ID: 1152750771

View in Genome Browser
Species Human (GRCh38)
Location 17:82061510-82061532
Sequence TGTGAACAGCACCATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 946
Summary {0: 1, 1: 1, 2: 42, 3: 219, 4: 683}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152750765_1152750771 11 Left 1152750765 17:82061476-82061498 CCATCAGAGCAGACTGGGATTGA 0: 1
1: 0
2: 0
3: 22
4: 143
Right 1152750771 17:82061510-82061532 TGTGAACAGCACCATGGGGAGGG 0: 1
1: 1
2: 42
3: 219
4: 683
1152750761_1152750771 22 Left 1152750761 17:82061465-82061487 CCAGCTCAGGCCCATCAGAGCAG 0: 1
1: 0
2: 1
3: 25
4: 216
Right 1152750771 17:82061510-82061532 TGTGAACAGCACCATGGGGAGGG 0: 1
1: 1
2: 42
3: 219
4: 683
1152750764_1152750771 12 Left 1152750764 17:82061475-82061497 CCCATCAGAGCAGACTGGGATTG 0: 1
1: 0
2: 4
3: 8
4: 102
Right 1152750771 17:82061510-82061532 TGTGAACAGCACCATGGGGAGGG 0: 1
1: 1
2: 42
3: 219
4: 683

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152750771 Original CRISPR TGTGAACAGCACCATGGGGA GGG Intronic
900713034 1:4127088-4127110 TGAGGACAGCACCAAGAGGATGG - Intergenic
900756304 1:4437490-4437512 TGAGAACAGCACTAGGGGGACGG + Intergenic
900902932 1:5528908-5528930 CGAGAACAGCACCAAGAGGATGG - Intergenic
900903185 1:5530933-5530955 TGAGAACAGCACCAAGGTGATGG - Intergenic
901117055 1:6855532-6855554 TGAGAACAGTACCAAAGGGACGG + Intronic
902322574 1:15678808-15678830 TGAGGACAGCACCAAGAGGATGG + Intergenic
902937268 1:19773292-19773314 TGGGATCAACACCCTGGGGAGGG + Intronic
903211204 1:21820017-21820039 TGAGAACAGCACCAAACGGATGG + Intronic
903998698 1:27324872-27324894 CGAGAACAGCACCAAAGGGATGG + Intronic
904323709 1:29713207-29713229 TATGCAGAGCACCATGGGAAGGG + Intergenic
904387485 1:30153170-30153192 TGAGAACAGCACCAAAGGGATGG - Intergenic
905603170 1:39271398-39271420 CGAGAACAGCACCAAGGGGATGG + Intronic
905648937 1:39643760-39643782 TGAGAACAGTACCAAGGGGATGG - Intergenic
905776579 1:40671504-40671526 TGAGAAGAGCACCAAGGGGATGG - Intergenic
905958662 1:42023570-42023592 GGAGAACAGCACCAAGTGGATGG - Intronic
906060271 1:42943923-42943945 TGTGAACAGCAGGAAGGGTAGGG - Intronic
906183277 1:43839924-43839946 CAAGAACAGCACCAGGGGGATGG + Intronic
906207889 1:43996795-43996817 TGAGCCCAGCACCCTGGGGAAGG - Intronic
906773811 1:48510467-48510489 TGTGAGCAGCAACCAGGGGAGGG + Intergenic
907195591 1:52684026-52684048 TGAGGACAGCACCAAGGGGAGGG - Intergenic
907294644 1:53442502-53442524 TGAGACCAGCACCGAGGGGATGG - Intergenic
907485891 1:54777887-54777909 TGTCAACAGCACAAGGGGGATGG - Intergenic
907625665 1:56026835-56026857 TGAGAACAGCACCAAAGGGATGG - Intergenic
907654171 1:56325408-56325430 TGAGGACAGCATCAAGGGGACGG + Intergenic
908076753 1:60528204-60528226 TGAGACCATCACCAAGGGGATGG - Intergenic
908580602 1:65512210-65512232 CAAGAACAGCACCAAGGGGATGG + Intronic
909829862 1:80174366-80174388 TGAGAACAGCACCAAGGAGATGG - Intergenic
910255228 1:85241287-85241309 TGAGGACAGCACCAAGGGGATGG - Intergenic
910273389 1:85421099-85421121 TGAGGACAGCACCAAGGAGATGG + Intronic
910350460 1:86291024-86291046 CGAGAACAGCACCAACGGGATGG - Intergenic
910368707 1:86493440-86493462 CGTGGACAGCACCGTGGGAAAGG + Exonic
910402647 1:86852749-86852771 TGATAATAGCACCAAGGGGATGG + Intergenic
910481207 1:87660381-87660403 CGAGAACAGCACCAAGAGGATGG + Intergenic
910575125 1:88753732-88753754 TGAGAACAGCACCAAGGGGATGG + Intronic
910593419 1:88952444-88952466 TGAGAACAGCATCAAGGGGATGG - Intronic
910863752 1:91768575-91768597 TGAGAACAGCACTAGGGGGATGG - Intronic
911249914 1:95563762-95563784 TGAGAACAGCACCAAGTGGGCGG + Intergenic
911283217 1:95957407-95957429 TGTGAAAATCAGCATTGGGATGG + Intergenic
911488204 1:98528510-98528532 TGAGAACAGCACCATGGGTGTGG - Intergenic
911885276 1:103289722-103289744 TAAGAACAGCACCAAGGAGATGG - Intergenic
911922544 1:103784024-103784046 TGAGAACAGCACCAAGAGGATGG + Intergenic
912260834 1:108110567-108110589 TGAGAACAGCACCAAGGGGATGG + Intergenic
912313572 1:108646674-108646696 CGAGAACAGCACTAAGGGGATGG - Intergenic
913052841 1:115132079-115132101 TGAGAACAGCACCAAGAGGATGG + Intergenic
914904923 1:151736139-151736161 TGAGAACAGCACCAAGGGGATGG - Intergenic
914967285 1:152271337-152271359 TGAGAACAGCACCAAGAAGATGG + Intergenic
914969083 1:152290776-152290798 TGAGAACAGCACCAAGAAGATGG - Intergenic
915086963 1:153395516-153395538 GGTAAACAGCTTCATGGGGACGG - Intergenic
915235987 1:154482680-154482702 TGTGAAAAAAACCATGGGAATGG - Exonic
915698995 1:157773008-157773030 TGTGAACAGCATGCAGGGGAGGG - Intronic
915780241 1:158541937-158541959 AGAGAACAGCACTAGGGGGATGG + Intergenic
916343804 1:163765924-163765946 TGAGAACAGCACCAATGGGATGG + Intergenic
916693909 1:167218087-167218109 TGAGGACAGCACCAAGGCGATGG - Intergenic
916735896 1:167606765-167606787 TGAGGACAGCACCAAGTGGATGG - Intergenic
917272334 1:173291274-173291296 TGAGGACAGCATCAAGGGGATGG + Intergenic
917355516 1:174123048-174123070 TGGGAACAGCACTAGGGCGATGG + Intergenic
917365882 1:174231821-174231843 TGAGAACAGCACCGAGGGGATGG + Intronic
917916521 1:179707900-179707922 TTGCAACAGCACCATGGGGTAGG + Intergenic
918227362 1:182496240-182496262 TGAGGACAGTACCAAGGGGATGG + Intronic
918757810 1:188359207-188359229 TGAGAACAGCACCAAAGTGATGG + Intergenic
918767122 1:188500445-188500467 TGAGAACAGCACCAAGGGGATGG - Intergenic
919129525 1:193435827-193435849 TGAGGACAGCACCAAGGGGATGG - Intergenic
919283087 1:195517713-195517735 TGAGAACAGTACCAAGGGGATGG - Intergenic
919580227 1:199363132-199363154 GGAGGACAGCACCAAGGGGATGG - Intergenic
919704325 1:200661920-200661942 TGATGACAGCACCAAGGGGAAGG - Intronic
920631448 1:207656745-207656767 CGAGAACAGCACCAAGGGGACGG + Intronic
920641933 1:207760870-207760892 CGAGAACAGCACCAAGGGGACGG + Intronic
920949980 1:210563457-210563479 GGTGGAAAGCACGATGGGGAGGG + Intronic
921014032 1:211170567-211170589 TGAGAACAGCACCAAGAGAATGG + Intergenic
921161434 1:212475020-212475042 TGTGATCAGCACAAAGAGGAAGG + Intergenic
921259091 1:213369739-213369761 TGTGGCCAGCAGGATGGGGAGGG + Intergenic
921933922 1:220778481-220778503 TGAGAACAGCACCAAGGTGGTGG + Intronic
922069361 1:222175600-222175622 ACAGAACAGCACTATGGGGATGG + Intergenic
922163622 1:223096955-223096977 TGAGGACTGCACCATGAGGATGG + Intergenic
923246909 1:232141098-232141120 TGTTAACAGGAACATTGGGAGGG + Intergenic
923295747 1:232593547-232593569 TATGAAAAGCACCCTGGAGATGG - Intergenic
924452311 1:244189479-244189501 TGACCACAGCACCAAGGGGATGG - Intergenic
1062912210 10:1218689-1218711 CGAGGACAGCACCAAGGGGACGG - Intronic
1063146197 10:3297201-3297223 TCAGAGCAGCACCATGGGGACGG - Intergenic
1063367672 10:5500918-5500940 TGTGTGCAGCACCAAGGGGCTGG - Intergenic
1063480005 10:6367218-6367240 TGAGAACAGCACCAAGAGGATGG + Intergenic
1063515761 10:6693551-6693573 CGAGAACAACACCATGGGGATGG - Intergenic
1064768677 10:18700940-18700962 TGAGAACAGCACCAAAGGGATGG - Intergenic
1064773153 10:18746678-18746700 TGTGCACAGCGCCTAGGGGAGGG - Intergenic
1064980463 10:21161621-21161643 TGTGAACAGGAACAGGGGGTGGG - Intronic
1065242748 10:23724096-23724118 TGAGAACGGCACCAAGGGGATGG + Intronic
1065430383 10:25648723-25648745 TGAGAACAGCACCCAAGGGATGG - Intergenic
1065436863 10:25711688-25711710 TGAGAATAGCACCAAGGGGACGG + Intergenic
1065444117 10:25780124-25780146 CAAGAACAGCACCAAGGGGATGG + Intergenic
1065870561 10:29952776-29952798 CGAGGACAGCACCAAGGGGATGG + Intergenic
1065915640 10:30352532-30352554 TGTGGACAGTGCCAAGGGGATGG - Intronic
1065996092 10:31060764-31060786 CGAGAACAGCACCATAGGGATGG - Intergenic
1066128124 10:32362378-32362400 TGAGAACAACACCAAGAGGATGG - Intronic
1066253063 10:33652876-33652898 TGAGGACAGCACCAAGAGGATGG + Intergenic
1066295742 10:34052729-34052751 TGAGAACAGCGCCAAGAGGATGG - Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067355175 10:45517439-45517461 TGAGGACAGCACCAAGGGGATGG - Intronic
1067835243 10:49634285-49634307 TGTGGGCAGGACCAAGGGGATGG + Intronic
1068197940 10:53743811-53743833 TGAGAACAGCACCAAAGGGATGG + Intergenic
1068198202 10:53745844-53745866 TGAGAATAGCACCAAAGGGATGG + Intergenic
1068200185 10:53774177-53774199 TGAGAACAGCACCAAGGAGATGG + Intergenic
1068712234 10:60147619-60147641 CGAGAACAGCACCAGGGGGATGG - Intronic
1068867407 10:61909232-61909254 TGAGAACAGCACTATGGTGGGGG - Intronic
1069217695 10:65842584-65842606 TGAAAACAGGACCAAGGGGATGG + Intergenic
1069381178 10:67844347-67844369 TGAGGACAGCACCAGGAGGATGG - Intergenic
1069861628 10:71475295-71475317 TGTGAGCATCACAGTGGGGAGGG + Intronic
1070058015 10:72953953-72953975 TGTGAACTGCAGCAGGGGGAAGG + Intronic
