTGGCCGAGGA 0: 1
1: 0
2: 3
3: 74
4: 1742
Right 1152748683 17:82052587-82052609 AGGGAGCCCCGGTGGGCCCGGGG 0: 1
1: 0
2: 3
3: 25
4: 263
1152748665_1152748683 30 Left 1152748665 17:82052534-82052556 CCCTGCTGCTCTGCTGGCCGAGG 0: 1
1: 0
2: 2
3: 65
4: 1619
Right 1152748683 17:82052587-82052609 AGGGAGCCCCGGTGGGCCCGGGG 0: 1
1: 0
2: 3
3: 25
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152748683 Original CRISPR AGGGAGCCCCGGTGGGCCCG GGG Intronic
900299585 1:1970061-1970083 AGGAAGCCCAGTGGGGCCCGTGG + Intronic
900321865 1:2088443-2088465 AGGGAGCCCTGCTGGGTCCCAGG - Intronic
900371007 1:2332184-2332206 AGGCAGCCCCGCTGGGCACCTGG - Intronic
900532211 1:3160191-3160213 GGGGATCCCCGGTGAGGCCGCGG + Intronic
901069117 1:6508466-6508488 AGGCAGCCCCAGTGGGTCAGGGG + Intronic
901828599 1:11878761-11878783 AGGAAGCCCGGGTGGGCGAGGGG - Intergenic
902371069 1:16007076-16007098 AGGCAGCCCAGGTGGGACCTGGG + Exonic
902438847 1:16416091-16416113 AGGGAGCCCCTGCAGGCTCGGGG - Intronic
903885666 1:26539774-26539796 ATGGAGCCCCGGTGTGCCTTAGG - Intronic
904399739 1:30248238-30248260 AGGTAGCCCTGGTGGGCCCAGGG + Intergenic
904490716 1:30857265-30857287 AGGGAGCCCCAGGTGGCCTGAGG - Intergenic
904600052 1:31668165-31668187 AGGCAGTCCTGGGGGGCCCGTGG + Exonic
905168703 1:36098145-36098167 AGGGACCCCTGGGGGCCCCGTGG + Exonic
905169024 1:36098988-36099010 AGGGAGGCCGGGGGGGCCGGGGG + Exonic
906925912 1:50116457-50116479 TGGGAGCCCCGGTGTGCCGTGGG + Intronic
912869019 1:113286320-113286342 AGGGAGTCCCAGAGGGCCTGAGG + Intergenic
915409255 1:155688144-155688166 AGGGATCCGCGGTGGACCCAGGG - Exonic
916522945 1:165581620-165581642 GGGGAGTCCCGGAGGCCCCGGGG + Intergenic
919220680 1:194624916-194624938 ATGGAGCCCCAGTGGGGGCGGGG + Intergenic
920060400 1:203223305-203223327 AGGCAGCCCCTGTGAGCCCCAGG + Intronic
922933765 1:229408904-229408926 AGGCAGCCCAGGCGGGCCCATGG - Intergenic
1066429825 10:35340976-35340998 AGGGAGACCAGGTGGGCTGGGGG - Intronic
1066659907 10:37728656-37728678 GTGCAGCCCCAGTGGGCCCGGGG + Intergenic
1069878937 10:71579847-71579869 AGGGAACACCGGTGAGCCCTGGG + Intronic
1069896252 10:71681954-71681976 AGGGAGGCCTGGAGGGCCCAAGG + Intronic
1069992193 10:72322693-72322715 AGGCAGCCTCAGTGGGCCCCGGG + Intergenic
1070327626 10:75398938-75398960 AGGGCTGCCCGGTGCGCCCGAGG + Exonic
1070826254 10:79392029-79392051 AGGGAGGCCGGGTGGGCCTGTGG - Intronic
1070954383 10:80454621-80454643 CGAGAGCCGCGGCGGGCCCGGGG + Intronic
1071211600 10:83348194-83348216 AGGGAGCCTCTTTGGGCCCTGGG + Intergenic
1072290658 10:93961616-93961638 AGGGAGCCCTGGAGGGGGCGGGG - Intergenic
