ID: 1152751634

View in Genome Browser
Species Human (GRCh38)
Location 17:82065171-82065193
Sequence TGCCCCCGCGTGTGACCCAA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 48}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152751634_1152751643 11 Left 1152751634 17:82065171-82065193 CCGTTGGGTCACACGCGGGGGCA 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1152751643 17:82065205-82065227 GGTCGGTGCAGGCTGGAGAACGG 0: 1
1: 0
2: 2
3: 23
4: 323
1152751634_1152751641 0 Left 1152751634 17:82065171-82065193 CCGTTGGGTCACACGCGGGGGCA 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1152751641 17:82065194-82065216 CTAAAGGCGGGGGTCGGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1152751634_1152751639 -10 Left 1152751634 17:82065171-82065193 CCGTTGGGTCACACGCGGGGGCA 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1152751639 17:82065184-82065206 CGCGGGGGCACTAAAGGCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 66
1152751634_1152751642 4 Left 1152751634 17:82065171-82065193 CCGTTGGGTCACACGCGGGGGCA 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1152751642 17:82065198-82065220 AGGCGGGGGTCGGTGCAGGCTGG 0: 1
1: 0
2: 4
3: 36
4: 324
1152751634_1152751640 -6 Left 1152751634 17:82065171-82065193 CCGTTGGGTCACACGCGGGGGCA 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1152751640 17:82065188-82065210 GGGGCACTAAAGGCGGGGGTCGG 0: 1
1: 0
2: 0
3: 15
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152751634 Original CRISPR TGCCCCCGCGTGTGACCCAA CGG (reversed) Exonic