1070108740 10:73461906-73461928 TGAGGACAGCACCAAAGGGATGG - Intronic
1070703897 10:78623331-78623353 AGAGAATAGCACCAAGGGGATGG + Intergenic
1071338561 10:84621873-84621895 CCAGAACAACACCATGGGGATGG - Intergenic
1071988184 10:91073647-91073669 TGTGTGCAGCACCATGGCTAAGG - Intergenic
1071990015 10:91092560-91092582 TGAGAACAGCACCAAAGGGATGG + Intergenic
1072277232 10:93835079-93835101 TGAGAACAGCACTAGGGGGATGG + Intergenic
1072889756 10:99312934-99312956 TGAGAACAGCACCAAGGAGATGG - Intergenic
1073538977 10:104302712-104302734 TGAGAACAGCACCAAGAGAATGG - Intronic
1073599945 10:104836808-104836830 TGAGAAAAGCAGCATGGAGATGG - Intronic
1074266196 10:111905995-111906017 TGAGAACAGCACCAAAGGGATGG + Intergenic
1074804059 10:117029602-117029624 TGAGGACAGCATCAAGGGGATGG - Intronic
1075421624 10:122305401-122305423 GGAGAACAGCACCAAGAGGATGG - Intronic
1075628611 10:123985232-123985254 TGAGAACAGCACCAAGGGGATGG + Intergenic
1075783968 10:125035780-125035802 TGTGAACTGCACCAGCTGGAGGG - Intronic
1075838487 10:125476790-125476812 TGAAAACATCACCAAGGGGAAGG + Intergenic
1076435260 10:130436729-130436751 TGAGAACAGCACCAAGAGGATGG - Intergenic
1076457127 10:130608267-130608289 TGGGAGAAGCACCAGGGGGAGGG - Intergenic
1077315203 11:1916602-1916624 AGTGGACAGCACCAGGGGCAGGG + Intergenic
1078698476 11:13658620-13658642 TGAGAACAGCACTAGGTGGATGG - Intergenic
1078698747 11:13660655-13660677 TGAGAACAGCACTAGGGGGAAGG - Intergenic
1078731104 11:13974785-13974807 TGTGGATATCACCCTGGGGAGGG - Intronic
1079915509 11:26364693-26364715 TGAAAATAGCACCAAGGGGATGG + Intronic
1079919847 11:26419223-26419245 TGAGAACAGCACTAGGGAGATGG + Intronic
1079975154 11:27082092-27082114 TGAGGACAGCACCAAGTGGATGG + Intronic
1080079101 11:28193461-28193483 TGAGAACATCACTAGGGGGATGG + Intronic
1080173841 11:29338656-29338678 TGACAACAGCACCAAGGGAATGG + Intergenic
1081093154 11:38898070-38898092 TGAGAACAGCACCAAGGGGATGG - Intergenic
1081336577 11:41874235-41874257 TGTAAACTGCACAATGTGGAGGG - Intergenic
1081783816 11:45732495-45732517 TGAGAACAGCACTAGGGGAATGG + Intergenic
1082936911 11:58664664-58664686 TAGGAACAATACCATGGGGAGGG + Intronic
1083024733 11:59540884-59540906 TGAGAACAGCACTAGGGAGATGG - Intergenic
1083068053 11:59946011-59946033 TGAGACCAGCACCAAAGGGATGG + Intergenic
1084104560 11:66972781-66972803 TGAAAACAGCACCAAGGGGATGG - Intergenic
1084929830 11:72546142-72546164 TGTGAACAGAAAGATGAGGAAGG - Intergenic
1084933752 11:72576116-72576138 TGCAAACAGCCCCATGGGGGAGG + Intergenic
1084943617 11:72627262-72627284 TGTTTACAACCCCATGGGGAAGG + Intronic
1085241788 11:75062562-75062584 TGAGAACAGCACCAAGGGGATGG - Intergenic
1085698572 11:78726638-78726660 TGAGAACAGCACCAAGAGGATGG - Intronic
1086084486 11:82940768-82940790 CGAGAACAGCACCAAGTGGATGG + Intronic
1086250408 11:84805539-84805561 TGAGAACAGCACCAAAGAGATGG - Intronic
1086505183 11:87497304-87497326 TGAGAATAGCACCAAGGGGATGG - Intergenic
1086645940 11:89220360-89220382 TGAGAACAGCACCAAACGGATGG + Intronic
1086894100 11:92292405-92292427 GTTGAACATGACCATGGGGATGG + Intergenic
1087854787 11:103078744-103078766 TGTGAGCAGGACCTTGAGGAAGG - Intronic
1088194278 11:107258168-107258190 TGTGAAAACCACAAAGGGGACGG + Intergenic
1088460241 11:110075157-110075179 TGAGAACAGCGCCAAGGGAACGG + Intergenic
1088506496 11:110532563-110532585 TGAGGACAGCACCAACGGGATGG - Intergenic
1088939050 11:114435367-114435389 TGAGGACAGCACCAAGGCGATGG + Intronic
1088989302 11:114937944-114937966 TAAAAACAGCACCAAGGGGATGG - Intergenic
1089114482 11:116083206-116083228 GGGGTACAGCATCATGGGGAGGG - Intergenic
1089169081 11:116500046-116500068 AATGGACAGCAGCATGGGGAGGG + Intergenic
1089571577 11:119414782-119414804 AGTGATCAGCACTATGAGGAGGG - Intergenic
1089709977 11:120307615-120307637 TGTGAGCAGCACCTTCGGGTGGG + Exonic
1090455470 11:126844955-126844977 TGTGCACAGCAGGGTGGGGAAGG - Intronic
1090611407 11:128474205-128474227 TGTAAACAGCACCAGGGTGCAGG + Intronic
1090959184 11:131540614-131540636 TGTGAACAGAAACATCTGGACGG - Intronic
1091084243 11:132705236-132705258 CAAGAACAGCACCAAGGGGATGG - Intronic
1091211725 11:133866301-133866323 CGAGAACAGCACCAAGAGGATGG + Intergenic
1091786505 12:3246245-3246267 TGAGGACAGCATCAAGGGGATGG + Intronic
1091842698 12:3632081-3632103 TGAGGACAGCACCAAAGGGAAGG - Intronic
1091964487 12:4726569-4726591 TGTGAACAGCACACTGAAGAGGG + Exonic
1092517256 12:9227504-9227526 TGAGAACACCACCAAGGGGATGG + Intergenic
1092597230 12:10020965-10020987 TGAGAACAGCACCAAGAAGATGG - Intergenic
1094223705 12:28023205-28023227 TGAGGACAGCACCAAGGGGATGG + Intergenic
1094322902 12:29204846-29204868 CGGGAACAGCACCAAGGAGATGG + Intronic
1095344273 12:41130981-41131003 TGAGGACAGCACCAAGAGGATGG - Intergenic
1095367995 12:41431011-41431033 GGAGAACAGTACCAAGGGGATGG + Intronic
1096777401 12:53972750-53972772 TGTGAGCAGCACCAGGAGGGTGG - Intergenic
1097365728 12:58710140-58710162 TGTGAAAGGCTCCATGGGCATGG + Intronic
1098252856 12:68587757-68587779 TGAGAACAGCACCAAAGGGATGG - Intergenic
1098621835 12:72610704-72610726 TGAGAACATCACCATGGTGCAGG + Intronic
1098644273 12:72879598-72879620 TGAGAATAGCACCAAGGGGTTGG + Intergenic
1098689854 12:73473192-73473214 GGAGAACAGCACTATGGGGATGG + Intergenic
1098903079 12:76132796-76132818 TGAGAACAGCACCAAGGAAATGG + Intergenic
1099016377 12:77348464-77348486 TGAGAACAGCACCAAGGGGATGG + Intergenic
1099893942 12:88621603-88621625 TGAGGACAGTACCAAGGGGATGG - Intergenic
1100448342 12:94681615-94681637 TGAGAACAGCACCAGGAAGATGG - Intergenic
1102448212 12:113019999-113020021 CGAGAAGAGCACCAAGGGGATGG - Intergenic
1102459064 12:113089115-113089137 TGGGAAGAGCACCTTGGGAAAGG + Intronic
1102524922 12:113505650-113505672 TGAAAACATCACCTTGGGGAAGG + Intergenic
1104943695 12:132406343-132406365 CGTGAACAGGACCATGGGGCAGG + Intergenic
1104995471 12:132651775-132651797 TGTGAAGAGCCCCATGGAGCAGG + Intronic
1105321067 13:19323005-19323027 TGAGAACAGGAGCATGAGGAGGG + Intergenic
1105624075 13:22096393-22096415 CGAGAACAGCACCAAGAGGATGG + Intergenic
1105730644 13:23211979-23212001 GGACAACAGCACCAAGGGGATGG - Intronic
1105906543 13:24816382-24816404 TGCAAACAGCCACATGGGGAGGG - Intronic
1106338994 13:28810177-28810199 TGAGAACAACACCAAGAGGATGG - Intergenic
1106464195 13:29998211-29998233 TGAGAACAGCACCAAGAGGATGG - Intergenic
1106619305 13:31358153-31358175 TGAGAACAACACCAAGGAGATGG - Intergenic
1106673711 13:31934656-31934678 TGTGAATGGCATCATGGGGATGG - Intergenic
1106831123 13:33584441-33584463 TGAGGACAGCATCAAGGGGATGG + Intergenic
1106831166 13:33584798-33584820 TGAGGACAGCACCAAGGGGATGG - Intergenic
1107231840 13:38119280-38119302 TGAGAACAGCACCAAAGGGAAGG + Intergenic
1107247132 13:38309986-38310008 TTAGAACAGCACCAAAGGGATGG + Intergenic
1108005123 13:45938552-45938574 TGAGGACAGCACCAAGAGGATGG - Intergenic
1108210846 13:48138470-48138492 CGAGAACAGCACCAAGTGGATGG - Intergenic
1108263917 13:48685301-48685323 TGAGAACAGCACCGAGGGGACGG + Intronic
1108735409 13:53278670-53278692 TGAGAACAGCACCTAGGGAATGG + Intergenic
1108935187 13:55873790-55873812 TGTGAACAGCTGAATGGGGGTGG - Intergenic
1109181693 13:59221565-59221587 TGTGAGCAGCACCTTTGAGATGG - Intergenic
1109799861 13:67362595-67362617 TGAGAACAGCACCAAAGGGATGG + Intergenic
1110084087 13:71355361-71355383 CGAGAACAGCACCAAGGTGATGG + Intergenic
1110161991 13:72389433-72389455 TGAGGACAGCACCAAGGGGATGG + Intergenic
1110187506 13:72692422-72692444 TGAGGACAGCACCAAGGAGATGG - Intergenic
1110276995 13:73651948-73651970 TGAGAACAGCACCAAGGGGATGG + Intergenic
1110411032 13:75204172-75204194 TGAGAACACCACCAAGGGGATGG + Intergenic
1110411300 13:75206186-75206208 CATGAACAGCACCAAGGGGATGG + Intergenic
1110423136 13:75335625-75335647 TGAGAACAGCACCAAGTGGATGG - Intronic
1110876510 13:80517214-80517236 TGAGCACAGCTCCATGGGCATGG - Intergenic
1110969762 13:81746791-81746813 TGAGAACAGCAGCAAAGGGAAGG - Intergenic
1111240191 13:85463859-85463881 TGAGAACAATACCATGTGGATGG + Intergenic
1111494698 13:89033185-89033207 TGAGAACAGCACCAAGAAGATGG - Intergenic
1111578629 13:90192769-90192791 TGAAAACAGCACCAAAGGGACGG - Intergenic
1112040468 13:95542164-95542186 CGGGAACAGCCCCAAGGGGATGG + Intronic
1112257988 13:97852340-97852362 TGAGAACAGCACTGGGGGGATGG + Intergenic
1113239529 13:108320861-108320883 TGAGCACAGCATCAAGGGGATGG + Intergenic
1113320502 13:109228139-109228161 ATTGGACAGCACTATGGGGATGG + Intergenic
1113980444 13:114270334-114270356 CGAGAACAGCACCAAGAGGATGG + Intronic
