ID: 1152751624

View in Genome Browser
Species Human (GRCh38)
Location 17:82065147-82065169
Sequence GGTACTGGAGCGGCCTTAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152751624_1152751629 -4 Left 1152751624 17:82065147-82065169 CCTTCTAAGGCCGCTCCAGTACC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1152751629 17:82065166-82065188 TACCACCGTTGGGTCACACGCGG 0: 1
1: 0
2: 0
3: 1
4: 20
1152751624_1152751642 28 Left 1152751624 17:82065147-82065169 CCTTCTAAGGCCGCTCCAGTACC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1152751642 17:82065198-82065220 AGGCGGGGGTCGGTGCAGGCTGG 0: 1
1: 0
2: 4
3: 36
4: 324
1152751624_1152751637 12 Left 1152751624 17:82065147-82065169 CCTTCTAAGGCCGCTCCAGTACC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1152751637 17:82065182-82065204 CACGCGGGGGCACTAAAGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 36
1152751624_1152751638 13 Left 1152751624 17:82065147-82065169 CCTTCTAAGGCCGCTCCAGTACC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1152751638 17:82065183-82065205 ACGCGGGGGCACTAAAGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 24
1152751624_1152751641 24 Left 1152751624 17:82065147-82065169 CCTTCTAAGGCCGCTCCAGTACC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1152751641 17:82065194-82065216 CTAAAGGCGGGGGTCGGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1152751624_1152751630 -3 Left 1152751624 17:82065147-82065169 CCTTCTAAGGCCGCTCCAGTACC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1152751630 17:82065167-82065189 ACCACCGTTGGGTCACACGCGGG 0: 1
1: 0
2: 0
3: 1
4: 33
1152751624_1152751632 -2 Left 1152751624 17:82065147-82065169 CCTTCTAAGGCCGCTCCAGTACC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1152751632 17:82065168-82065190 CCACCGTTGGGTCACACGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 17
1152751624_1152751633 -1 Left 1152751624 17:82065147-82065169 CCTTCTAAGGCCGCTCCAGTACC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1152751633 17:82065169-82065191 CACCGTTGGGTCACACGCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1152751624_1152751636 11 Left 1152751624 17:82065147-82065169 CCTTCTAAGGCCGCTCCAGTACC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1152751636 17:82065181-82065203 ACACGCGGGGGCACTAAAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 29
1152751624_1152751635 8 Left 1152751624 17:82065147-82065169 CCTTCTAAGGCCGCTCCAGTACC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1152751635 17:82065178-82065200 GTCACACGCGGGGGCACTAAAGG 0: 1
1: 0
2: 0
3: 2
4: 36
1152751624_1152751640 18 Left 1152751624 17:82065147-82065169 CCTTCTAAGGCCGCTCCAGTACC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1152751640 17:82065188-82065210 GGGGCACTAAAGGCGGGGGTCGG 0: 1
1: 0
2: 0
3: 15
4: 137
1152751624_1152751639 14 Left 1152751624 17:82065147-82065169 CCTTCTAAGGCCGCTCCAGTACC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1152751639 17:82065184-82065206 CGCGGGGGCACTAAAGGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152751624 Original CRISPR GGTACTGGAGCGGCCTTAGA AGG (reversed) Exonic