ID: 1152751629 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:82065166-82065188 |
| Sequence | TACCACCGTTGGGTCACACG CGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 22 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 20} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1152751623_1152751629 | -3 | Left | 1152751623 | 17:82065146-82065168 | CCCTTCTAAGGCCGCTCCAGTAC | 0: 1 1: 0 2: 0 3: 5 4: 41 |
||
| Right | 1152751629 | 17:82065166-82065188 | TACCACCGTTGGGTCACACGCGG | 0: 1 1: 0 2: 0 3: 1 4: 20 |
||||
| 1152751624_1152751629 | -4 | Left | 1152751624 | 17:82065147-82065169 | CCTTCTAAGGCCGCTCCAGTACC | 0: 1 1: 0 2: 0 3: 3 4: 40 |
||
| Right | 1152751629 | 17:82065166-82065188 | TACCACCGTTGGGTCACACGCGG | 0: 1 1: 0 2: 0 3: 1 4: 20 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1152751629 | Original CRISPR | TACCACCGTTGGGTCACACG CGG | Exonic | ||