ID: 1152750525

View in Genome Browser
Species Human (GRCh38)
Location 17:82060506-82060528
Sequence CCTCCACCAAGGACACCGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152750517_1152750525 19 Left 1152750517 17:82060464-82060486 CCGAGCGTCCACTGAGGGAGGAC 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1152750525 17:82060506-82060528 CCTCCACCAAGGACACCGAGGGG 0: 1
1: 0
2: 1
3: 15
4: 123
1152750518_1152750525 11 Left 1152750518 17:82060472-82060494 CCACTGAGGGAGGACACAGCTGA 0: 1
1: 1
2: 3
3: 28
4: 285
Right 1152750525 17:82060506-82060528 CCTCCACCAAGGACACCGAGGGG 0: 1
1: 0
2: 1
3: 15
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152750525 Original CRISPR CCTCCACCAAGGACACCGAG GGG Intronic
900140774 1:1138764-1138786 CCTCCCCCAAGCACAGCGTGTGG - Intergenic
900655305 1:3753956-3753978 CCCACACCCAGGACACCGTGTGG - Intronic
902401767 1:16161838-16161860 GCTCCACCAAGGCCACACAGTGG - Intergenic
902649326 1:17826380-17826402 CCTCCACCAAGGCCACAGTCTGG + Exonic
903603222 1:24556743-24556765 CCTCCCACAAGGATACCCAGAGG - Intronic
903828661 1:26162011-26162033 GCTCCACCACCGACACCGGGGGG - Exonic
904206236 1:28856996-28857018 CTACCACCGAGGACACCCAGGGG + Intronic
904296170 1:29521153-29521175 CCTGCACCAATCACACAGAGGGG - Intergenic
904410165 1:30320292-30320314 CCTGCACCAATCACACAGAGGGG + Intergenic
907124072 1:52033653-52033675 CGTCCACCACGTACACCGCGCGG + Exonic
907288287 1:53396106-53396128 CCTCCCCCAAAGACACTGAAGGG + Intergenic
909890225 1:80996046-80996068 CCTCCAGCAAGAACACAGACTGG + Intergenic
923202592 1:231726437-231726459 CCTCCACCAAGGAGGGAGAGAGG + Intronic
1064018290 10:11789735-11789757 CCTTCACCAAGGACACTTTGAGG + Intergenic
1067039111 10:42939702-42939724 CCTCCACCACGGCCACCCAGAGG + Intergenic
1070719500 10:78746440-78746462 CATCCACCAGGCACACAGAGAGG - Intergenic
1072854717 10:98935311-98935333 TCTCCAGCAAGGACACAGAATGG - Intronic
1075521964 10:123148516-123148538 CCTCCTCCGAGGACACGGACAGG - Exonic
1077280861 11:1744875-1744897 CCTACACCAAGGACGCGGGGTGG - Intronic
1078175293 11:8965101-8965123 CCTCCGCCTAGGACTCCAAGAGG + Intergenic
1081770811 11:45649714-45649736 CCTCCACCAGGCTGACCGAGGGG + Exonic
1082831274 11:57619506-57619528 CCTTCAACAATGACACCAAGTGG - Intergenic
1088742714 11:112780201-112780223 ACTGCACCAAGGACAGGGAGAGG - Intergenic
1096518816 12:52172730-52172752 CCCCCACCAACTACACAGAGAGG - Intronic
1097057433 12:56258320-56258342 GCTCCACCGGGGACACGGAGCGG + Exonic
1097810710 12:64015721-64015743 GCACCACACAGGACACCGAGGGG + Intronic
1102047964 12:109841486-109841508 CATGCACCAAGGACAGAGAGAGG - Intergenic
1103904639 12:124321098-124321120 CCTCCACCCAGGGCACAGAGTGG - Intergenic
1104764108 12:131315386-131315408 CACCCACCAAGGACACCCAGGGG + Intergenic
1104781157 12:131421466-131421488 TCTCCACCAAGGACGCAGATGGG - Intergenic
1104972614 12:132538883-132538905 CCACCTCCCAGGACAGCGAGAGG + Intronic
1112204738 13:97313574-97313596 CCTCCAAGAAGGGCACCAAGAGG - Intronic
1114461174 14:22886986-22887008 CCTCCACCAAGGAAGCCGGACGG - Exonic
1115782446 14:36784726-36784748 CCTCCACCAAAGAGAAGGAGAGG + Intronic
1121588010 14:95077111-95077133 CCTGTACCAAGGACACTGAAAGG - Intergenic
1122972537 14:105158238-105158260 CCTCCACCAAGTGCACGGGGTGG + Intronic
1124501042 15:30226070-30226092 CCTCCAGCACTGGCACCGAGGGG + Intergenic
1124742527 15:32312597-32312619 CCTCCAGCACTGGCACCGAGGGG - Intergenic
1128183047 15:65621793-65621815 CTTCCACCAGGGACACAGAGGGG - Intronic
1130885884 15:88092234-88092256 CCTCCAAGAATGACACTGAGCGG - Intronic
