ID: 1152751631

View in Genome Browser
Species Human (GRCh38)
Location 17:82065168-82065190
Sequence CCCCGCGTGTGACCCAACGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 19}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152751631_1152751637 -9 Left 1152751631 17:82065168-82065190 CCACCGTTGGGTCACACGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1152751637 17:82065182-82065204 CACGCGGGGGCACTAAAGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 36
1152751631_1152751642 7 Left 1152751631 17:82065168-82065190 CCACCGTTGGGTCACACGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1152751642 17:82065198-82065220 AGGCGGGGGTCGGTGCAGGCTGG 0: 1
1: 0
2: 4
3: 36
4: 324
1152751631_1152751636 -10 Left 1152751631 17:82065168-82065190 CCACCGTTGGGTCACACGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1152751636 17:82065181-82065203 ACACGCGGGGGCACTAAAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 29
1152751631_1152751639 -7 Left 1152751631 17:82065168-82065190 CCACCGTTGGGTCACACGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1152751639 17:82065184-82065206 CGCGGGGGCACTAAAGGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 66
1152751631_1152751643 14 Left 1152751631 17:82065168-82065190 CCACCGTTGGGTCACACGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1152751643 17:82065205-82065227 GGTCGGTGCAGGCTGGAGAACGG 0: 1
1: 0
2: 2
3: 23
4: 323
1152751631_1152751640 -3 Left 1152751631 17:82065168-82065190 CCACCGTTGGGTCACACGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1152751640 17:82065188-82065210 GGGGCACTAAAGGCGGGGGTCGG 0: 1
1: 0
2: 0
3: 15
4: 137
1152751631_1152751638 -8 Left 1152751631 17:82065168-82065190 CCACCGTTGGGTCACACGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1152751638 17:82065183-82065205 ACGCGGGGGCACTAAAGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 24
1152751631_1152751641 3 Left 1152751631 17:82065168-82065190 CCACCGTTGGGTCACACGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1152751641 17:82065194-82065216 CTAAAGGCGGGGGTCGGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152751631 Original CRISPR CCCCGCGTGTGACCCAACGG TGG (reversed) Exonic