1114244656 14:20901407-20901429 GGAGAACAGCACCAAGGGAATGG + Intergenic
1114247655 14:20929550-20929572 GGAGAACAGCACCAAGGGAATGG + Intergenic
1114499566 14:23158284-23158306 TGGGAGCACCACCCTGGGGAAGG + Intronic
1114540232 14:23450010-23450032 TGAGGACAGCACCAAGGGGATGG - Intergenic
1115073917 14:29362736-29362758 TGAGGACAGCACCAAGAGGATGG - Intergenic
1117762804 14:59049803-59049825 TGAGGACAGTACCAAGGGGATGG + Intergenic
1118145317 14:63128440-63128462 TGAGAACAGCACCAAAGGGATGG - Intergenic
1118188655 14:63560349-63560371 TGACAACAGCACTAGGGGGATGG - Intergenic
1118538392 14:66794218-66794240 CAAGAACAGCACCAAGGGGATGG - Intronic
1118710372 14:68513774-68513796 TGTGAACAGCCACATGTGGCTGG - Intronic
1119041164 14:71275930-71275952 TGAGAACAGCACAGAGGGGATGG - Intergenic
1119050111 14:71358881-71358903 TGAGAACAGCACCAAAGGGATGG + Intronic
1119144124 14:72294768-72294790 TGAGAACAGCACCAAAGGGGTGG + Intronic
1119611917 14:76070704-76070726 TGAGGACAGCGCCAAGGGGATGG - Intronic
1120197779 14:81504769-81504791 CAAGAACAGCACCAAGGGGATGG - Intronic
1120203084 14:81559688-81559710 TGAGAACAGCACTAGGGGGATGG + Intergenic
1120326810 14:83039912-83039934 TGAGAACAGCACCAAAAGGATGG + Intergenic
1120505277 14:85347863-85347885 TGAGAACAGCACCAAGAGAATGG + Intergenic
1120612357 14:86657939-86657961 GGTGAACTCCACCATGGGAATGG - Intergenic
1120654858 14:87177407-87177429 TGAGAACAGCACTAGGGGGATGG - Intergenic
1120680744 14:87477783-87477805 CGAGAACAGCACCAAAGGGATGG + Intergenic
1120707915 14:87763394-87763416 CAAGAACAGCACCAAGGGGATGG + Intergenic
1120807573 14:88769258-88769280 TGAGAACAGCACCCAGAGGAAGG - Intronic
1120819395 14:88898019-88898041 TGAGAACAGCACCCAGGGGATGG + Intergenic
1120858698 14:89235200-89235222 TGAAAACATCACCATGGAGAGGG + Intronic
1121140601 14:91538547-91538569 AGAGAACAGCACCAAGAGGATGG + Intergenic
1121267187 14:92612032-92612054 AGAGAACAGCACCGAGGGGATGG + Intronic
1121336210 14:93078931-93078953 TGTGAACCGCACAATGGGAAAGG + Intronic
1121372810 14:93375748-93375770 CGGGAACAGCACCAAGGGGATGG + Intronic
1121383393 14:93494238-93494260 TGAGAACAGCACCAAAGGGATGG + Intronic
1121549749 14:94789911-94789933 TGTGACCATCACCATGGCTATGG + Intergenic
1122056565 14:99102390-99102412 TGAGAACAGCACCAAGGAGATGG - Intergenic
1122693933 14:103543848-103543870 TGTGCTCAGCGCCTTGGGGATGG - Intergenic
1122763828 14:104050715-104050737 TGTGCAGAGCTCCATGGGCAAGG + Intronic
1122812524 14:104296135-104296157 TGTGGACAGCCCCATGGGAGAGG + Intergenic
1202837481 14_GL000009v2_random:89200-89222 TGAGGACAGTACCAAGGGGATGG - Intergenic
1123878387 15:24649377-24649399 TGAGGACAGCATCAAGGGGATGG + Intergenic
1124685464 15:31778088-31778110 AGTCATCAGCACCATGGGAATGG + Intronic
1125002423 15:34785367-34785389 TGAGGACAGTACCAAGGGGATGG - Intergenic
1125290013 15:38136097-38136119 TGAGAATAGCACCAAAGGGATGG + Intergenic
1125407531 15:39369322-39369344 TGAGAACAGCACTAGGGGAATGG + Intergenic
1125407950 15:39372456-39372478 TGAGAACAGCACTAGGGGGATGG + Intergenic
1126563002 15:50064921-50064943 TGAGAACAACACCGAGGGGATGG + Intronic
1126697676 15:51340106-51340128 TGAGAACAGCACTGAGGGGATGG + Intergenic
1127357783 15:58217439-58217461 CAAGAACAGCACCAGGGGGATGG + Intronic
1127440276 15:58999952-58999974 TGAGAACAGCACCAAAGGGATGG + Intronic
1127550552 15:60033537-60033559 TGAGAACAGCACCAAAGAGATGG - Intronic
1127768422 15:62210454-62210476 TGAGGACAGCACCAAGGGGATGG - Intergenic
1128126514 15:65197207-65197229 TGTGGACCGCACCCTGGTGAAGG - Exonic
1128680005 15:69643599-69643621 TGAGAACAGCACCAAAGGGATGG + Intergenic
1129343194 15:74899536-74899558 TGGGAACAGCAGAAAGGGGAGGG + Exonic
1129583087 15:76832682-76832704 TGAGGACAGCACCAAAGGGATGG - Intronic
1129640560 15:77372790-77372812 TGAGAACAGTACTAGGGGGATGG - Intronic
1131137526 15:89949820-89949842 AGTGAACAGAGGCATGGGGAAGG - Intergenic
1131327605 15:91463406-91463428 TGAGAACAGCACCAAGAGGATGG - Intergenic
1131489265 15:92848482-92848504 TGTGATCAGAGCAATGGGGATGG + Intergenic
1132249851 15:100327533-100327555 TGTGAAATACACCATGGGGGAGG + Intronic
1132714672 16:1284773-1284795 TGGGGACAGCACAATGGGGAGGG - Intergenic
1132840052 16:1974527-1974549 TGTCACCAGCACCTGGGGGAGGG - Exonic
1132917056 16:2355200-2355222 TGAGAACAGCACTAGGGGGATGG + Intergenic
1133458653 16:5966695-5966717 TGAGAACAGTACCAAGAGGATGG + Intergenic
1133707524 16:8369286-8369308 TGAGAACAGCACTGAGGGGATGG - Intergenic
1135151723 16:20012842-20012864 TGAGAACAGCACCAAGGGGATGG + Intergenic
1135751546 16:25062421-25062443 TCAGAACAGCACCAAGAGGATGG - Intergenic
1135930549 16:26732658-26732680 TGAGAACAGCACCAAGAAGATGG - Intergenic
1136421238 16:30134801-30134823 AGAGAACAGCACCAAAGGGATGG + Intergenic
1137000066 16:35221887-35221909 TGTGTACGGCACCATGGACACGG - Intergenic
1137967974 16:52955637-52955659 AGAGAAGAGCACCAAGGGGATGG - Intergenic
1138169239 16:54833458-54833480 TGAGAACAGCACAAAGTGGATGG - Intergenic
1138218662 16:55229047-55229069 CGAGAACAGCACCAAAGGGATGG - Intergenic
1138292024 16:55855940-55855962 TGAGAACAGCACCAAAGGGGTGG - Intronic
1138402718 16:56760628-56760650 TGAGGACAGCACCAAGAGGATGG + Intronic
1138705598 16:58912060-58912082 CAAGAACAGCACCAGGGGGATGG - Intergenic
1138987678 16:62350089-62350111 TGAGAACAGCACCAAGTGGATGG + Intergenic
1139106247 16:63830437-63830459 TGAGAATAGCACCAAGGAGATGG - Intergenic
1139360229 16:66393527-66393549 TGAGAACAGAACCTAGGGGATGG + Intronic
1141337570 16:83171306-83171328 TGAGAACAGCACCAAAGGGATGG + Intronic
1141345075 16:83237257-83237279 CGTGAGCATCACCATGGGGTGGG - Intronic
1141364661 16:83431747-83431769 TGAGGATAGCACCAAGGGGATGG + Intronic
1141758774 16:86013143-86013165 TGAGGACAGCACCAAGGGGATGG + Intergenic
1142375329 16:89703757-89703779 TATTTACAGCAGCATGGGGACGG + Intergenic
1143427319 17:6850285-6850307 CGAGAACAGCACCAAGGAGATGG - Intergenic
1143458451 17:7083425-7083447 TGAGAACAGCACCAAGGAGATGG + Intergenic
1144517156 17:15926589-15926611 TGTGAGCAGCAGAATGGGCAAGG + Intergenic
1144914884 17:18716357-18716379 TGAGAAAAGAACCATGAGGAGGG + Intronic
1145783795 17:27581228-27581250 CGAGAACAGCACCAAGAGGATGG + Intronic
1146065236 17:29629823-29629845 TGGGGACAACAGCATGGGGAAGG + Exonic
1146348641 17:32077697-32077719 TGTGGACAGCACCAAAGAGATGG + Intergenic
1146453374 17:32991828-32991850 TGTTAAGAGAACAATGGGGAAGG - Intronic
1146966763 17:37037832-37037854 TGAGGACAGCACCACGGGAATGG - Intronic
1147347840 17:39814760-39814782 TGTCAGCAGGACCATGGGAAGGG - Intronic
1149281635 17:55111533-55111555 TGAGGACAGCACCAACGGGATGG - Intronic
1149361362 17:55898995-55899017 TGAGAACAGCACTAGGGGGATGG - Intergenic
1149456219 17:56790795-56790817 TGAGAACAGTACCAAGGGGATGG - Intergenic
1150123941 17:62624749-62624771 TGAGAACAGCATCAAGAGGATGG + Intergenic
1150147395 17:62780485-62780507 TGTGAACAGCACACTGGGCCAGG + Intronic
1150610028 17:66726512-66726534 TGTGAACAGCAGAAGAGGGAAGG + Intronic
1150686604 17:67326118-67326140 TGTGCACAGAACTATGGAGATGG - Intergenic
1151045524 17:70916085-70916107 TGAGAACAGCACCAAGGGGATGG - Intergenic
1151045806 17:70918155-70918177 TGAGAACAGCACCCAAGGGATGG - Intergenic
1151053556 17:71006518-71006540 TGAGAACAGCACTAAGGGGATGG - Intergenic
1151905265 17:77043965-77043987 CGAGAACAGCACCAAGAGGACGG + Intergenic
1152000269 17:77640918-77640940 TGGGAAGAGTTCCATGGGGAGGG + Intergenic
1152406988 17:80103433-80103455 TGTGTAATACACCATGGGGAGGG - Intergenic
1152750771 17:82061510-82061532 TGTGAACAGCACCATGGGGAGGG + Intronic
1153044228 18:841186-841208 TGTGGACAGCACCTTCAGGAAGG - Intergenic
1153461474 18:5338594-5338616 TGAGAACAGCACCAAGAGGATGG - Intergenic
1153832911 18:8938928-8938950 TGAGAATAGCACCGAGGGGATGG - Intergenic
1153937498 18:9942790-9942812 TGGGAACAGTGTCATGGGGATGG + Intronic
1155465288 18:26127974-26127996 TGAGAGCAGCACCTAGGGGATGG - Intergenic
1155703342 18:28777732-28777754 TGTGAACAGGGCCATCAGGAAGG - Intergenic
1157082827 18:44546409-44546431 TGGGAACAGCACCAAAAGGATGG - Intergenic
1157225750 18:45862536-45862558 TGAGAACAGCACCAAGAGGATGG - Intronic
1157324173 18:46657187-46657209 AGGGAACAGCACCTTGGGCACGG - Intergenic
1157680317 18:49600372-49600394 AGTGAACAGAACCAAGGGGTGGG + Intergenic
1158129005 18:54132207-54132229 TGAGAACAGCATCAAGAGGATGG - Intergenic
1158317820 18:56230954-56230976 TGAGAACAGCACAAAGAGGATGG - Intergenic
1158377483 18:56887273-56887295 GCTGAACGGCACTATGGGGAGGG + Intronic
1158406120 18:57161213-57161235 TGTAAACAGCACCAAAGGGATGG + Intergenic
1158741667 18:60149563-60149585 TCTGACCAGCACCATGGTGGTGG + Intergenic