1132092661 15:98958418-98958440 CCGCCCCCAAGGACACAGATGGG + Exonic
1139673160 16:68505427-68505449 CCAGCACCAAGGACACCGACTGG - Intergenic
1139748775 16:69095766-69095788 CCTCCAACAAAGGCACCGATGGG + Intergenic
1141954080 16:87358618-87358640 CAGCCACCCAGGACACAGAGAGG + Intronic
1141959147 16:87392699-87392721 CCTCCTCCCAGGCCTCCGAGAGG - Intronic
1143512868 17:7405563-7405585 CCTCCATCCAGGGCTCCGAGTGG - Intronic
1147384085 17:40071604-40071626 CCTGCCCCAAGGAGGCCGAGGGG - Intronic
1147451784 17:40510235-40510257 CCTCCTCCAAGGACAGCGAGAGG - Intergenic
1151219709 17:72603353-72603375 CCTCCACCAAGGACTTTGGGGGG + Intergenic
1151734338 17:75929694-75929716 CCTCCACCTAGAAGACAGAGGGG - Intronic
1152209857 17:78997318-78997340 CCCCCACAAAGGACACCGGCTGG - Exonic
1152504531 17:80739147-80739169 CCGCCACCACGGAGGCCGAGGGG + Intronic
1152750525 17:82060506-82060528 CCTCCACCAAGGACACCGAGGGG + Intronic
1152861057 17:82697474-82697496 CCTCCGCCCAGGACTCAGAGCGG + Intronic
1155575716 18:27244368-27244390 TCTTCACCAAGGACACAAAGAGG - Intergenic
1156473079 18:37389586-37389608 CCTCCCCCAAGCATACCCAGAGG - Intronic
1158314056 18:56191137-56191159 CATTCACCAAGGACACTGAGTGG + Intergenic
1159000825 18:62973639-62973661 CCTCCACCAAGCTCTCTGAGAGG - Intronic
1160725715 19:616979-617001 CCTCCAGCACTGGCACCGAGAGG + Exonic
1160932345 19:1576735-1576757 CCTCCACCAGGCAGACAGAGGGG + Exonic
1161604234 19:5205780-5205802 CCGCCCCCAAGGAGACAGAGAGG - Exonic
1161915138 19:7222721-7222743 CCTCCACCAAGAGCAAGGAGTGG - Intronic
1163509735 19:17727475-17727497 CCTGCTCAAAGGACACCGACAGG - Exonic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1164655511 19:29918244-29918266 CCTCCACCGATGACACTGAGAGG + Intergenic
1166297475 19:41896142-41896164 CATCCACCCAGGACACACAGGGG + Intronic
1166917696 19:46206870-46206892 CATCCACCCATGACAGCGAGTGG + Intergenic
925481280 2:4277026-4277048 CCTCTCCCAAGGGCACCAAGTGG + Intergenic
926616131 2:14998462-14998484 CCTCACCCAAGGACACCCTGAGG - Intergenic
928220788 2:29401257-29401279 CCTCCACCAAGGACAGAAAGAGG - Intronic
929096056 2:38264066-38264088 CCATCAGCAAGGACACCGGGAGG + Intergenic
929282740 2:40100115-40100137 CCACCACAAAGGACACTGAAAGG + Intronic
943051747 2:182921535-182921557 CCTGCACCAAGAGCACCAAGAGG + Intronic
944303236 2:198149043-198149065 CATCTAGCAAGGACACCCAGTGG - Intronic
945000044 2:205339760-205339782 CATGCAACAAGGACACCGACCGG + Intronic
946578123 2:221098344-221098366 CATTCACCAAGGACAGGGAGTGG - Intergenic
1169900515 20:10547884-10547906 CCTCCACAAAGGCCACCTGGTGG + Intronic
1171408918 20:24933303-24933325 CCTCCACCAAGGGCACCAGGGGG - Intergenic
1173465703 20:43279534-43279556 CTTCCACTAAGGATACCCAGGGG + Intergenic
1175368499 20:58471226-58471248 CCTCCACCAAGGAGCCCTGGGGG + Intronic
1175412098 20:58777174-58777196 TCTCCACCAAGTACACCTGGTGG - Intergenic
1175890781 20:62314992-62315014 CCTCCATCAGGGGCACCGCGAGG + Intronic
1175957267 20:62617820-62617842 CCTGCCCCAAGGCCACCTAGGGG + Intergenic
1179179751 21:39035403-39035425 CCTCCACCAATAACACCCAGTGG + Intergenic
1180168762 21:46046491-46046513 CCACCATCAGGGACACCCAGAGG + Intergenic
1181164615 22:20976685-20976707 GCTCCACCACAGACACAGAGTGG - Exonic
1184262144 22:43324465-43324487 CCTCCATCCAGGACACTGGGAGG - Intronic
1184458330 22:44623939-44623961 CCTCCCCCCAGCACACAGAGAGG - Intergenic
950124068 3:10500916-10500938 CCCTCACCAAGGACACTGGGGGG + Intronic
950342057 3:12256327-12256349 ACTCCAGCAAGAACAACGAGTGG - Intergenic
