ID: 1152749915

View in Genome Browser
Species Human (GRCh38)
Location 17:82057904-82057926
Sequence ACTTTTGCACACGCGTGCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152749915 Original CRISPR ACTTTTGCACACGCGTGCTG AGG Exonic
903663498 1:24993090-24993112 AGTTTTCCAGACGTGTGCTGGGG + Intergenic
915723368 1:158000290-158000312 ACTGTTGCACACTAGTGCTCTGG - Intronic
916261835 1:162850042-162850064 ATTTTTGAACACTCTTGCTGAGG - Intronic
1064493812 10:15886881-15886903 ACTATTTCATACACGTGCTGTGG - Intergenic
1065105153 10:22376015-22376037 ACTTTTGCACACTTGAACTGAGG + Intronic
1066989123 10:42495598-42495620 ACTTTTTCACACGGATGATGAGG + Intergenic
1072641859 10:97217036-97217058 ACTTCTGAACATGAGTGCTGAGG + Intronic
1075640449 10:124060568-124060590 ACCTTTGCACACTCCTGGTGGGG - Intronic
1084629302 11:70335760-70335782 ACTGTTACACACGCCTGCTCAGG - Intronic
1086801560 11:91183372-91183394 ACTTTTTCACAGGGTTGCTGTGG + Intergenic
1105855675 13:24370017-24370039 ACTATTGCATAGCCGTGCTGTGG + Intergenic
1120157947 14:81114613-81114635 ACCATTGCACAGGCGTGCTTAGG + Intronic
1121022806 14:90591832-90591854 ACTTTTGCATAAGGGAGCTGTGG + Intronic
1134836709 16:17367460-17367482 AATTTTGCACCCACTTGCTGTGG + Intronic
1138292900 16:55863136-55863158 ACTTGTGCACACCAGTGGTGTGG + Intronic
1138433234 16:56982699-56982721 ACCATAGCACACGTGTGCTGGGG + Intronic
1140919341 16:79522435-79522457 ACTTGTGCACACAAGTGGTGAGG - Intergenic
1147534732 17:41312293-41312315 ACTTTTGGACAGGCCTGCAGAGG + Intergenic
1149359677 17:55881061-55881083 AGTTTTGTCCACGGGTGCTGAGG + Intergenic
1152749915 17:82057904-82057926 ACTTTTGCACACGCGTGCTGAGG + Exonic
926310866 2:11675195-11675217 CCTTCTGCACACGCCTGTTGAGG - Intergenic
928312579 2:30222956-30222978 ACATTTCCACACGCTTGGTGAGG - Intergenic
932117953 2:69070182-69070204 CCTTTGGCACACCCGTGCGGTGG + Intronic
933455056 2:82509005-82509027 ACTTTTGCACAAGTTTGCTTGGG - Intergenic
936068791 2:109351690-109351712 ACTTTTGCACATGACTGCAGCGG + Intronic
941919024 2:170830754-170830776 AGTTTTGCACATGCTTCCTGGGG - Intronic
944306906 2:198189099-198189121 ACTGTAACACACGCCTGCTGGGG + Intronic
1169769696 20:9187360-9187382 ACATTTGCACACCCCTGCTGAGG + Intronic
1174361619 20:50032265-50032287 GTTTTTGCACACACGTGGTGGGG + Intergenic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1184842397 22:47059872-47059894 AGTTATGCAAACGAGTGCTGTGG + Intronic
954297779 3:49683782-49683804 ACTTTTGCCCATGGGTGCCGTGG - Exonic
957638181 3:82814757-82814779 AGTTTTGCTCAGGCCTGCTGGGG + Intergenic
966269851 3:178091251-178091273 ACTTTTCCACAGGGCTGCTGTGG - Intergenic
973008429 4:45042752-45042774 ACTTTTTCACACTGGTGATGAGG + Intergenic
979188635 4:117831544-117831566 ACTATAGCACACGCACGCTGGGG - Intergenic
989106214 5:37865510-37865532 ACGTGTGCACACGTGTGCAGAGG - Intergenic
998906128 5:146907261-146907283 ATTTTTGCACAAGCGAGCTGGGG + Intronic
1000749665 5:165078269-165078291 ACTTTTGCACCCTGGAGCTGAGG + Intergenic
1009463745 6:63945555-63945577 ACTTTTGCATATGTGTGGTGAGG - Intronic
1014127331 6:117791977-117791999 ACTCTTGCACCCGAGTGCAGGGG + Intergenic
1016457169 6:144243429-144243451 ACTTTTCCAGCCGGGTGCTGTGG - Intergenic
1017536025 6:155348959-155348981 ACTTTTGCATAGGGCTGCTGTGG + Intergenic
1023572855 7:41590511-41590533 ACTTCTGCGCAAGAGTGCTGGGG - Intergenic
1034450031 7:151132351-151132373 ACTTTAGCACATGTGTGCTCAGG + Intronic
1035165486 7:156987091-156987113 ACTTCTGCACACTTGTACTGTGG - Intergenic
1035927511 8:3744220-3744242 CCTGTTGCACACACCTGCTGCGG - Intronic
1041713233 8:60911622-60911644 ACTGTTGCAAATGCCTGCTGCGG + Intergenic
1046260914 8:111766232-111766254 ACTGTTACACACGCCTGTTGGGG + Intergenic
1189871942 X:45393492-45393514 ACTTTTGCACCAGTGTGCTCTGG - Intergenic
1191219881 X:57976797-57976819 AATTTTGCACACACATGCAGAGG + Intergenic
1194388793 X:93290577-93290599 ACTTTTGCACTCATGTGTTGGGG + Intergenic