1159159985 18:64631625-64631647 TGAGAACCGCACCAAGGGGATGG - Intergenic
1159465928 18:68784369-68784391 TGAGAACAGCACCAAGGGGATGG + Intronic
1159702727 18:71649923-71649945 TGAGGACAGTACCAAGGGGATGG - Intergenic
1159898609 18:74021129-74021151 TGAGAGCAGCACCAAGTGGAAGG + Intergenic
1160327960 18:77968034-77968056 TATGAAGAGCACCCTGGGGAGGG - Intergenic
1160717920 19:584804-584826 TGCCAACAGGACGATGGGGAAGG + Intergenic
1161231580 19:3177383-3177405 TGTCAGCAGGGCCATGGGGATGG + Intronic
1161573449 19:5042737-5042759 TGAGGACAGCACCGCGGGGATGG + Intronic
1164424536 19:28129139-28129161 AGAGAACAGCACCAAGGGAATGG - Intergenic
1164538216 19:29102677-29102699 CGAGAACAGCACCAAGAGGATGG - Intergenic
1164555727 19:29249365-29249387 TGAGAGCAGCACTAGGGGGATGG - Intergenic
1164732881 19:30519348-30519370 TTTGCACAGCACCTTGGGGCAGG + Intronic
1164766404 19:30775465-30775487 TGAGAACAGCACCAAGGGATTGG - Intergenic
1165202781 19:34158878-34158900 TGAGATCAGCACTAGGGGGATGG - Intergenic
1165593180 19:36988563-36988585 TGAGAACAGCAACAAGGGGGTGG + Intronic
1165761997 19:38326965-38326987 TGTGACCAGCACCTTGTAGAGGG - Exonic
1166025293 19:40077479-40077501 TGAGGACAGCACCAAGGGGATGG + Intronic
1167576859 19:50321969-50321991 TGGGAAGGGCACCAAGGGGAAGG + Intronic
1167725012 19:51205480-51205502 TCTTAACAGCACCAAGGAGATGG - Intergenic
1168357406 19:55710557-55710579 TGAGAACAGCACCAAAGGGATGG - Intronic
1168451662 19:56471087-56471109 CGGGAACAGCACCAAAGGGATGG - Intronic
1202635161 1_KI270706v1_random:38151-38173 TGAGGACAGTACCAAGGGGATGG + Intergenic
1202644959 1_KI270706v1_random:131220-131242 TATGAACAATATCATGGGGAGGG - Intergenic
1202650057 1_KI270706v1_random:171954-171976 TGAGGACAGTACCAAGGGGATGG - Intergenic
925110143 2:1328120-1328142 TGAGAACAGCACTAGGGGGATGG + Intronic
925663333 2:6225409-6225431 TGAGAACAGCACCAAGCAGATGG - Intergenic
926248440 2:11138665-11138687 TGAGGACAGTACCATGGGGATGG - Intronic
926312940 2:11687677-11687699 TATGGACAGCCCTATGGGGAAGG - Intronic
926942292 2:18151373-18151395 TGTGAACAGCATCAAGAGGATGG + Intronic
927141257 2:20132425-20132447 TGAGGACAGCACCAAGAGGATGG + Intergenic
927395775 2:22649824-22649846 TGTGAACTGCAGCATTAGGAAGG - Intergenic
927838043 2:26417052-26417074 TGAGAACACCACCAAGAGGATGG + Intronic
928871697 2:35988374-35988396 TGAGAACAGCACCAAGGAGATGG + Intergenic
928925926 2:36579480-36579502 TGAGAACAGCACCAGGGGGATGG - Intronic
929091604 2:38222969-38222991 TGAGAACAGCACCAAGGAGATGG + Intergenic
929095958 2:38263503-38263525 TGAGAACAGCACCAAGGGGATGG + Intergenic
929785553 2:44988343-44988365 TGAGAACACCACCAAGGAGATGG + Intergenic
929806578 2:45151483-45151505 TGAGAACAGTACCAAGAGGATGG - Intergenic
929811091 2:45189910-45189932 TGAGAACAGCATCAAGAGGACGG - Intergenic
930104072 2:47626495-47626517 TAAGAACAGCACCAAGAGGATGG - Intergenic
930553872 2:52870491-52870513 TGAGAACAGCACCAAGAGGATGG - Intergenic
930600061 2:53432513-53432535 TGAGAACAGCACCAAGGGGATGG - Intergenic
932015579 2:68023616-68023638 TCTGAACAGCACCTTGAAGAGGG - Intergenic
932597022 2:73100343-73100365 CATGGACAGCACCATGGGCAGGG + Intronic
932931895 2:76050844-76050866 TGAGAAAAGCACTAAGGGGATGG - Intergenic
933283602 2:80359496-80359518 TGAGAACAGCACCAAAGGGGGGG - Intronic
933458057 2:82542130-82542152 TGAGAACAGCACCAAGAGGATGG + Intergenic
933484968 2:82909606-82909628 TGAGAACAGCACCCAGGTGATGG - Intergenic
934154162 2:89179711-89179733 TGAGAACAGCACCAAGAAGATGG - Intergenic
934213071 2:90002224-90002246 TGAGAACAGCACCAAGAAGATGG + Intergenic
935160892 2:100528564-100528586 TGAGAACAACACCAAAGGGATGG + Intergenic
935225502 2:101048635-101048657 TGTGAACGGCAGCATGCTGAGGG - Intronic
935377729 2:102417270-102417292 TGTGGACAACACCAAAGGGATGG - Intergenic
935409045 2:102739508-102739530 TGAGAACAGCACCAAGAGGATGG - Intronic
935693698 2:105752519-105752541 TGTGTTCAGCACCATAGGAAAGG + Intronic
935839037 2:107088400-107088422 TGTGGATAGCTCCATGGAGAGGG - Intergenic
936094190 2:109519268-109519290 CGAGAACAGCACTAGGGGGATGG + Intergenic
936233280 2:110722902-110722924 TGAGAACAGCACCAAGGTGATGG - Intergenic
936638529 2:114286625-114286647 TGAGGACAGCACCAAGGGGATGG + Intergenic
936732413 2:115400105-115400127 TGAGAACAGCACCAAGAAGATGG + Intronic
937146133 2:119646507-119646529 TGAGAACAGCACCAAGGAGATGG + Intronic
937344448 2:121116006-121116028 TGGGGACAGCACCAAGGGGATGG + Intergenic
937438558 2:121898340-121898362 AGTTAACAGCAGCAAGGGGATGG + Intergenic
937471048 2:122174230-122174252 TGAGAAGAGCAGCATGGGCAAGG - Intergenic
938238862 2:129727563-129727585 TGGGAACAGCTCCATAGAGAAGG + Intergenic
939195212 2:138963155-138963177 GGGGAACAGCACTAGGGGGATGG - Intergenic
939687365 2:145215532-145215554 CGAGAACAGCACCAAAGGGATGG + Intergenic
940691829 2:156927957-156927979 TGAGAACAGCAGCAAGGGGATGG + Intergenic
942104651 2:172620663-172620685 TGAAGACAGCACCAAGGGGATGG - Intergenic
942482543 2:176404693-176404715 TGAGAACAGCACCAAGAGGATGG + Intergenic
942597861 2:177609185-177609207 TGAGAACAGCACCAAAGGGATGG - Intergenic
944037484 2:195312916-195312938 TGAGAATAGCACCAAAGGGATGG + Intergenic
944306317 2:198183884-198183906 TGCGAAGAGCACTAGGGGGATGG - Intronic
944311136 2:198235162-198235184 TGAGAACAGCACCAAGAGGGTGG + Intronic
944594708 2:201250585-201250607 TGCAAACAGCACTGTGGGGATGG + Intronic
944828569 2:203509791-203509813 AGAGGACAGCACCAAGGGGATGG - Intronic
945328668 2:208514502-208514524 TGAGAACAGCACTGAGGGGATGG + Intronic
945328899 2:208516276-208516298 TGGGGACAGTACCAAGGGGATGG + Intronic
945751783 2:213795694-213795716 TGAGAACAGCACTGAGGGGATGG - Intronic
946145885 2:217730698-217730720 TGAGGACAGCACCAAGGGGATGG - Intronic
946561746 2:220921821-220921843 TGAGAACAGCACCAAGGAGATGG + Intergenic
946636886 2:221739138-221739160 GGAGAACAGCACCGAGGGGATGG + Intergenic
946714454 2:222538820-222538842 CTAGAACAGCACCAAGGGGATGG + Intronic
946801645 2:223423665-223423687 TGAGAGCAGCACCAACGGGATGG - Intergenic
946837506 2:223787052-223787074 TGAGAACAGCATCAAGGAGATGG - Intronic
946990978 2:225329135-225329157 TGAGAACAGCACCAAGAGAATGG + Intergenic
947253945 2:228140730-228140752 TGAGGACAGCACCAAGGAGACGG - Intronic
947536622 2:230943706-230943728 AGAGGACAGCACCAAGGGGAGGG - Intronic
947965569 2:234278605-234278627 GGAGAACAGCACCAAAGGGATGG + Intergenic
948126946 2:235571145-235571167 CAGGAACAGCACCAAGGGGACGG + Intronic
948202006 2:236136167-236136189 TGTGGTGAGCACCATGGGGAAGG - Intergenic
948215100 2:236222670-236222692 TGAGGAAAGCACCAAGGGGATGG - Intronic
948219055 2:236254904-236254926 TGAGAACAGCACCAAGCGGATGG - Intronic
948343613 2:237276819-237276841 GAAGAACAGCACCAAGGGGATGG + Intergenic
948658740 2:239493426-239493448 TGAGAACAGCACTGAGGGGATGG + Intergenic
948661994 2:239513228-239513250 CGAGAACAGCACCAAGGAGATGG - Intergenic
948961348 2:241340922-241340944 AGTGAACAGGATCATGGGGAGGG - Intronic
1169165235 20:3417151-3417173 TGAGTACAGCACCAAGGAGAAGG + Intergenic
1169286044 20:4308155-4308177 TGAGGACAGCACCAAGGGGATGG + Intergenic
1169296901 20:4407885-4407907 TGTGAACAGCTCAGTAGGGATGG + Intergenic
1169745574 20:8939211-8939233 TGAGAGCAGCACCAGGAGGATGG + Intronic
1169810684 20:9606151-9606173 TGAGAATAGTACCAAGGGGATGG - Intronic
1170018195 20:11806609-11806631 TGAGAACAGCACCAAGAGCATGG - Intergenic
1170560043 20:17549514-17549536 CGAGAACAGCACCAAAGGGATGG + Intronic
1171016260 20:21544632-21544654 TGAGAACAGCAACAAGGGGATGG + Intergenic
1171307569 20:24119209-24119231 TCAGAACAGCCCCATGGGGTAGG - Intergenic
1171497943 20:25570348-25570370 TGACAACAGCACCAAGGGGATGG - Intronic
1171881313 20:30619333-30619355 TGAGGACAGTACCAAGGGGATGG + Intergenic
1172226453 20:33308182-33308204 CGAGAACAGCACCAAGAGGATGG + Intronic
1172291328 20:33779282-33779304 TGAGGACTGCACCAAGGGGATGG + Intronic
1173020476 20:39263692-39263714 GGAGAACAGCACCAAGGGGATGG + Intergenic
1173110659 20:40185104-40185126 TGAGAACAGCACCAAGGGGATGG + Intergenic
1173927384 20:46791028-46791050 TGAGGACAGCACGAAGGGGATGG + Intergenic
1174036036 20:47668818-47668840 GGTGAGAAGCACCATGGGCATGG - Intronic
1174515338 20:51087804-51087826 AGGGACCAGCAGCATGGGGATGG - Intergenic
1174715649 20:52755165-52755187 TGAGAACAGCACCAAGGGAATGG + Intergenic
1174751874 20:53119025-53119047 TTAGAACAGCTCCAAGGGGATGG + Intronic
1174951360 20:55044745-55044767 TGAGGACAGCACCGAGGGGATGG - Intergenic
1175043185 20:56075637-56075659 TGAGAACAACACCAAAGGGATGG - Intergenic
1175096969 20:56548883-56548905 TGAGAACAGCACCAAGGGGATGG - Intergenic
