ID: 1152751627

View in Genome Browser
Species Human (GRCh38)
Location 17:82065157-82065179
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 54}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152751627_1152751638 3 Left 1152751627 17:82065157-82065179 CCGCTCCAGTACCACCGTTGGGT 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1152751638 17:82065183-82065205 ACGCGGGGGCACTAAAGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 24
1152751627_1152751637 2 Left 1152751627 17:82065157-82065179 CCGCTCCAGTACCACCGTTGGGT 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1152751637 17:82065182-82065204 CACGCGGGGGCACTAAAGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 36
1152751627_1152751636 1 Left 1152751627 17:82065157-82065179 CCGCTCCAGTACCACCGTTGGGT 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1152751636 17:82065181-82065203 ACACGCGGGGGCACTAAAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 29
1152751627_1152751635 -2 Left 1152751627 17:82065157-82065179 CCGCTCCAGTACCACCGTTGGGT 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1152751635 17:82065178-82065200 GTCACACGCGGGGGCACTAAAGG 0: 1
1: 0
2: 0
3: 2
4: 36
1152751627_1152751643 25 Left 1152751627 17:82065157-82065179 CCGCTCCAGTACCACCGTTGGGT 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1152751643 17:82065205-82065227 GGTCGGTGCAGGCTGGAGAACGG 0: 1
1: 0
2: 2
3: 23
4: 323
1152751627_1152751642 18 Left 1152751627 17:82065157-82065179 CCGCTCCAGTACCACCGTTGGGT 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1152751642 17:82065198-82065220 AGGCGGGGGTCGGTGCAGGCTGG 0: 1
1: 0
2: 4
3: 36
4: 324
1152751627_1152751640 8 Left 1152751627 17:82065157-82065179 CCGCTCCAGTACCACCGTTGGGT 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1152751640 17:82065188-82065210 GGGGCACTAAAGGCGGGGGTCGG 0: 1
1: 0
2: 0
3: 15
4: 137
1152751627_1152751641 14 Left 1152751627 17:82065157-82065179 CCGCTCCAGTACCACCGTTGGGT 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1152751641 17:82065194-82065216 CTAAAGGCGGGGGTCGGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1152751627_1152751639 4 Left 1152751627 17:82065157-82065179 CCGCTCCAGTACCACCGTTGGGT 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1152751639 17:82065184-82065206 CGCGGGGGCACTAAAGGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152751627 Original CRISPR ACCCAACGGTGGTACTGGAG CGG (reversed) Exonic