1073509712 10:104035315-104035337 TGGGATCCCTGGTGGACCCGGGG + Exonic
1075334438 10:121598271-121598293 CGCGAGCCCCGGGGGCCCCGAGG - Exonic
1075419726 10:122291829-122291851 GGGCAGCCCAGGTGGGCCAGCGG - Intronic
1075948914 10:126460706-126460728 AGGGGGCCTCGGTGGGACCTGGG - Intronic
1076452642 10:130567388-130567410 AGGGAGCCCCGGCAGCCCTGTGG - Intergenic
1076550300 10:131273600-131273622 AGGGAGCCTCGGTCAGCCCAGGG - Intronic
1076726635 10:132416955-132416977 AGGGTGCCCCGGAGGGCCTGAGG - Intronic
1076821771 10:132943223-132943245 GGGGAGCCCCGGGGGGCAGGTGG - Intergenic
1077047423 11:552619-552641 AGGGACCCTCCGTGGGCCCCAGG - Exonic
1077055799 11:592420-592442 AGGGAGACCCTCTGGGCCTGTGG + Intronic
1077266582 11:1653728-1653750 ACGGAGCCCAGATGGGCCTGGGG + Intergenic
1077293797 11:1814669-1814691 AGGCGGCCCCTGTGGGCCCCCGG - Intergenic
1077352739 11:2100432-2100454 AGTGAGCTCCGGTGGGGCTGAGG - Intergenic
1077550392 11:3197593-3197615 AGGGATCCCCGTGGGGCCTGTGG + Intergenic
1078108637 11:8374208-8374230 AGTGAGCCCCTGTGGACCCTGGG - Intergenic
1078822027 11:14892065-14892087 TGGCAGCCCCGGCGGCCCCGGGG + Exonic
1078827207 11:14940578-14940600 CTGGAGCCCAGGTGGGCCAGTGG + Intronic
1079555425 11:21753360-21753382 AGGGAGCCCCTGCCGGCCCCGGG - Intergenic
1081502630 11:43681119-43681141 AGGGAGCCAGGAGGGGCCCGCGG - Intronic
1081911892 11:46705126-46705148 AGGGAGCCCTGGTTGGCCAGGGG - Exonic
1083267868 11:61555287-61555309 GGGGGGCGACGGTGGGCCCGGGG - Intronic
1083275510 11:61594893-61594915 AGGGAGCCCCGGGAGCCCGGAGG - Intergenic
1083667863 11:64285328-64285350 AGGGAGGACCGTAGGGCCCGTGG + Intronic
1083741502 11:64713789-64713811 AGGGAGCCCCGCTCAGCGCGGGG - Exonic
1083776411 11:64896256-64896278 TGGGAGCCCCTGTGGGCCTCGGG + Intronic
1084165473 11:67373115-67373137 AGGGAGGCCGGGGGAGCCCGAGG - Intronic
1084546936 11:69819289-69819311 GGGGAGCCCCGCGGGGCTCGGGG + Intergenic
1085507148 11:77067061-77067083 CGGGAGCCCGGCTGGACCCGCGG + Exonic
1088604208 11:111512790-111512812 CGGGGGTCCCGCTGGGCCCGGGG + Intergenic
1090980165 11:131712987-131713009 AGGGAGCCCCGGTTGGTCAGGGG + Intronic
1091280537 11:134379415-134379437 AGAGAGCCCGGCTGGGCCAGGGG + Intronic
1091616357 12:2053625-2053647 AGGGAGCCCCGGCGAGGCGGCGG - Intronic
1092659462 12:10722931-10722953 AGGAAACCCCGGTGGGGACGCGG - Exonic
1094025667 12:25958390-25958412 AGCGTGGCCCGGTGGGCCCGAGG + Intergenic
1094711719 12:32970636-32970658 AGGGAGCCTCGATGGCCCCTGGG + Intergenic
1094853691 12:34393566-34393588 GGGCTGCCCCCGTGGGCCCGAGG - Intergenic
1096775851 12:53963705-53963727 AGGAAGCCCCGGTGGCCGCGAGG + Intergenic