1175233997 20:57496155-57496177 TGAGGACAGCACCAAGCGGATGG - Exonic
1175525312 20:59629574-59629596 TGTGAAGAGAACCAGGGAGAAGG - Intronic
1175704581 20:61167122-61167144 TGTGGGCAGCACCCTGGAGAAGG - Intergenic
1175931864 20:62497321-62497343 GGAGAAAAGCACCAGGGGGAGGG + Intergenic
1176183293 20:63763588-63763610 TGAGGACAGCACTAAGGGGAGGG + Intronic
1176387159 21:6143949-6143971 TGAGGACAGTACCAAGGGGATGG - Intergenic
1176601756 21:8800597-8800619 TGAGGACAGTACCAAGGGGATGG + Intergenic
1176606920 21:8841447-8841469 TATGAACAATATCATGGGGAGGG + Intergenic
1176626215 21:9094130-9094152 TGAGGACAGTACCAAGGGGATGG - Intergenic
1176647375 21:9363915-9363937 TGAGGACAGTACCAAGGGGATGG + Intergenic
1176886759 21:14265740-14265762 GGGAAACAGCACCAGGGGGATGG - Intergenic
1177095450 21:16826438-16826460 TGAGAATAGCACCATGAGGATGG + Intergenic
1177147760 21:17425083-17425105 CGAGAACAGCGCCAAGGGGATGG - Intergenic
1177169444 21:17639689-17639711 TGAGAACAGCACTAGGGGAATGG + Intergenic
1177187557 21:17814715-17814737 TGAGAACAGCACTGAGGGGATGG + Intronic
1177499442 21:21933396-21933418 TGAGAATAGCACCAAAGGGATGG - Intergenic
1177725528 21:24962270-24962292 TGAGAACAGCACCAAGGAGGAGG + Intergenic
1177725603 21:24963091-24963113 TGAGAACAGCACCAAGGAGGAGG - Intergenic
1178289016 21:31350531-31350553 CGAGAACAGCACCAAGGGGATGG - Intronic
1178320975 21:31605434-31605456 GGAGAACAGCACCAAGGGGATGG - Intergenic
1178520419 21:33284671-33284693 GGAGGACAGCACCAAGGGGATGG - Intronic
1178642065 21:34352688-34352710 CGAGAACAGCTCCAAGGGGATGG - Intergenic
1178767412 21:35467314-35467336 TGTGATCACCACCATGGGAAGGG + Intronic
1179097014 21:38325044-38325066 TGGGATCTGCACCATGGGGCAGG + Intergenic
1179736314 21:43394303-43394325 TGAGGACAGTACCAAGGGGATGG + Intergenic
1179893085 21:44347178-44347200 CGGGAACAGCACCAAGAGGATGG + Intergenic
1180153576 21:45965860-45965882 TGAGAACAGCACCAAGGGGATGG - Intergenic
1180344042 22:11692148-11692170 TGAGGACAGTACCAAGGGGATGG + Intergenic
1180357000 22:11851224-11851246 TATGAACAATATCATGGGGAGGG + Intergenic
1180365543 22:11935076-11935098 TGAGGACAGTACCAAGGGGATGG - Intergenic
1180381262 22:12141107-12141129 TATGAACAATATCATGGGGAGGG - Intergenic
1180624943 22:17188183-17188205 TGACAACAGCCCCATGGAGAAGG - Intronic
1180638663 22:17280800-17280822 TCTGACTGGCACCATGGGGAAGG - Intergenic
1181562468 22:23713943-23713965 TGAGAGCAGCACCGTGGGGAAGG + Intergenic
1181985091 22:26794908-26794930 CGAGAACAGCACCAAGGAGATGG - Intergenic
1182084497 22:27551943-27551965 TGAGAACAGCACCACAGGGATGG - Intergenic
1182844957 22:33422813-33422835 TGAGAACGGCACCAAGGTGATGG + Intronic
1183145405 22:35986287-35986309 TATGAACAGCAGGATGAGGAAGG + Intronic
1183257022 22:36769183-36769205 TGTGAACAGGTCCATGAGGGGGG - Intronic
1183487853 22:38098990-38099012 TGTCCTCAGCACCATGGGCAGGG + Intronic
1184498226 22:44856071-44856093 TGAGAACAGCACCAAAGAGATGG + Intronic
1184753636 22:46503416-46503438 TGTCCTCACCACCATGGGGATGG - Intronic
1184915917 22:47568950-47568972 TGAGAACAGCACCGAGAGGATGG + Intergenic
949591595 3:5499985-5500007 TGTGAACAGCAGGATGGGGGAGG + Intergenic
949703848 3:6792460-6792482 TGAGAACATCACCAAGTGGATGG - Intronic
949823631 3:8141376-8141398 TGAGAACAGCACCAAGGGGATGG - Intergenic
949951949 3:9236504-9236526 TGAGAACAGCACCAAAGTGATGG - Intronic
950732471 3:14972894-14972916 TGAGAACAGCACCAAGAGGACGG + Intronic
950799814 3:15541275-15541297 TGTGAACAGCACCAAGGGGATGG + Intergenic
951173126 3:19566319-19566341 TGAGAACAGCACCAACAGGATGG - Intergenic
951191096 3:19772557-19772579 TGAGAACAGCACCAAGGGGATGG - Intergenic
951312022 3:21138599-21138621 TGAGGACAGCACCAAGGGGACGG - Intergenic
951449249 3:22818360-22818382 TGAGAACAGCACTAGGGGGATGG + Intergenic
951457697 3:22911008-22911030 CGAGAACAGCACAAAGGGGATGG - Intergenic
951528804 3:23679731-23679753 CGAGAACAGCACCAAAGGGATGG + Intergenic
951810026 3:26688665-26688687 TGAGAACAGCACCAAGGGGATGG + Intronic
951990903 3:28675375-28675397 CGAGAACAGCACCAAAGGGATGG - Intergenic
952526417 3:34215367-34215389 TGTGAATAGCACCAGGGGCCAGG + Intergenic
952674232 3:36007971-36007993 TGAGAAGAGCACCAAGGGTATGG + Intergenic
952807825 3:37374393-37374415 TGACAACAGCACCAAGGGGATGG + Intergenic
953196867 3:40742542-40742564 TGTGAACTGGACCCTGGGTATGG + Intergenic
953519141 3:43624434-43624456 CGAGGACAGCACCAAGGGGATGG - Intronic
953540564 3:43814222-43814244 TGGGAAAATAACCATGGGGAAGG - Intergenic
953716606 3:45321382-45321404 TCTCATCAGCACGATGGGGAGGG + Intergenic
953985920 3:47442895-47442917 TGTGAAGAGGATGATGGGGATGG + Exonic
954273341 3:49526192-49526214 TGAGAACAGCACTAGGGGGGTGG + Intronic
954602820 3:51884004-51884026 CAGGAACAGCACCAAGGGGATGG + Intergenic
954926030 3:54235517-54235539 CAAGAACAGCACCAAGGGGATGG + Intronic
955089327 3:55733742-55733764 TGTGCCAAGCACCATGGGCAAGG - Intronic
955273737 3:57527598-57527620 TGAGGACAGCATCAAGGGGATGG + Intronic
955551661 3:60091678-60091700 TGAGAACAGCACCAAGGGGATGG - Intronic
955725301 3:61926315-61926337 CAAGAACAGCACCAAGGGGATGG - Intronic
956137540 3:66113999-66114021 TCTGAATAGCATCCTGGGGAAGG + Intergenic
956227499 3:66976098-66976120 TGAGAACAGCACCACGTGGAGGG - Intergenic
956775089 3:72558364-72558386 TGAGGACAGTACCAGGGGGATGG - Intergenic
956966052 3:74462043-74462065 TGAGAACAGCACCAAAGAGATGG - Intronic
957273891 3:78065298-78065320 TGAGAACAACACCAAGAGGATGG - Intergenic
957609751 3:82451770-82451792 TGAAAACAGCACCAAGGGGATGG - Intergenic
957694219 3:83613250-83613272 TGAGAACAGCACCAAGGGGATGG + Intergenic
957931378 3:86882448-86882470 TGATGACAGCACCAAGGGGATGG + Intergenic
958846133 3:99267001-99267023 TGAGGACAGCATCAAGGGGATGG + Intergenic
959105122 3:102057056-102057078 TGAGAATAGCACCAAAGGGAGGG + Intergenic
959801044 3:110495550-110495572 TGGGAAGAGCACCTGGGGGAAGG + Intergenic
960059907 3:113310324-113310346 TGTGATCAACATCGTGGGGATGG - Intronic
960059965 3:113310741-113310763 TGAGAACAGCACTGAGGGGATGG - Intronic
960150768 3:114246531-114246553 TGAGAATAGCACCAAAGGGATGG - Intergenic
960587486 3:119333996-119334018 TGTGCACAGCATCTTGGAGAAGG + Intronic
960890039 3:122438160-122438182 CTAGAACAGAACCATGGGGATGG - Intronic
962324523 3:134422384-134422406 TGAGGACAACACCAGGGGGATGG - Intergenic
963012230 3:140781237-140781259 CGAGAACAGCACCAAAGGGATGG - Intergenic
964129637 3:153272494-153272516 TGAGAACAGCACCAAAGAGATGG - Intergenic
964176737 3:153832617-153832639 GGAGAACAGCACCAAGGGGATGG + Intergenic
964241785 3:154602584-154602606 TGAGAACAGCACCAATGGGATGG + Intergenic
964367600 3:155966489-155966511 TGAGAACAGCACCAAAGGGATGG - Intergenic
964718951 3:159752688-159752710 CGAGAACAGCACCAAGGGGATGG + Intronic
965232681 3:166073119-166073141 TGAGGACAGCACCAAGGGGATGG - Intergenic
965833416 3:172824447-172824469 TGAGAACAGCACCAGGGGGATGG + Intergenic
966655601 3:182354470-182354492 TGTGAAGATCACCATCTGGATGG - Intergenic
966809425 3:183830229-183830251 TGTGAACAGGAGAGTGGGGATGG - Intronic
967324389 3:188224784-188224806 TGAGGACAGCACCAAGAGGATGG + Intronic
967521079 3:190433847-190433869 TGAGAACAGCACCAAGGTTATGG - Intronic
967704084 3:192630058-192630080 CGAGGACAGCACCAAGGGGATGG - Intronic
967851642 3:194087001-194087023 TGTGAAAAGCACCCAGAGGAAGG + Intergenic
1202739504 3_GL000221v1_random:41072-41094 TGAGGACAGTACCAAGGGGATGG - Intergenic
969095125 4:4727041-4727063 TGAGAACAGCACCAAGGGGACGG - Intergenic
969129311 4:4979913-4979935 TAAGAACAGCACCAAGGGGACGG + Intergenic
969142657 4:5092744-5092766 CGAGAACAGCACCAAGGAGATGG + Intronic
969316969 4:6388231-6388253 TGTGCCCAGCACCAGGGGGCTGG - Intronic
969619689 4:8272868-8272890 TGTGAACGGCGCCCTGGAGATGG - Intronic
969929679 4:10618815-10618837 TGAGAACAGCATCAAGGGGATGG + Intronic
970117783 4:12718630-12718652 TGAGAACAGTACCAAGAGGATGG - Intergenic
970399076 4:15700749-15700771 TGAGAATAGCAACAAGGGGATGG + Intronic
970487710 4:16541242-16541264 TATGGACAGCACCAAGTGGATGG - Intronic
970646180 4:18122851-18122873 TGAGGACAGCACTAAGGGGATGG + Intergenic
970707323 4:18820792-18820814 TGAGAACAGTACAAAGGGGAAGG + Intergenic
970945147 4:21682245-21682267 TGAGAACAGTACCAAGGGGATGG + Intronic
971420489 4:26469722-26469744 TGAGGATAGCACCACGGGGATGG + Intergenic
971557979 4:28037938-28037960 CAAGAACAGCACCAAGGGGATGG + Intergenic
972069405 4:34996495-34996517 TGAGTACAGCACCAAGAGGATGG + Intergenic
972123815 4:35739606-35739628 TGAGAACAGCACTAAGGGGATGG + Intergenic
972227178 4:37026659-37026681 TGAGAACAGCACTAGGGGGATGG + Intergenic