950407338 3:12813003-12813025 CCTCCACCAGGGGCACCAGGCGG - Exonic
950792715 3:15486251-15486273 CCTCCACCAAGTGAACGGAGTGG - Intronic
951737858 3:25887557-25887579 CCTGCACCAAGCCCACAGAGAGG - Intergenic
953193688 3:40712756-40712778 GCTCCACCAAGGACTCTGAGGGG - Intergenic
955303670 3:57809041-57809063 CCTCCACCAAGAGCACAGGGAGG - Intronic
961531452 3:127542743-127542765 CCACCACCAAACACACCCAGAGG + Intergenic
961781699 3:129324374-129324396 GCTTCTTCAAGGACACCGAGAGG + Intergenic
962330227 3:134471823-134471845 CCTCCACCATGCCCACAGAGTGG - Intergenic
966734614 3:183179220-183179242 CCTCCTCCGAGGAGCCCGAGGGG - Exonic
968628489 4:1638442-1638464 CCTACATCAAGGGCACCGAGGGG + Intronic
969353112 4:6609631-6609653 GCACCACCCAGGACCCCGAGCGG - Intronic
969477469 4:7429702-7429724 CCTGAACCAAGGCCACAGAGTGG + Intronic
972158935 4:36198888-36198910 CCTCCACCAAGAGCACAGGGAGG + Intronic
972397883 4:38672904-38672926 CCTTCACCATGGAAACCTAGAGG - Intronic
974933837 4:68389909-68389931 CCTACAACAATGACACCAAGGGG + Intergenic
978835867 4:113149068-113149090 CCTTCACCAAGGAAAGGGAGGGG - Intronic
980627347 4:135390781-135390803 CCTAAAGCAAGGACACAGAGTGG - Intergenic
986353288 5:6900603-6900625 CCTCCACCAGAAACACCCAGAGG - Intergenic
993367378 5:87050257-87050279 CCTCCGCCAAGGTCACCCATTGG + Intergenic
996550958 5:124729400-124729422 CCTAAACCAAGGATAGCGAGTGG + Intronic
998341716 5:141423294-141423316 CCACCACCAAGTACAGCGAGAGG - Exonic
999745596 5:154589606-154589628 CTTCCACCATCGACACCCAGAGG + Intergenic
1001783056 5:174387076-174387098 CCTCCAGCAGGGACACTGACTGG + Intergenic
1002693793 5:181070628-181070650 CCTCCCCCAAGAGCACAGAGGGG + Intergenic
1006923399 6:37640748-37640770 CCTGCCCCAAGGACACTGATGGG - Intronic
1014138450 6:117914605-117914627 ACTCCACCAATGGCACCCAGAGG - Intronic
1015658900 6:135550776-135550798 CCTACAACAAGAACACCAAGTGG - Intergenic
1016407664 6:143747418-143747440 CCTCAAGCAAGGACACTGATAGG - Intronic
1017126707 6:151071517-151071539 CATTCACCAAGGTCACCGAGAGG + Intronic
1017750876 6:157489642-157489664 TCTCCACCAGGCACACCGTGTGG + Intronic
1018445290 6:163852771-163852793 CCTCCACCCAGAACACTGAGGGG - Intergenic
1019127984 6:169853933-169853955 CCAACACCAAGCACACCGACGGG - Intergenic
1019305507 7:332666-332688 ACTCCAACAAGAACACCCAGTGG + Intergenic
1022518901 7:30993211-30993233 CCTCCAGGAAGGACAGTGAGCGG + Intronic
1034554237 7:151839833-151839855 CCTTCCCCAGGGACACCGTGTGG + Intronic
1034940327 7:155226502-155226524 CCGCCACGGAGGGCACCGAGGGG + Intergenic
1038843716 8:31209866-31209888 CCTCCACCAAGAACAGCCATGGG - Intergenic
1042872309 8:73410162-73410184 CCTACAACAAGGAGACAGAGAGG + Intergenic
1045303243 8:100933410-100933432 CCTCCCCAAAGGACTCCCAGTGG + Intronic
1048272960 8:133044027-133044049 CCCCTCCCAAGGACACCGTGAGG - Intronic
1048286895 8:133148767-133148789 CCTCCCCCATGGATACCGACGGG + Intergenic
1049566044 8:143339720-143339742 CCCCCACCAGGGACAGGGAGGGG + Intronic
1050664419 9:7919212-7919234 ACTCCAGCAAGGAAACAGAGAGG - Intergenic
1052339761 9:27353610-27353632 CCTGGACCAAGGTCACCCAGGGG + Intronic
1052784251 9:32813968-32813990 CCACCACCAAGCACAGAGAGCGG + Intergenic
1057524144 9:95784418-95784440 CCTCCACCCACGACCCCGCGTGG - Intergenic
1061041916 9:128145367-128145389 CCTCCCCCAAGTACACCCACTGG - Intergenic
1061667348 9:132168335-132168357 GCTCCTCCAAGGACACGCAGAGG - Intronic
1061700634 9:132412315-132412337 CTTCCACCAGGGACAGCCAGGGG + Intronic
1188508486 X:30908859-30908881 CCTCAACCCAGGACACACAGAGG - Intronic