1103741774 12:123096082-123096104 AGGGAGCCAAAGTGGCCCCGTGG + Intronic
1104846960 12:131851640-131851662 ACGGAGGCCCTGTGGGCCGGCGG - Exonic
1105021851 12:132822018-132822040 AGGTGGCACCAGTGGGCCCGGGG + Exonic
1108559461 13:51628205-51628227 AGGGAGCCCAGTGGGGCCTGAGG - Intronic
1108648118 13:52450439-52450461 AGGGACCCCCGGTGGGCGCGCGG - Intronic
1112402282 13:99086981-99087003 AGGGAGCCCGGCTGCGCTCGAGG + Intergenic
1113620337 13:111758041-111758063 AGGGAGCCTGCGTGGGCCCCAGG + Intergenic
1114493760 14:23119007-23119029 AGGGGGCCGAGCTGGGCCCGGGG - Exonic
1114519050 14:23321579-23321601 AGGGGGCCCCGGGGGGCGCAGGG + Exonic
1118206509 14:63728121-63728143 AGGGAGCCCGGGTGGGGGCGGGG - Intergenic
1118473155 14:66093833-66093855 AGGGAGTCCAGGTGGGCCTGAGG - Intergenic
1118992664 14:70809808-70809830 AGGGAGCTGCGGCGGGCCAGTGG - Intergenic
1121313590 14:92948204-92948226 AGTGAGTGCCGGTGGGCCCAGGG + Intronic
1122137713 14:99644577-99644599 GGGGAGCCCCAGTGGGTCCTGGG + Intergenic
1122211749 14:100178198-100178220 AGGGAGTCCCAGAGGGCCAGGGG + Intergenic
1122270586 14:100567075-100567097 ACGGAGACCCTGTGGGCCAGGGG + Intronic
1122352217 14:101102866-101102888 AGGGAGCCCTGGGGGGATCGGGG + Intergenic
1122413813 14:101539102-101539124 AGGGATCCCAGAGGGGCCCGGGG - Intergenic
1122689736 14:103526467-103526489 AAGCAGCCCCTGTGGGCCCCAGG - Intergenic
1123008857 14:105337696-105337718 AGGGGGCTCAGGTGGGCCCTGGG - Intronic
1123706524 15:22955060-22955082 AGGGACCCACGGTGGGCAGGAGG + Intronic
1129177365 15:73849618-73849640 AGGGAGTCCAGGGGGGCCTGTGG - Intergenic
1129524342 15:76204406-76204428 AGGGAGGCCAGGTGGGCTCCTGG - Exonic
1131510106 15:93045035-93045057 AGGGCGCCCAGGAGGGGCCGGGG + Exonic
1131827348 15:96331954-96331976 AGGGCGCCCCGGGTGGCTCGGGG - Exonic
1131831063 15:96354655-96354677 AGGGTGCCCCGTCGGACCCGTGG - Intergenic
1131941280 15:97568664-97568686 AGGGATCCCAGGTGGGCACCTGG + Intergenic
1132145456 15:99426602-99426624 ACGGAGCACAGGTGTGCCCGAGG + Intergenic
1133171020 16:3982525-3982547 AGGGAGCCAGGCTGGTCCCGAGG + Intronic
1134846532 16:17445533-17445555 ACGCAGCCCAGGTGAGCCCGGGG - Intronic
1135407392 16:22207731-22207753 AGGGAGCTTCTGTGGGCCTGGGG - Intronic
1136147294 16:28322773-28322795 AGGCAGCCCCGATGGGCTCCAGG - Exonic
1136540144 16:30924165-30924187 AAGGAGCCCCCGTTGGCCTGGGG + Intronic
1139400237 16:66675537-66675559 AGGGAGCCCAGCAGGGCCAGGGG - Intronic
1140759724 16:78099889-78099911 AGGGGGCCGCAGTGGGGCCGCGG + Intronic
1141950564 16:87336527-87336549 AGGGAGCCCAGGTGAGGCGGGGG + Intronic
1142280550 16:89145601-89145623 TGGGAGCTCTGGTGGGCACGGGG - Intronic