972730538 4:41790370-41790392 TGAGAACAGCACCAAGCAGATGG + Intergenic
972944950 4:44242745-44242767 AGAGGACAGCACCAAGGGGAGGG - Intronic
972976497 4:44642674-44642696 TGAGAACAGCCCTAGGGGGATGG - Intronic
973371179 4:49249634-49249656 TATGAACAATATCATGGGGAGGG - Intergenic
973389825 4:49545677-49545699 TATGAACAATATCATGGGGAAGG + Intergenic
973608094 4:52607678-52607700 TGAGGACAGCACCAGGAGGATGG - Intronic
975600009 4:76089391-76089413 TGATAACAGCACAAAGGGGACGG - Intronic
975636683 4:76457248-76457270 TGAGAACAGCACCAAGGTAATGG - Intronic
976306088 4:83560751-83560773 TGAGGACAGTACCATGGGGATGG - Intronic
976985525 4:91291644-91291666 CGAGAACAGCACCAAGGGGACGG + Intronic
977551590 4:98448934-98448956 AGAGAACAGCACTATGGGAAAGG + Intergenic
978024884 4:103860870-103860892 TGAGAACAGCACAAAGGGGATGG - Intergenic
978690560 4:111504463-111504485 TGAGAGCAGCACCAATGGGATGG - Intergenic
979253663 4:118590346-118590368 TGAGAACAGCACCAAGGGGATGG - Intergenic
980658021 4:135815254-135815276 TGAGAACAGCACTAGGGGGCTGG - Intergenic
980849448 4:138362912-138362934 CGAGAACAGCACCAAAGGGATGG + Intergenic
980898374 4:138880915-138880937 TGAGAACAGCACCAAGAGGATGG - Intergenic
981053200 4:140332077-140332099 TGTGAACAGCACTAGTGGGATGG + Intronic
981146932 4:141334689-141334711 TATGAATAGAACCATGTGGAGGG - Intergenic
981409919 4:144417776-144417798 TGAGAACAGCACCAAGGGGATGG + Intergenic
981776883 4:148378535-148378557 GGAGAACAGCACCAAAGGGATGG - Intronic
981842841 4:149132469-149132491 TGAAGACAGCACCAAGGGGATGG - Intergenic
982087373 4:151849525-151849547 TGAAAACAGCACTAGGGGGATGG - Intergenic
982214536 4:153069257-153069279 TGAGAACAGTACCAAGGGGATGG - Intergenic
982527931 4:156503309-156503331 AGTCAACAGCACCATGTGGCAGG + Intergenic
982809048 4:159803491-159803513 TGTGAACTGCACCTGCGGGAGGG - Intergenic
982925186 4:161328205-161328227 TGAGAACAGCACCAAAGGGATGG - Intergenic
983939534 4:173525463-173525485 TGCGAACATCACCCTGAGGATGG + Intronic
984529723 4:180901734-180901756 TGAGAACAGCGCCAGGGGGATGG + Intergenic
984967258 4:185150263-185150285 CGTGCAAAGCACCATGGGGGTGG + Exonic
1202762464 4_GL000008v2_random:124031-124053 TGAGGACAGTACCAAGGGGATGG + Intergenic
985875303 5:2590117-2590139 TGGGACCAGGGCCATGGGGAAGG + Intergenic
985914864 5:2909619-2909641 TCTCAAAAGCAACATGGGGACGG + Intergenic
985915034 5:2911026-2911048 TGTGAACAGGACAATGTGGCCGG - Intergenic
986536395 5:8792498-8792520 TGAGAACAGCACCAAGAAGAGGG - Intergenic
986940674 5:12945590-12945612 GGAGGACAGCACCAAGGGGATGG - Intergenic
987192549 5:15493176-15493198 TGAGAACAGCACTAGGGGGATGG - Intergenic
987287321 5:16469620-16469642 CTGGAACAGCACCAAGGGGATGG - Intergenic
987289408 5:16494463-16494485 TGAGCACAGCACCAAGGGGATGG - Intronic
987432860 5:17857844-17857866 TGAGAACAGCACCAAGGGCATGG - Intergenic
987463587 5:18245413-18245435 TGAGAGCAACACCAAGGGGATGG - Intergenic
987650725 5:20736892-20736914 CAAGAACAGCACCAAGGGGATGG - Intergenic
987964415 5:24853240-24853262 CGAGAACAGCACCAAAGGGATGG - Intergenic
988215578 5:28268083-28268105 TGAGAACAGCAGTAGGGGGATGG - Intergenic
988288489 5:29253370-29253392 TGAGGACAGCACCAAGAGGATGG + Intergenic
988455953 5:31387484-31387506 TGAGAATAGCACCAAGAGGATGG + Intergenic
988914999 5:35883312-35883334 AGAGGACAGCACCAAGGGGATGG - Intergenic
989347211 5:40442471-40442493 AGTGAGCAGCACCACAGGGAAGG - Intergenic
990095503 5:52107357-52107379 TGACAACAGCACCATGGGGATGG + Intergenic
990504875 5:56434192-56434214 TGAGAACAGCACTAGGGGCATGG + Intergenic
991312198 5:65256146-65256168 TTTGAACAGCCCCATGTGGCTGG - Intronic
991429659 5:66531048-66531070 TGAGAACAGCACCAAGGAGTTGG + Intergenic
991938732 5:71829504-71829526 CAAGAACAGCACCAAGGGGATGG + Intergenic
992270925 5:75062227-75062249 TGAGAACAGCATTAGGGGGATGG - Intergenic
992448351 5:76853896-76853918 TGAGAACAGCACCAAGGGGATGG - Intronic
992791148 5:80215191-80215213 TGAGAACAGTACCAAGTGGATGG - Intronic
992825084 5:80541282-80541304 GGTGAAAAGCACAATGGGAAGGG - Intronic
993047099 5:82880395-82880417 TGAGGACAGCACCAAGGAGATGG + Intergenic
993816622 5:92556458-92556480 TGAGAACAGCAGCAAGGGGATGG - Intergenic
993840048 5:92866473-92866495 TGAGAACATCATCATGGTGATGG - Intergenic
993997373 5:94738758-94738780 TGTGAAAAACACCTTGAGGACGG + Intronic
994558734 5:101339150-101339172 AGAGAACAGCACCAAGGGGTTGG + Intergenic
994693067 5:103042059-103042081 CAAGAACAGCACCAAGGGGATGG - Intergenic
995117584 5:108499418-108499440 CGTGGATAGCACCAAGGGGATGG - Intergenic
995414322 5:111891804-111891826 TGAGGACAGCACCAAGGGCATGG + Intronic
995857432 5:116608096-116608118 TGAGAACAGCACCAAGAGGATGG + Intergenic
995927315 5:117389863-117389885 TGAGAACAGCACCGAGGGGATGG - Intergenic
995966537 5:117914386-117914408 TGAGAACAGAACCTAGGGGATGG - Intergenic
996004824 5:118407006-118407028 CAAGGACAGCACCATGGGGATGG + Intergenic
996120905 5:119671035-119671057 TGAGAACAGCATCAAGGGGATGG - Intergenic
996615425 5:125435740-125435762 TGAGAACAGCACCAAGAGGATGG + Intergenic
996777398 5:127147497-127147519 CTAGAACAGCACCAAGGGGATGG + Intergenic
996903859 5:128575491-128575513 TGAGAAAAGCTCTATGGGGATGG + Intronic
996980849 5:129492248-129492270 TGAGAACAGTATCAAGGGGAGGG + Intronic
996993599 5:129667519-129667541 TGAGGACAGCACCAAGAGGATGG - Intronic
997032303 5:130145070-130145092 TGAGAACAGCACCAAGGGGCTGG + Intronic
997183648 5:131859440-131859462 AGAGAACAGCACTAAGGGGATGG - Intronic
997222945 5:132184308-132184330 AGAGAACAGCACCAAGGGAATGG + Intergenic
998442461 5:142173921-142173943 GGAGAACAGCACCAAGGGGATGG + Intergenic
998739775 5:145187574-145187596 TCAGAACAGCACCAAGGGGATGG - Intergenic
998941556 5:147288688-147288710 CGAGAACAGCACCAAGAGGATGG + Intronic
999120555 5:149206333-149206355 TGTGTGAAGCACAATGGGGAAGG + Intronic
999853633 5:155569726-155569748 TGAGGACAGCACCAAGGGGATGG + Intergenic
1000243439 5:159429527-159429549 TGAGAACAGCACCAAGGAGATGG + Intergenic
1000414089 5:160965274-160965296 TGAGAAGAGCACTAGGGGGATGG - Intergenic
1000567462 5:162867591-162867613 CTAGAACAGCACCAAGGGGACGG - Intergenic
1000826105 5:166045958-166045980 TTTCAACAGCATCATGTGGAAGG + Intergenic
1000911591 5:167029646-167029668 TGGCAACAGCCCCATGAGGAAGG - Intergenic
1001891282 5:175341240-175341262 TGAGAATAGCACCAAGGGGATGG + Intergenic
1002018373 5:176344724-176344746 CTAGAACAGCACCAAGGGGATGG + Intronic
1002154564 5:177266256-177266278 GGTGACCATCACCAAGGGGAAGG - Intronic
1002317700 5:178354532-178354554 TGAGAACAGCACCCAGAGGATGG - Intronic
1003447682 6:6199867-6199889 GGTGGCCAGCACCATGGAGAGGG + Intronic
1003671181 6:8161886-8161908 TGAGGAAAGCACCAAGGGGATGG + Intergenic
1003986920 6:11444465-11444487 TGAGAACAGCACCAAGGGGATGG + Intergenic
1004165740 6:13255248-13255270 GGAGAACAACACCAAGGGGAAGG + Intronic
1004166033 6:13257252-13257274 GGAGAACAGCACCAAGGGAATGG + Intronic
1004176397 6:13343910-13343932 TGAGAACAGCATCGAGGGGATGG - Intergenic
1005149294 6:22730315-22730337 TGAGATCAGCACCAAGGGGATGG - Intergenic
1006308046 6:33236770-33236792 TGAGAACAGCACCAGGAGGATGG - Intergenic
1006462213 6:34167600-34167622 TAAGAACAGCACCAAAGGGATGG - Intergenic
1006991076 6:38215419-38215441 AGTGAACAGCACCAGGGGACAGG + Intronic
1007209101 6:40177383-40177405 TGAGAACGGCACCAAGAGGATGG + Intergenic
1007257733 6:40540567-40540589 TGTGACTGGCAGCATGGGGAAGG + Intronic
1007535021 6:42579312-42579334 GGAGAACAGCACCAAGAGGATGG + Intronic
1009652973 6:66499817-66499839 TGAGAACAGCATCAAGAGGATGG - Intergenic
1010009912 6:71037757-71037779 TGAGAACAGCACCAAGGGGATGG + Intergenic
1010202442 6:73294815-73294837 TGAGAACAGCACCAAGTGGATGG - Intronic
1010472146 6:76241501-76241523 TGATAACAGCACCAAAGGGATGG - Intergenic
1010536403 6:77036851-77036873 TGAGAACAGCACCAAGGGGATGG - Intergenic
1011041399 6:83033519-83033541 TGAGTACAGCACCAAGGGGATGG - Intronic
1011172108 6:84516707-84516729 TGAGAACAGCACCAAGGGGATGG - Intergenic
1011554547 6:88561084-88561106 TGAGAACAGCACCAATGGGACGG - Intergenic
1011639348 6:89404587-89404609 AAGGAACAGCACTATGGGGAGGG + Intronic
1011645666 6:89455604-89455626 TGAAAACAGCACCAAGAGGACGG - Intronic
1011849257 6:91605071-91605093 TGAGAACAGGACTAAGGGGACGG + Intergenic
1012039582 6:94186726-94186748 TGAGAACAGCACCAAAGGAATGG + Intergenic
1012230724 6:96758270-96758292 GGAGAACAGCACCAAGGGGATGG - Intergenic
1012464546 6:99502748-99502770 TGAGAACAGCACCAAAGTGATGG - Intronic
1012548031 6:100441418-100441440 TGTGTACATCCCCATGGGGATGG - Intronic
1012564367 6:100628500-100628522 TGAGAATAGCACCAAGAGGATGG - Intronic
