ID: 1152751641

View in Genome Browser
Species Human (GRCh38)
Location 17:82065194-82065216
Sequence CTAAAGGCGGGGGTCGGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152751634_1152751641 0 Left 1152751634 17:82065171-82065193 CCGTTGGGTCACACGCGGGGGCA 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1152751641 17:82065194-82065216 CTAAAGGCGGGGGTCGGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1152751623_1152751641 25 Left 1152751623 17:82065146-82065168 CCCTTCTAAGGCCGCTCCAGTAC 0: 1
1: 0
2: 0
3: 5
4: 41
Right 1152751641 17:82065194-82065216 CTAAAGGCGGGGGTCGGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1152751627_1152751641 14 Left 1152751627 17:82065157-82065179 CCGCTCCAGTACCACCGTTGGGT 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1152751641 17:82065194-82065216 CTAAAGGCGGGGGTCGGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1152751631_1152751641 3 Left 1152751631 17:82065168-82065190 CCACCGTTGGGTCACACGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 19
Right 1152751641 17:82065194-82065216 CTAAAGGCGGGGGTCGGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1152751624_1152751641 24 Left 1152751624 17:82065147-82065169 CCTTCTAAGGCCGCTCCAGTACC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1152751641 17:82065194-82065216 CTAAAGGCGGGGGTCGGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1152751628_1152751641 9 Left 1152751628 17:82065162-82065184 CCAGTACCACCGTTGGGTCACAC 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1152751641 17:82065194-82065216 CTAAAGGCGGGGGTCGGTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152751641 Original CRISPR CTAAAGGCGGGGGTCGGTGC AGG Exonic
900564034 1:3323656-3323678 ACAAAGGCGAGGGCCGGTGCTGG + Intronic
901409268 1:9071537-9071559 CTAAAACCGGGGGTCGCTGGGGG + Intronic
903897804 1:26620453-26620475 CTAGAGGCGGGGGATGGGGCGGG + Intergenic
904612628 1:31733772-31733794 CTAAAAGCTGGGGTCGGGCCAGG + Intronic
905484266 1:38284488-38284510 TTAAAGGCTAGGGTAGGTGCTGG - Intergenic
908785431 1:67730514-67730536 TTTTTGGCGGGGGTCGGTGCGGG - Intronic
915505840 1:156355774-156355796 AAAAAGGCGGGGGTGGGGGCCGG - Intronic
924044141 1:240010832-240010854 CTAAAGGCAGGGGTGGATTCTGG - Intergenic
1073290474 10:102410841-102410863 CTCAAGGTGGGGGGCGGGGCAGG - Exonic
1081487478 11:43542954-43542976 CTGAAGGCTGGGGTCAGTGTAGG + Intergenic
1081773199 11:45662278-45662300 CTAAAGGCAGGGGTCAGCCCTGG - Intronic
1085266955 11:75242771-75242793 CCAGAGGCGGGGGTGGGTGAAGG - Exonic
1088764381 11:112962001-112962023 CCAAAGGCGGGCGGCGGGGCGGG + Intronic
1089583284 11:119494935-119494957 CTAGAGGCTGGGGACGGTGAGGG + Intergenic
1090304845 11:125682322-125682344 AAAATGGCGGGGGTCGGTGGGGG + Intergenic
1091389540 12:117673-117695 CTAAAGGTGTGGGTGGGGGCTGG - Intronic
1091837376 12:3595289-3595311 CTAAAGATGGGGGTGGGTGCAGG - Intergenic
1095800583 12:46267663-46267685 TTAAACGCGTGGGTCGGTGCCGG - Exonic
1096461067 12:51821662-51821684 CCATAGGCGGTGGGCGGTGCCGG + Intergenic
1096477668 12:51918174-51918196 CAAGAGGAGGGGGTCAGTGCTGG + Intronic
1111978960 13:94997012-94997034 CTAGAGGCGGGGGTGGGGGTGGG + Intergenic
1121332574 14:93058569-93058591 TACAAGGCGGGGGTGGGTGCTGG + Intronic
1121332652 14:93058793-93058815 CTTGAGGCGGGGGCGGGTGCTGG + Intronic
1121332810 14:93059242-93059264 CTCGAGGCGGGGATGGGTGCTGG + Intronic
1121413677 14:93764278-93764300 CTGAAGGCGGGGGTGGGGGAGGG - Intronic
1135656708 16:24256444-24256466 GTAAAGACGAGGGTCCGTGCAGG - Exonic
1136283946 16:29230515-29230537 CCAAAGCCGGGGGTGGGAGCGGG - Intergenic
1137426631 16:48385581-48385603 CCAAAGGCGGCAGTAGGTGCGGG + Intronic
1138495491 16:57406540-57406562 CTATAGGCTGGGGTGGGTGTTGG - Intronic