1142486858 17:253110-253132 AGGGAACCACGGTGGGCTTGGGG + Intronic
1143031072 17:3967360-3967382 AGGGGGCCCGGGTGGGCATGAGG + Intergenic
1143634562 17:8156906-8156928 AGGGAGCCTCGGTGGGACCCAGG - Intronic
1143762087 17:9112171-9112193 AGGGAGCCCCAGTGGGGCCAAGG + Intronic
1144561733 17:16326026-16326048 AGGGAGCCCATGTAGGCCAGGGG + Exonic
1144625693 17:16843426-16843448 AGGGAGCCTCTGCGGGCCCCTGG + Intergenic
1144880738 17:18429294-18429316 AGGGAGCCTCTGCGGGCCCCTGG - Intergenic
1145151497 17:20515093-20515115 AGGGAGCCTCTGCGGGCCCCTGG + Intergenic
1145933949 17:28704281-28704303 AGTGAGCCCCGGTGGGCTGATGG - Intronic
1146162847 17:30569343-30569365 AGGGAGCCTCTGCGGGCCCCTGG + Intergenic
1146902943 17:36600100-36600122 AGGGAGCCCTGCAGGGCCAGGGG + Intronic
1150249232 17:63697093-63697115 AGGGCGCCCCGGTGGGACACAGG - Exonic
1150617916 17:66786239-66786261 AGGAAGGCACGGTGGCCCCGTGG - Intronic
1150634391 17:66902674-66902696 CGGGAGCCCAGGTGGGGCCAGGG + Intergenic
1151212774 17:72557152-72557174 AGGCAGCTCCTCTGGGCCCGCGG - Intergenic
1151724757 17:75877576-75877598 AGGGAGCCGGGTTAGGCCCGCGG - Intronic
1151761119 17:76103734-76103756 ACGGGGGCCCGGTGGGCCCGCGG - Exonic
1152208869 17:78992274-78992296 GGGGTGCCACGGTGGGCCGGAGG - Exonic
1152333596 17:79687094-79687116 AGGGACCCTCGGTGGTCCCCAGG - Intergenic
1152433942 17:80263870-80263892 AGGCAGCTCAGGTGGGGCCGAGG + Intronic
1152506461 17:80752293-80752315 AGGGAGGCCCCATGGGCCCTGGG - Intronic
1152590264 17:81208315-81208337 AGGGTGCTCCTGTGGGGCCGTGG - Intronic
1152623842 17:81379479-81379501 AGGGAGCCACAGTGAGCCCTGGG + Intergenic
1152627345 17:81393739-81393761 GGGGAGCTCCGGAGAGCCCGGGG - Intergenic
1152627430 17:81393969-81393991 GGGCTGCCCCGGTCGGCCCGCGG + Intergenic
1152748683 17:82052587-82052609 AGGGAGCCCCGGTGGGCCCGGGG + Intronic
1152809509 17:82374937-82374959 AGGTAGGCGCGGTGGGCGCGCGG - Exonic
1153270851 18:3319612-3319634 ATGGAGCCCCGGGGGGGCCGTGG - Intergenic
1154008801 18:10558570-10558592 AGTGAGTCCCTGTGGGCCAGAGG - Intergenic
1156489047 18:37485649-37485671 AGGGCGCGTCGGCGGGCCCGGGG - Intronic
1159948056 18:74458108-74458130 AGGGACGCCCTGTGGGCCCAGGG - Intergenic
1160390131 18:78523756-78523778 AGGGAGTCCTGGTGGCCCAGGGG + Intergenic
1160404811 18:78638129-78638151 AGGGCGCCCCGGCCGGCCTGGGG + Intergenic
1160835662 19:1123400-1123422 AGGGAGGGCCGGAGAGCCCGGGG - Intronic
1160889674 19:1370706-1370728 GGGGAGCCCCGAGGAGCCCGTGG + Exonic
1160966660 19:1749702-1749724 ACGGAGCCCGGGCGGGCGCGGGG + Intergenic
1161800886 19:6416302-6416324 GGGGAGCCCCGGGTGGCCCCTGG + Exonic