1012809492 6:103939325-103939347 TGAGGACAGCATCAAGGGGACGG + Intergenic
1012940383 6:105409178-105409200 TGAGGACAGCACCAAGAGGAGGG + Intergenic
1013315585 6:108939396-108939418 CGAGAACAGCACCAGGGGGATGG - Intronic
1014040923 6:116823920-116823942 TAAGAACAGCACTAGGGGGATGG + Intronic
1014247862 6:119085943-119085965 TGAGAACAGCACCAAGGGGATGG + Intronic
1014328368 6:120028156-120028178 TGAGAAGGGCACCAAGGGGATGG + Intergenic
1014415392 6:121177246-121177268 TGAGAACAGCACCAAGGGGATGG - Intronic
1014493067 6:122086608-122086630 TGAGAACAGCACAAAGAGGATGG + Intergenic
1014619755 6:123652255-123652277 TGAACACAGCACCAAGGGGATGG - Intergenic
1014937436 6:127400699-127400721 TGAGAACAGCACCAAGAGAATGG + Intergenic
1015019855 6:128460028-128460050 GGAGAACAGCACTAGGGGGATGG + Intronic
1015045428 6:128770147-128770169 TAAGGACAGCACCAAGGGGATGG + Intergenic
1015280936 6:131433454-131433476 TGGGAACAGCACCAAGGGGATGG - Intergenic
1015311120 6:131768192-131768214 AGAGAACAGCACCAGGAGGATGG - Intergenic
1015477660 6:133671606-133671628 CGAGGACAGCACCAAGGGGATGG + Intergenic
1015583815 6:134755419-134755441 TGAGGACAGCACCAAAGGGAAGG - Intergenic
1015907383 6:138130804-138130826 TGAGAACAGCACCAAGAAGATGG + Intergenic
1016007015 6:139099426-139099448 TGTGCTCAGCCCCATGTGGAGGG - Intergenic
1016131208 6:140474207-140474229 TGATAACAGCACCAAGGTGATGG + Intergenic
1016559846 6:145383563-145383585 CGAGAACAGCACCAAAGGGATGG + Intergenic
1016683097 6:146853023-146853045 CAAGAACAGCACCAAGGGGATGG + Intergenic
1017108659 6:150912071-150912093 TGAGAACAGCACCAATGGGATGG + Intronic
1017166485 6:151412845-151412867 CAAGAACAGCACCAAGGGGATGG + Intronic
1017552371 6:155522778-155522800 CTAGAACAGCACCAAGGGGATGG + Intergenic
1017687772 6:156930234-156930256 CGAGAACAGCACCAAGAGGATGG - Intronic
1018051811 6:160015810-160015832 TGAGGACAGCACCAAGGGGATGG - Intronic
1018064423 6:160115573-160115595 TGAGCACAGCCCCATGGGGAGGG + Intergenic
1018161931 6:161053274-161053296 TGAGAACAGCACCAATGGGATGG + Intronic
1018332542 6:162746675-162746697 TGTGCAAAGCACCGAGGGGAGGG - Intronic
1018572840 6:165228996-165229018 TGGGAACAGCACACTGGGAAAGG + Intergenic
1018574564 6:165245706-165245728 TCTGATGAGCACCATGGGGGTGG - Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019334579 7:476935-476957 TGAGCCCAGCACCGTGGGGATGG - Intergenic
1019538322 7:1540189-1540211 TGAGAACAGCAGCATGCGGCTGG + Exonic
1019736790 7:2654056-2654078 TGTGAAGAGCTCCTTGGAGAAGG - Intronic
1019765867 7:2849727-2849749 TGTGATGAGCACCAGGAGGAAGG - Intergenic
1019875776 7:3809269-3809291 TGAGGACAGCACCAAGAGGATGG + Intronic
1020616088 7:10464456-10464478 TGTGAACAGCACTAAGGGGATGG - Intergenic
1020668046 7:11072299-11072321 TGAGAACAGCACCAAGAGGATGG + Intronic
1020752489 7:12160315-12160337 TGTTGACAGCTCCCTGGGGAAGG + Intergenic
1021102769 7:16602764-16602786 TGAGGACAGCACCAAGGGAAGGG - Intronic
1021133595 7:16940184-16940206 TGAGGACAGCACCAAGGAGACGG - Intergenic
1021767206 7:23961887-23961909 TGAGAGCAACACCAAGGGGATGG + Intergenic
1022002120 7:26235936-26235958 TGAGAACAGCACTGGGGGGATGG - Intergenic
1022421884 7:30230961-30230983 CGAGAACAGCACCAAAGGGATGG - Intergenic
1022753027 7:33252185-33252207 TAAGAACAGTACCAAGGGGATGG + Intronic
1023707515 7:42957247-42957269 TGAGAACAGCACCAAGTGGGTGG - Intergenic
1024147902 7:46536003-46536025 TGAGGACGGCACCAAGGGGATGG - Intergenic
1024212340 7:47216708-47216730 TGAGGCCAGTACCATGGGGAAGG - Intergenic
1024639728 7:51318849-51318871 TCTGGACACCACCATGGGAAGGG + Intergenic
1024755120 7:52519945-52519967 TGAGAACACCACCAAAGGGATGG + Intergenic
1025230430 7:57200552-57200574 TGAGAGCAGCACCATGGGGAAGG + Intergenic
1025730544 7:64103164-64103186 TGACAGCAGCACCGTGGGGAAGG - Intronic
1026147525 7:67760242-67760264 CGTGAACAGCACTAGGGGGATGG - Intergenic
1026198864 7:68196587-68196609 TGAGAACAGCACCAAGTGGATGG + Intergenic
1026558170 7:71426043-71426065 TGAGAACAGCACCAAAGGGATGG + Intronic
1027751627 7:82154980-82155002 TGAGTACAGCACCAAGGAGATGG - Intronic
1028418774 7:90609463-90609485 CCAGAACAGCACCAAGGGGATGG - Intronic
1029736553 7:102468702-102468724 CCTGAACAGCAGCATGGGGATGG + Intronic
1029917752 7:104229934-104229956 TGAGAACAGCACCAAGGAGAAGG + Intergenic
1030496931 7:110312000-110312022 TGAGAAGAGCACCAAAGGGATGG - Intergenic
1030676887 7:112393693-112393715 CAAGAACAGCACCAAGGGGACGG - Intergenic
1030710859 7:112747464-112747486 TGTAGACAGTACCAAGGGGATGG - Intergenic
1030999454 7:116397971-116397993 TGAGAACAGCACCAAGGAGATGG - Intronic
1031114015 7:117647520-117647542 TGAGAACAGCGCCAAGAGGATGG + Intronic
1031618123 7:123904889-123904911 TGAGAATAGCACCAAAGGGATGG + Intergenic
1032282449 7:130515388-130515410 CAAGAACAGCACCAAGGGGATGG + Intronic
1032360958 7:131254162-131254184 TGTGCACAGCCCCCTCGGGATGG - Intronic
1032578568 7:133081865-133081887 TGAGAACATCACCGTGGTGAAGG - Exonic
1032891250 7:136197946-136197968 TGAGGAGAGCACCAAGGGGATGG + Intergenic
1033313405 7:140278964-140278986 TGAGGACAGCACCAAGAGGATGG - Intergenic
1033729415 7:144160384-144160406 TGAGGACAGCACCAAGGAGATGG + Intergenic
1033953767 7:146817732-146817754 TGAGAACAGCACCAAGAGGATGG + Intronic
1034206667 7:149322129-149322151 TGAGGACAGCACCGAGGGGATGG + Intergenic
1034681374 7:152931017-152931039 CAAGAACAGCACCAAGGGGATGG + Intergenic
1034691985 7:153021438-153021460 TGAGGACAGCACCAAAGGGATGG + Intergenic
1035062145 7:156077301-156077323 CGAGGACAGCACCAAGGGGATGG + Intergenic
1035258326 7:157646272-157646294 TGAGGACAGCGCCAAGGGGATGG - Intronic
1036156513 8:6347273-6347295 TGTGAACAACTCCACGGGGTGGG - Intergenic
1036666203 8:10742264-10742286 TGAGGACAGCACCAAGTGGATGG + Intronic
1036914546 8:12792830-12792852 TGAGAAGAGCACCGAGGGGATGG + Intergenic
1037389093 8:18374152-18374174 TCTGAACAGCACTCTGGGGATGG + Intergenic
1037634565 8:20690156-20690178 TGAGAACAGAACCATCGTGATGG + Intergenic
1037697147 8:21233536-21233558 AGAGACCAGCACCAAGGGGATGG - Intergenic
1038058057 8:23880684-23880706 CGTGATCAGCATCAGGGGGATGG + Intergenic
1038188228 8:25294922-25294944 CGAGAACAGCACCAAAGGGATGG + Intronic
1038214037 8:25545438-25545460 TGAGAACAGCACCAAGAGGTTGG + Intergenic
1038406119 8:27324307-27324329 TGTGAATAGCACAAATGGGAAGG + Intronic
1038823706 8:30977704-30977726 TGAGAACAGCACCAAAGGGATGG + Intergenic
1038988938 8:32844748-32844770 TGAGAATAGCACCAAAGGGATGG - Intergenic
1039160469 8:34612732-34612754 TGAGTACAGCATCAAGGGGATGG - Intergenic
1039161306 8:34624837-34624859 TGAGGACAGCACCAAGAGGATGG + Intergenic
1039777491 8:40751450-40751472 TGAGGACTGCACCAAGGGGATGG + Intronic
1040103978 8:43529301-43529323 TGAAAACAGCATCAAGGGGATGG - Intergenic
1041093423 8:54326060-54326082 AGTGAACAGCTCCATGGGACTGG - Intergenic
1041201602 8:55455125-55455147 TGTGATCCGCGCCATGGGGAGGG + Intronic
1041270069 8:56103035-56103057 TGAGAACAGCACCGAGAGGATGG - Intergenic
1041392370 8:57358521-57358543 TGAGAACAGTACTAAGGGGAGGG + Intergenic
1042072189 8:64948714-64948736 TGAGAATAGCACCAAAGGGATGG + Intergenic
1042072470 8:64950737-64950759 CGAGAACAGCACCAAAGGGATGG + Intergenic
1042528874 8:69794996-69795018 TGAGAACAGCACTGAGGGGATGG + Intronic
1042762707 8:72288001-72288023 TGAGAACAGCACTATAGGAATGG + Intergenic
1042893988 8:73645875-73645897 CGAGAACAGCACCAAGGGGATGG + Intronic
1043036781 8:75208859-75208881 TGAGAACAGCACCAAAGGGATGG + Intergenic
1043085672 8:75828123-75828145 TGAGAACAGCACCAAGGGAATGG - Intergenic
1043090198 8:75891750-75891772 TGAGAACAGCACTGAGGGGATGG + Intergenic
1043352912 8:79382421-79382443 TGAGGATAGCAACATGGGGAAGG - Intergenic
1043823954 8:84902344-84902366 TGAGAACAGCACCAAGAGGATGG + Intronic
1043886145 8:85602990-85603012 TGAGAACAGCACCAAGGAGATGG + Intergenic
1044894923 8:96881421-96881443 CAAGAACAGCACCAGGGGGATGG + Intronic
1045266519 8:100623284-100623306 TGAGAACAGCAACAAGGGGGAGG + Intronic
1045601340 8:103721066-103721088 GGAGAACAGCACCAAAGGGATGG - Intronic
1046084107 8:109410540-109410562 TGAGAACAGCACCGATGGGATGG + Intronic
1046716055 8:117568647-117568669 TGGGAACAGCATTAGGGGGATGG + Intergenic
1047128896 8:121995849-121995871 TGAGAACAGCACCAAGGGGATGG + Intergenic
1047484962 8:125321034-125321056 TGAGAACAGCACCAGGGGGACGG + Intronic
1048168951 8:132086910-132086932 TGTGCAAGGCACCAAGGGGAAGG + Intronic
1048922686 8:139245543-139245565 TGACAACAGCACCGAGGGGACGG + Intergenic
1049125006 8:140778798-140778820 TGTAGACAGCAGAATGGGGATGG + Intronic
1049282484 8:141757146-141757168 TCTCAGCAGCACCATGGGGAGGG + Intergenic