1142088978 16:88200025-88200047 CCAAAGCCGGGGGTGGGAGCGGG - Intergenic
1146370646 17:32263998-32264020 CCAAAGGAGGGGGTCGCTGTGGG - Intergenic
1146624420 17:34424746-34424768 CTAAAGGCGGGGGCGGGGGGGGG + Intergenic
1146788071 17:35735288-35735310 GTAAAGGCGGCGGGCGGTGGTGG - Exonic
1149283249 17:55131760-55131782 CTTAAGGCAGGGGTGGGTGGGGG - Intronic
1152751641 17:82065194-82065216 CTAAAGGCGGGGGTCGGTGCAGG + Exonic
1152782120 17:82231214-82231236 CTGCGGGCGGGGGTCGGCGCGGG - Intronic
1157095247 18:44680742-44680764 CAAAAGGCGGGGGGCGGAGGGGG - Intronic
1160163290 18:76491436-76491458 ACAAAGGCGGGGGTCTGTGCGGG - Intronic
1160297129 18:77649181-77649203 CTTAAGGCGGGGATCTGTGGAGG + Intergenic
1162000294 19:7740430-7740452 CTAGAGGGGCGGGGCGGTGCCGG + Exonic
1165907738 19:39203919-39203941 CTCCAGGCGCGGGTAGGTGCCGG + Exonic
1166531255 19:43544828-43544850 GTAAAGGCGGGGGTCGGGGGGGG + Intronic
927228849 2:20799679-20799701 CTAAAGGCTGGGAAGGGTGCAGG - Intronic
935958355 2:108400356-108400378 AAAAAGGCGGGGGTCTGTCCTGG - Intergenic
936380002 2:111975951-111975973 CTAAAGGCTGGGGACGGGGTTGG - Intronic
936577320 2:113667697-113667719 GTGAAGGTGGGGGTCGGGGCTGG + Intergenic
942455720 2:176136962-176136984 CTACAGGCGGCGGTCGGTCCGGG - Intergenic
947761473 2:232606572-232606594 TTAAAGATGAGGGTCGGTGCAGG - Intronic
1175963172 20:62647303-62647325 CTCAGGGCGGGGCTGGGTGCAGG + Intronic
1177108486 21:16992542-16992564 CTGATGGCGGGGGTGGGGGCGGG + Intergenic
1178487758 21:33029730-33029752 CTCAAGGCGGGGGTGGCCGCTGG - Intergenic
1179959545 21:44760413-44760435 CTACAGGCGCGGGTGGGTGAAGG + Intergenic
1183361915 22:37387217-37387239 CTGAAGGTGGGGGTGGGAGCAGG - Intronic
1185204690 22:49531108-49531130 CCACAGGCAGGGGTGGGTGCAGG - Intronic
1185422911 22:50744967-50744989 GTGAAGGTGGGGGTCGGGGCTGG - Exonic
954136065 3:48582717-48582739 CTAGAGGCTGGGGTGGGGGCTGG + Intronic
960997991 3:123352078-123352100 CTCAAGGCGGGGTGCAGTGCGGG + Intronic
965959545 3:174412602-174412624 CTCAAGGCAGGGGTGGGTGGAGG - Intergenic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968662539 4:1804748-1804770 GTACAGCCGGGGGTCAGTGCTGG - Intronic
977667301 4:99655676-99655698 CTTAAGATGGGGGTCTGTGCTGG + Intergenic
985490076 5:174144-174166 CTAGGGGCAGGGGTCGGGGCTGG + Intronic
985549333 5:525049-525071 CTAAAGGCAGGGGATGGGGCAGG - Intergenic
987063041 5:14261001-14261023 TTTAAGGAGGGGGTAGGTGCAGG - Intronic
997429144 5:133825583-133825605 CTATCCGCGGGGGTGGGTGCAGG + Intergenic
1015880662 6:137867413-137867435 CCGCAGGCGGGGGTCGGGGCAGG - Exonic
1020105046 7:5418952-5418974 GGAAAGGTGGGGGCCGGTGCTGG - Intronic
1025032873 7:55571990-55572012 CTAACGGAGGCGGTCGGCGCGGG + Intronic
1029492148 7:100876794-100876816 CTAAAGGAGGGGAGCGGTGCTGG + Intronic
1030812313 7:113989504-113989526 CTGAAGGTGGGGGTGGGGGCTGG - Intronic
1033238745 7:139659468-139659490 CTGCAGCCGGGGGTCTGTGCTGG - Intronic
1052971741 9:34380926-34380948 CCGCAGGCGGCGGTCGGTGCAGG + Exonic
1053049432 9:34947009-34947031 CTAAAGGCGAGGGTTGCTGTTGG - Intergenic
1053271895 9:36755740-36755762 CTGAAGGCTGGGATGGGTGCAGG + Intergenic
1053779680 9:41592934-41592956 CTAAAGGCTGGGGTGGCTGTGGG - Intergenic
1054167636 9:61803175-61803197 CTAAAGGCTGGGGTGGCTGTGGG - Intergenic
1054669907 9:67777730-67777752 CTAAAGGCTGGGGTGGCTGTGGG + Intergenic
1057125063 9:92610469-92610491 CTAAATTCGCGGGTCGGTTCTGG + Intronic
1058838386 9:108880222-108880244 CTAAAGGCGGGGAGCAGTGAAGG + Intronic
1060587903 9:124797993-124798015 GTAAAGGCAGGGCTCAGTGCTGG + Intronic
1062321242 9:135991397-135991419 CTAAAGGGGGAGGGCAGTGCTGG - Intergenic
1062682362 9:137788662-137788684 CTGCAGGCGGGAGTCGCTGCGGG + Intronic
1188505844 X:30883906-30883928 CTAAAGGCTAGAGTCTGTGCAGG - Intronic