1162072005 19:8158574-8158596 AGGGAGCCACGGTGGGTTCTAGG + Intronic
1162404825 19:10467458-10467480 GGGGAGGCCCGGGAGGCCCGGGG - Exonic
1162716988 19:12640432-12640454 AGGATGGCCTGGTGGGCCCGGGG + Intergenic
1162806440 19:13140072-13140094 AGGGACCCCCAGTGGGCCGGCGG - Exonic
1162957382 19:14106978-14107000 AGGGGGCCCCGGGGAGCACGTGG + Intronic
1163251442 19:16128473-16128495 AGGGAGCCCTGATGGGACCTGGG + Intronic
1163416956 19:17192731-17192753 AGGAAGACCTGGTGGGCACGGGG - Exonic
1164137441 19:22427597-22427619 AGGGAGGGCTGGTGGCCCCGCGG - Intronic
1164845020 19:31424622-31424644 GGGGAGCCCTGGTGGGGCTGGGG - Intergenic
1165074927 19:33275416-33275438 AGGCAGCCCCTGTGGGGCAGGGG - Intergenic
1165204648 19:34172921-34172943 AGGGAGCCGCGGGGAGGCCGCGG - Intronic
1165448307 19:35868762-35868784 TGGGAGCCCCGGCGCGGCCGAGG + Exonic
1165760560 19:38319034-38319056 AGGGAGCCCTAGAGGGCCCTGGG - Intergenic
1166230969 19:41425715-41425737 AGGAAGCCTGGGTGGGCCTGGGG + Exonic
1166868168 19:45853746-45853768 AGGGAGCCCAGGGGGGCTCTGGG - Intronic
1166983982 19:46649046-46649068 AGGGGGCCCCGAAGGGACCGCGG + Exonic
1167238623 19:48330206-48330228 AAGAAGCGCCGGAGGGCCCGTGG - Intronic
1167244049 19:48363422-48363444 AGAGGGCCCGGGGGGGCCCGAGG + Exonic
1167383072 19:49149674-49149696 AGGGAGCCCCGGAGAGCCCAGGG - Exonic
1167594084 19:50418337-50418359 TGGAAGCCCCGGTGCGCCTGGGG - Intronic
1168315775 19:55484219-55484241 GGGGAGCCCCGCGGGGCCCGAGG - Exonic
1168320696 19:55507875-55507897 AGGGAGCCCGGGAGGTCCAGGGG + Intronic
1168722390 19:58561280-58561302 AGGGAAGCCCTGTGGGCCTGAGG - Intergenic
925640936 2:5985370-5985392 AAGGAGCCCCGGAGGCCCTGGGG - Intergenic
927684368 2:25160586-25160608 GGGGAGCCCCTGAGCGCCCGGGG + Intergenic
927698314 2:25252159-25252181 ACGGAGCCCCGGGGAGACCGGGG - Intronic
929583795 2:43101191-43101213 AGGGAGCCGGGGTGGGCAGGGGG + Intergenic
930117677 2:47732465-47732487 AGGGAGCCCCTGTAAGCCTGTGG - Intronic
930751701 2:54940754-54940776 AGGGTGCCCCAGTTGGCCCTGGG + Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
933700796 2:85254078-85254100 AGGAAGCCCAGCTGGGCACGGGG + Intronic
933728052 2:85437607-85437629 AGGGAGCACCGGGTGGCCGGCGG + Intergenic
934650569 2:96089249-96089271 AGGGAGCCCCGTTCCTCCCGGGG - Intergenic
937289988 2:120776348-120776370 AGGGAGGCCCAGTGGGCTCTGGG + Intronic
937982274 2:127622710-127622732 AGGGAGCCCCTGTGGGCTCGGGG - Intronic
942046141 2:172100555-172100577 GGGGCGCCCCGGTGAGCGCGGGG - Exonic
944920341 2:204406137-204406159 AGGCTGCCCCAGTGGGCCTGGGG + Intergenic
948515966 2:238504182-238504204 AGGGAGTCCAGCTGGGCCCTGGG + Intergenic