1049871626 8:144983307-144983329 CAAGAACAGCACCAGGGGGATGG - Intergenic
1050038624 9:1463807-1463829 TGTCAACAACACCATGGGTGTGG - Intergenic
1050125035 9:2347942-2347964 TGAGGACAGCACCAAGGGAATGG - Intergenic
1050236520 9:3586966-3586988 TGAGAACAGCACCAAAGGGATGG - Intergenic
1051018053 9:12505438-12505460 TGAGAACAGCACCAGAGGAATGG - Intergenic
1052054406 9:23887514-23887536 TGAGAACAGCATCAAGGGTATGG + Intergenic
1053472185 9:38354810-38354832 CGAGAACAGCACCAAGGGGACGG + Intergenic
1053610618 9:39709740-39709762 TGAGAACAGCACCAAGGGAATGG + Intergenic
1053868653 9:42467762-42467784 TGAGAACAGCACCAAGGGAATGG + Intergenic
1054087635 9:60761417-60761439 TGAGAACAGCACCAAGGGAATGG - Intergenic
1054242905 9:62632655-62632677 TGAGAACAGCACCAAGGGAATGG - Intergenic
1054557029 9:66667173-66667195 TGAGAACAGCACCAAGGGAATGG - Intergenic
1055171550 9:73265299-73265321 TGTGAAGAGCATTATGGTGAGGG + Intergenic
1055191817 9:73533783-73533805 TGAGAACAGCACCAAAGGGATGG - Intergenic
1055331115 9:75184713-75184735 TGAGGACAGTACCAAGGGGATGG + Intergenic
1055561975 9:77530232-77530254 TGAGAACAGCACCAAGGTGAGGG - Intronic
1055663509 9:78530921-78530943 TGAGACCAGCACTAGGGGGATGG - Intergenic
1055924069 9:81492026-81492048 TGAGAACAGCACTAGGAGGATGG - Intergenic
1056468226 9:86879690-86879712 TGAAAACAGCACCAACGGGATGG + Intergenic
1056604257 9:88072946-88072968 TGAGAACAGCACCAAGAGGATGG + Intergenic
1056765426 9:89441946-89441968 TGTAAACACAGCCATGGGGATGG - Intronic
1056811873 9:89771359-89771381 TGGGACCAGTACCATGGGAAAGG + Intergenic
1057301651 9:93889345-93889367 AGAGAACAGCACTAGGGGGATGG - Intergenic
1057340003 9:94191906-94191928 TGAGAACAGCACCGAAGGGATGG + Intergenic
1057602855 9:96473514-96473536 TGTGAACACCACCTTGGCGTAGG - Intronic
1057678045 9:97151352-97151374 TGAGGACAGCAGCAAGGGGATGG + Intergenic
1057937502 9:99253233-99253255 CGAGAACAGCACCATGAGCATGG + Intergenic
1057961494 9:99461749-99461771 TGAGAACACCACCAAGGGGACGG - Intergenic
1058740103 9:107934389-107934411 TGAGAACAGCACCAAACGGATGG - Intergenic
1058768930 9:108211625-108211647 TTTGGCCAGCACCAAGGGGAAGG - Intergenic
1059034212 9:110735899-110735921 TGAGAACAGCACTGAGGGGATGG + Intronic
1059072568 9:111154192-111154214 TGTGAACAGCTACATGCTGAGGG + Intergenic
1059362756 9:113758475-113758497 TGGGAACAGCACTAGGAGGATGG + Intergenic
1059612800 9:115917230-115917252 TGAGAACAGCACCAAGGGAATGG + Intergenic
1059617431 9:115966622-115966644 TGAGAACAGCACCAAAGGGTTGG + Intergenic
1059765368 9:117378899-117378921 CTAGAACAGCACCAAGGGGATGG - Intronic
1059946470 9:119413570-119413592 TGAGTACAGCATCAAGGGGATGG + Intergenic
1060046739 9:120347522-120347544 TGAGAATAGCACAAAGGGGATGG - Intergenic
1060505552 9:124195472-124195494 TGAGGGCAGCACCAAGGGGATGG + Intergenic
1060702863 9:125774239-125774261 TGAGAACAGCACTAGGGGGATGG + Intronic
1062245694 9:135565009-135565031 TGTGCTCAGAAACATGGGGAAGG - Intronic
1203695605 Un_GL000214v1:94578-94600 TATGAACAATATCATGGGGAGGG - Intergenic
1203742058 Un_GL000218v1:11737-11759 TATGAACAATATCATGGGGAGGG + Intergenic
1203702256 Un_KI270742v1:6327-6349 TATGAACAATATCATGGGGAGGG + Intergenic
1203708150 Un_KI270742v1:71029-71051 TGAGGACAGTACCAAGGGGATGG - Intergenic
1203543228 Un_KI270743v1:108912-108934 TGAGGACAGTACCAAGGGGATGG + Intergenic
1203554235 Un_KI270743v1:192383-192405 TATGAACAATATCATGGGGAGGG + Intergenic
1203640668 Un_KI270751v1:9485-9507 TATGAACAATATCATGGGGAGGG + Intergenic
1185891697 X:3827898-3827920 TGAGAGCAGCACCAAGCGGATGG - Intronic
1185896806 X:3866312-3866334 TGAGAGCAGCACCAAGCGGATGG - Intergenic
1185901924 X:3904739-3904761 TGAGAGCAGCACCAAGCGGATGG - Intergenic
1186003253 X:5038638-5038660 TGAGAACAACACCAAAGGGATGG - Intergenic
1186151846 X:6683065-6683087 TGAGAACAACACCAAGAGGATGG + Intergenic
1186541180 X:10402130-10402152 TGAGAACAGCACCAAAGAGAAGG + Intergenic
1186712343 X:12212450-12212472 TAGGAACAGCACCATGGGGATGG + Intronic
1186850639 X:13576332-13576354 TGAGGACAACACCAAGGGGATGG + Intronic
1187043632 X:15623814-15623836 TGAGAACAGGACCAAGAGGATGG - Intergenic
1187091154 X:16098308-16098330 TGAGAACACCACCAAGAGGATGG - Intergenic
1187217305 X:17289576-17289598 TGAGAACAGCACTAGGGGGATGG + Intergenic
1187959806 X:24557839-24557861 TAGGAACAGCACCACGTGGAGGG - Intergenic
1188045342 X:25419940-25419962 TGAGAACAGCACCAAGAGTATGG - Intergenic
1188138193 X:26515408-26515430 TGAGAATAGCACCAAAGGGATGG - Intergenic
1188370434 X:29363792-29363814 CTAGAACAGCACCAAGGGGATGG + Intronic
1188408830 X:29845945-29845967 TGAGGACAGCACCAAGGGCATGG + Intronic
1188422864 X:30010829-30010851 TGTGAAGAGCACCATGTGACAGG - Intergenic
1188673239 X:32906184-32906206 CGAGAACAGCATCAAGGGGATGG - Intronic
1188775669 X:34215549-34215571 AGAGGACAGCACCAAGGGGATGG - Intergenic
1188973568 X:36646650-36646672 TGAGAACAGCACTAAGGGGATGG - Intergenic
1189094234 X:38121175-38121197 TGAGGACAGCACCAAGGGGACGG + Intronic
1189163568 X:38836224-38836246 TGAGCACAGCATCATGTGGATGG - Intergenic
1189213503 X:39304036-39304058 TGAGAACAGCAACAAGGCGATGG - Intergenic
1189220100 X:39364199-39364221 TGAGAACAGCACAAGGAGGATGG - Intergenic
1189431555 X:40951707-40951729 TAAGAACAGCACCAAAGGGATGG + Intergenic
1189888576 X:45576103-45576125 TGAGAACAGTACCAAGAGGATGG - Intergenic
1190145690 X:47889869-47889891 TGAGAACAGCACCAAGGGGATGG + Intronic
1190322797 X:49188363-49188385 TCTTCACTGCACCATGGGGAGGG + Exonic
1190558914 X:51668208-51668230 GGAGAAAAGCACCAAGGGGATGG - Intergenic
1190565377 X:51725114-51725136 GGAGAAAAGCACCAAGGGGATGG + Intergenic
1190704679 X:53017018-53017040 TCAGGACAGCACCACGGGGATGG - Intergenic
1190790460 X:53695204-53695226 TGGGACCAGCACCATGGAGCAGG + Intergenic
1191041625 X:56087356-56087378 TGAGAAAAGCATCAAGGGGATGG - Intergenic
1191802272 X:65094028-65094050 TGAGAACAGCACCAAAGGAATGG - Intergenic
1191877589 X:65811913-65811935 TGAAAACAGCACCAAAGGGATGG - Intergenic
1192388900 X:70704013-70704035 TGAGAATAGCACCAAAGGGATGG - Intronic
1192706781 X:73534377-73534399 TGAGAATAGCACCAAGGGTATGG - Intergenic
1192912897 X:75624072-75624094 TGAGAACAGCACCAAGGTGATGG + Intergenic
1193070325 X:77299533-77299555 TTTGAACAGTACCAAGGGGAGGG - Intergenic
1193090967 X:77493830-77493852 TGAGAACAGCACAAAGGGGATGG + Intergenic
1193205098 X:78738998-78739020 TGAGGACAGCACCAATGGGATGG + Intergenic
1193547169 X:82844856-82844878 TGAGAACAGCACCAAGGAGATGG - Intergenic
1193619692 X:83736977-83736999 TGAGAACAGCATTATGGGGATGG - Intergenic
1193929598 X:87535813-87535835 TGAGAACAGCACCAAAAGGATGG - Intronic
1194092622 X:89597936-89597958 TAAGAACAGCACCAAGGGGGTGG + Intergenic
1194394757 X:93368732-93368754 TGAAGACAGCACCAAGGGGATGG + Intergenic
1194419159 X:93650547-93650569 TGAGAACAGCACCAAGGAAATGG - Intergenic
1194559059 X:95397615-95397637 TGAGGACAGCACCAAGGGGATGG - Intergenic
1194961681 X:100243462-100243484 CGAGAATAGCACCAAGGGGATGG + Intergenic
1194993585 X:100570411-100570433 TGTGAACAGCAGAATGGGGGTGG - Intergenic
1195512419 X:105732383-105732405 TGAGAACAGCACCAAAGGGATGG - Intronic
1196599221 X:117582961-117582983 TGAGAATAGCACCAAGGGGATGG - Intergenic
1198171096 X:134105855-134105877 TGAGAACAGCATTGTGGGGATGG - Intergenic
1198261929 X:134972776-134972798 TGAAAACAGCACTAGGGGGATGG - Intergenic
1198309614 X:135417712-135417734 TGACAACAGCACCAAGGGGATGG - Intergenic
1198456291 X:136821180-136821202 TGAGAACAGTACCAAGGGGATGG + Intergenic
1198571885 X:137966082-137966104 TGAGGGCAGCACCAAGGGGATGG + Intergenic
1198947246 X:142028568-142028590 TGAGAACAGCACTAGAGGGATGG - Intergenic
1198999363 X:142615923-142615945 TGAGAACAGTACCAAGGAGATGG - Intergenic
1199148059 X:144394991-144395013 TGAGGACAGCACCATGGGAATGG + Intergenic
1199263500 X:145803288-145803310 TGTTAACACTACCTTGGGGAGGG - Intergenic
1199383095 X:147193369-147193391 TGAGAACAGCACCAAAGGGATGG - Intergenic
1199384444 X:147207624-147207646 TGAGAACAGCACCAAAGGGATGG - Intergenic
1199385271 X:147216285-147216307 TGAGAACAGCACCAAAGGGATGG - Intergenic
1200009480 X:153110267-153110289 CGAGGACAGCACCAGGGGGATGG - Intergenic
1200030120 X:153289655-153289677 CGAGGACAGCACCAGGGGGATGG + Intergenic
1200445269 Y:3254039-3254061 TAAGAACAGCACCAAGGGGGTGG + Intergenic
1201155589 Y:11129213-11129235 TATGAACAATATCATGGGGAGGG + Intergenic
1202265227 Y:23011075-23011097 TGGGTACAGCACCAAGGTGAGGG + Intergenic
1202418218 Y:24644817-24644839 TGGGTACAGCACCAAGGTGAGGG + Intergenic
1202452568 Y:25025269-25025291 TGGGTACAGCACCAAGGTGAGGG - Intergenic