1171035410 20:21709325-21709347 AGGCGGCCACGGCGGGCCCGGGG - Exonic
1172208234 20:33179807-33179829 AGGGAGCCCCCGGGTGCCTGTGG - Intronic
1174188169 20:48721751-48721773 AGGGAGGCCCGCTGGGGCCGTGG + Intronic
1174561319 20:51432607-51432629 AGGGAGCCATGGTGGCCACGAGG + Exonic
1175853237 20:62104844-62104866 AGGGAGCCCAGGGGGGCCGGGGG + Intergenic
1175872497 20:62215127-62215149 AGGGGGCCCGGCTGGGCCCGAGG - Exonic
1175921866 20:62453859-62453881 AGGGACCTCCCGTGGGCCTGGGG + Intergenic
1176056535 20:63151846-63151868 AGGGAGCCGGGTGGGGCCCGGGG + Intergenic
1176067888 20:63208768-63208790 GGGCAGCTCTGGTGGGCCCGGGG - Intronic
1176103262 20:63374146-63374168 AGGGAGCCCGGGACGTCCCGGGG + Intronic
1176300550 21:5096979-5097001 AGGGAGCCCCTGGGGTCCTGTGG - Intergenic
1177157458 21:17513364-17513386 AGGGAGCCGCGCAGGGCGCGCGG + Intronic
1178162933 21:29939644-29939666 AGGGAACCCGCGTGGGACCGCGG + Exonic
1178696453 21:34796919-34796941 AGGAAGCCCAGGTGGGGCTGGGG + Intronic
1179816955 21:43912405-43912427 AGGCAGCCCCCGTGGGCACCAGG + Intronic
1179856493 21:44165002-44165024 AGGGAGCCCCTGGGGTCCTGTGG + Intergenic
1179905083 21:44418559-44418581 TGGGGGCTCCGGTGGGCCTGGGG + Intronic
1179951589 21:44711610-44711632 AGTGACCCCCGGGGGCCCCGCGG - Intergenic
1180085216 21:45505231-45505253 AGGGGGCCCTGGGGGGCCTGGGG - Exonic
1180253448 21:46605600-46605622 AGGCAGCCCCGTTGAGCCCAGGG - Intergenic
1181028724 22:20139989-20140011 AGGGATCCCCAGTGGGCAGGTGG + Intronic
1181030689 22:20147728-20147750 AGGCAGCCCCAGTGGGGCCCAGG - Exonic
1181056853 22:20264366-20264388 GGGGAGCCCAGCTGGGCCCCAGG + Intronic
1181313982 22:21960278-21960300 AGGGAGCCTCGGTGGGCCCTGGG + Intronic
1181626603 22:24126375-24126397 AGGGAGCCCTGATGGCCACGAGG + Intronic
1183453089 22:37906949-37906971 GGGGAGGCCCGGCGAGCCCGTGG - Intronic
1183678225 22:39311699-39311721 AGGGTGCACCTGTGGGCTCGGGG - Intergenic
1183788367 22:40045080-40045102 AGGGCGCCCCCGGGGGCGCGCGG + Intronic
1184096192 22:42317745-42317767 AGGGAGCCGAGGTGGGCACAGGG + Intronic
1185055538 22:48576763-48576785 GGTGAGCCCCGATGGGCGCGGGG - Intronic
1185194763 22:49462105-49462127 ATGGAGCCCAGGTGGGACAGAGG + Intronic
951906989 3:27715500-27715522 AGGGAGCCTAGGTGGGCCTAAGG + Intergenic
953983639 3:47425654-47425676 CGGGAGCCCCAGTGGGCCGGGGG - Intronic
954415033 3:50389138-50389160 CTGCAGCCCCGGTGGGCCTGGGG + Intronic
954707465 3:52488729-52488751 AGGGAGGCCCGGGGGGGGCGAGG - Intronic
955339058 3:58110809-58110831 TGGGAGGCCAGGTGGGCCTGAGG - Intronic
963042063 3:141077348-141077370 TGGGAGCCCCAGTGGGCGCCTGG + Intronic
964138320 3:153369833-153369855 TGGGAGCCCAGGGGGGCCGGGGG + Intergenic
968662088 4:1802854-1802876 AGGCAGCCCCGCCGGGCACGAGG - Intronic
968702102 4:2062101-2062123 AGGGGGCTCCGGTGGGCACACGG + Intronic
969682200 4:8649623-8649645 AGGGAGCCCCGCTGGCCTGGGGG - Intergenic
971479131 4:27098842-27098864 AGGGAGCCCTGGAAGGCCCCAGG + Intergenic
976146060 4:82043955-82043977 AGGGACCCCTGGCGGGCCTGGGG - Intronic
982260195 4:153488168-153488190 AGAGAGACCCTGTGGGCCTGTGG + Intronic
985593347 5:776450-776472 AGGGAGACCGGGTAGGCCCCTGG + Intergenic
994728511 5:103464410-103464432 AGGAAGCCCAGGTGGGCCGCAGG + Intergenic
999269348 5:150287460-150287482 AGGGAGCCCTGGTGTGGCCATGG - Intronic
999295651 5:150458135-150458157 TGGGAGCCCCTGTGTGCCCCAGG + Intergenic
999296991 5:150465927-150465949 AGGGAGCCCAGGTGGAGCCACGG + Intergenic
1001818703 5:174693063-174693085 AGGGGTCCCCGCTGGGCTCGGGG - Intergenic
1002299988 5:178252553-178252575 AGGGATCCCTGGTGGCCCTGGGG + Exonic
1002424522 5:179167341-179167363 CGGGAGCCCGGGTGCGGCCGCGG - Intronic
1004016384 6:11735820-11735842 AGGGAGCCACGGTAGGTCCTTGG - Intronic
1005954295 6:30652848-30652870 TGGGAGCCCTGGTGGCCCTGGGG + Exonic
1006298417 6:33180306-33180328 AGGGAGCCCTGCTCGGCCAGGGG + Exonic
1006577949 6:35059661-35059683 CTGGAGCCCCTGTGGGGCCGTGG - Intronic
1006806702 6:36793725-36793747 AGGGGCCTCCGGCGGGCCCGGGG - Intronic
1007644340 6:43369097-43369119 GGGGAGCCGCGACGGGCCCGAGG + Exonic
1016330446 6:142947304-142947326 AGAGAGCCCCGGTGTCCCCCGGG - Intergenic
1018125605 6:160679394-160679416 TGGGAGCCGCAGCGGGCCCGTGG - Intergenic
1018150247 6:160931061-160931083 TGGGAGCCGCAGCGGGCCCGCGG + Intergenic
1019120528 6:169800500-169800522 AGGGAGCCCAGGTCGGTCCGGGG - Intergenic
1019434035 7:1012593-1012615 AGGGAGCCACTGTGGCCACGAGG + Intronic
1019733202 7:2638524-2638546 AGGGAGCCCCGGGGGGTGTGGGG + Intronic
1023861657 7:44220586-44220608 AGGAAGCCCGGGTGGGCATGAGG - Intronic
1023951253 7:44847943-44847965 AGGGCGGCCGGGTGGGCCGGGGG - Intronic
1026828068 7:73596304-73596326 AAGGAGCCCAGGAGGGCCTGGGG + Intronic
1026890227 7:73977437-73977459 AGCCAGCCCCAGAGGGCCCGGGG - Intergenic
1029699919 7:102239603-102239625 AGGGAGCGCCGGTCGGCCCAGGG + Intronic
1032429036 7:131846044-131846066 AGGGAGCCAGGCTGGGCCAGTGG + Intergenic
1032490636 7:132321661-132321683 AGGGAGCCCCGGGGGACACGTGG + Intronic
1034243012 7:149624286-149624308 AGGAAGCCCCGGAGGGGCCAAGG + Intergenic
1034336353 7:150326080-150326102 AGGGATCCCTGGGGGGCCCCCGG - Intronic
1034430755 7:151040185-151040207 AGGAAGCCACGGTGGGGCGGGGG - Intronic
1034529659 7:151687911-151687933 AGGGAGCCCCGTTGGGGAGGAGG - Intronic
1034904211 7:154929689-154929711 AGGGAGGGCTGGTGGGCCAGAGG - Intronic
1034964397 7:155382558-155382580 AGGGAGCCCAGGGGAGCCCATGG + Intronic
1035315811 7:157997191-157997213 AGGCAGCCCCGCAGGGCACGTGG - Intronic
1035388105 7:158488260-158488282 AGGGAGCCCCAGGGGGTCCTAGG + Intronic
1035432098 7:158829788-158829810 AGGGTGCCCCGTGGGGCTCGAGG - Intronic
1036815168 8:11896978-11897000 AGTGAGCCCCGGTGTGGCTGAGG - Intergenic
1039458078 8:37721096-37721118 GGGGAGCCCAGGTGGGGACGAGG - Intergenic
1041044886 8:53880087-53880109 AGTGGGACCCGGTGGGGCCGCGG - Intronic
1045111591 8:98942209-98942231 AGGTGGCCCAGGAGGGCCCGCGG + Intronic
1046817139 8:118597185-118597207 AAGGAGCCCCCGTTGGCCCTAGG - Intronic
1048933966 8:139340093-139340115 TGGGAGCCCTGGTGGACACGTGG - Intergenic
1049189540 8:141279178-141279200 TGGGAGCCCCTGTGGCCTCGGGG + Intronic
1049194642 8:141308514-141308536 CGGGAGCCACGGTGCGCGCGGGG - Intergenic
1049222238 8:141433422-141433444 AGGGAGACGCTGGGGGCCCGAGG + Intergenic
1049756082 8:144311877-144311899 GGCGAGCCCCTGTGGGCCCAGGG + Intronic
1051892680 9:21959351-21959373 AGCCAGCCCCGCTGGCCCCGAGG + Intronic
1052647588 9:31255207-31255229 AGGGTGTCCTGGTGGGCCCACGG + Intergenic
1052651697 9:31311674-31311696 TGGGAGGCCCGGTGGGCAGGGGG - Intergenic
1052840578 9:33288937-33288959 AGGGACCCCCAGTGGGCCAGCGG - Intergenic
1057423063 9:94927585-94927607 AGGAAGCCCTGGTGGGCAAGGGG + Intronic
1057619108 9:96619427-96619449 CGGGAGCCTCGGCGGGCGCGCGG - Exonic
1058128285 9:101221455-101221477 AGGGAGTCCCTGTGAGCCAGAGG - Intronic
1059404856 9:114093254-114093276 AGGCAGGCCCAGTGGGCCAGGGG + Exonic
1060196082 9:121624206-121624228 GGGCAGCCCCGCTGGGTCCGTGG - Intronic
1060431203 9:123552607-123552629 AGGGAGCACAGGTGAGCCAGAGG + Intronic
1061194866 9:129102228-129102250 AGGGAGGCCAGGAGGGGCCGTGG - Intronic
1061621487 9:131813987-131814009 AGGGAGGCCCCGTGAGGCCGAGG + Intergenic
1061666018 9:132161527-132161549 GGGGCGTCCCGGCGGGCCCGTGG - Intergenic
1061937675 9:133867246-133867268 AGGGAGGCCTGGTGGGCACTGGG - Intronic
1061941596 9:133887016-133887038 AGGGAGAGCAGGAGGGCCCGGGG - Intronic
1062116570 9:134812600-134812622 AGGGGGACCCGGGGGGCCCTAGG - Exonic
1062292948 9:135805550-135805572 AGAGAGCAGCGGTGGGCCAGTGG - Intergenic
1062346982 9:136119365-136119387 TGCGAGGCCCGGTGGGCCGGCGG + Intergenic
1062502601 9:136857812-136857834 AGGGGGCCCCAGTGGGCTCAGGG + Intronic
1062578934 9:137221313-137221335 GGGGGGCCCCGGACGGCCCGTGG + Intronic
1200080345 X:153573131-153573153 AGGGACCCCCGGTGGCCACATGG - Intronic
1201291245 Y:12421786-12421808 AGGGGGCCGCGGTGGGCGAGGGG - Intergenic